
[Cancer Research 64, 2984-2987, May 1, 2004]
© 2004 American Association for Cancer Research
Depletion of Methionine Aminopeptidase 2 Does Not Alter Cell Response to Fumagillin or Bengamides
Sunkyu Kim,
Kenneth LaMontagne,
Michael Sabio,
Sushil Sharma,
Richard W. Versace,
Naeem Yusuff and
Penny E. Phillips
Novartis Pharmaceuticals, East Hanover, New Jersey
 |
ABSTRACT
|
|---|
Inhibition of endothelial cell growth by fumagillin has been assumed to be mediated by inhibition of the molecular target methionine aminopeptidase 2 (MetAp2). New data show that depletion of MetAp2 by siRNA does not inhibit endothelial cell growth. Moreover, MetAp2-depleted endothelial cells remain responsive to inhibition by either fumagillin or a newly identified MetAp2 enzyme inhibitor. These data suggest that MetAp2 function is not required for endothelial cell proliferation.
 |
Introduction
|
|---|
The methionine aminopeptidases (MetAp) are a class of proteases that selectively remove methionine from the NH2 terminus of newly synthesized proteins (1)
. Two isoforms of MetAps have been identified in humans (2, 3, 4)
. The human MetAp2 isoform has been of considerable interest as a target for cancer chemotherapy, after the discovery that the antiangiogenic natural compound fumagillin is a covalent inhibitor selective for MetAp2 (5, 6, 7)
. On the basis of the antiangiogenic activity observed in vitro, a fumagillin analog TNP-470 has progressed to clinical trials (8)
; however, the compound has demonstrated dose limiting neurotoxicity (9)
.
A second family of natural products, the bengamides, has recently been identified as inhibitors of both MetAp isoforms (10)
. In contrast to fumagillin, bengamides and a synthetic analogue, LAF389, inhibit growth of tumor epithelial cells as well as endothelial cells. In an effort to test the hypothesis that inhibition of MetAp2 results in selective inhibition of endothelial cell growth, we prepared a series of bengamide analogues and tested their activity in MetAp enzyme and cell proliferation assays. The current data demonstrate that MetAp2 can be selectively inhibited by a bengamide analogue but that this compound does not selectively inhibit endothelial cell proliferation. Furthermore, endothelial cell proliferation is unaffected by selective depletion of MetAp2 through use of a targeting small interfering (si)RNA. Finally, endothelial cells depleted of MetAp2 by siRNA treatment remain sensitive to growth inhibition by either fumagillin or the MetAp2-selective bengamide. Taken together, these data show that MetAp2 is not the target for the antiangiogenic effects of fumagillin.
 |
Materials and Methods
|
|---|
Cell and Enzyme Assays.
A549 and H1299 non-small cell lung cancer cell lines were purchased from American Type Culture Collection. Fumagillin was purchased from Sigma. Human umbilical vein endothelial cells and human aortic endothelial cells were purchased from Clonetics and cultured as recommended by the vendor. LBM648 and LAF389 were synthesized as described previously (11
, 12)
. LBM648, LAF389, and fumagillin were dissolved in DMSO at 1000-fold final concentrations and added to cells in culture. DMSO was included at 0.1% final concentration in all vehicle control samples. Cell culture, production of recombinant human MetAp1 and 2, and MetAp enzyme assays have been described previously (10)
. For Fig. 2, C and D
, cell proliferation was measured by 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxy-phenyl)-2-(4-sulfonyl)-2H-tetrazolium assay. One-hundred percent growth refers to cell number of vehicle-treated cells after 72 h, corrected for initial plating density. Cell growth was normalized to initial cell number as described (10)
. For Figs. 2B
and 3AC
, cell growth was measured by bromodeoxyuridine (BrdUrd) incorporation. BrdUrd was added to cells in the final 2 h of the indicated times of cell growth. BrdUrd incorporation into cells was measured using a cell proliferation ELISA kit (catalogue no. RPN250; Amersham Bioscience) according to manufacturers specifications. One-hundred percent growth refers to the incorporation of BrdUrd in cells treated with vehicle control. MetAp2 suppression was performed using an siRNA sequence designed as described previously (13)
. The targeting sequence was AAUGCCGGUGACACAACAUGA (Dharmacon Research). The control mismatch sequence was AAUGCCGGCGCUACAACAUGA. Duplex RNA was introduced into epithelial tumor cells using LipofectAMINE 2000 (Invitrogen) according to the manufacturers protocol. Duplex RNA was introduced into endothelial cells by electroporation. All data are the average ± SE of triplicate determinations from a representative experiment repeated at least twice.

View larger version (32K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 3. Methionine aminopeptidase 2 (MetAp2) small interfering (si)RNA effects on endothelial cells. A, human aortic endothelial cells (HAECs) and human umbilical vein endothelial cells (HUVECs) were treated with MetAp2 siRNA (2) or control siRNA (2C). Bromodeoxyuridine incorporation was measured after 48 h as described in "Materials and Methods." B and C, growth of siRNA-treated HAECs was measured after 72-h exposure to LBM648 (B) or fumagillin (C). Insets show MetAp2 levels measured in cells after 72 h; actin levels (data not shown) were identical in control siRNA and MetAp2 siRNA-treated cells. D, proliferation of HUVECs after treatment with control siRNA (left) or MetAp2 siRNA (right). Cell number was measured by counting trypsinized cells in a Coulter counter after 72 h of growth in the presence of vehicle or basic fibroblast growth factor (bFGF) and in the presence of the indicated concentrations of fumagillin. Each sample was counted twice, and the average of the triplicate control wells (i.e., stimulated cells with DMSO only) determined the percentage of control values for the test wells and the negative control wells. The graphs were generated by SigmaPlot, and the significance (P) was determined by a t test (SigmaStat). Asterisks indicate P < 0.01.
|
|
Human Endothelial Cell Response to Basic Fibroblast Growth Factor.
Human umbilical vein endothelial cells and human aortic endothelial cells were transfected with siRNA as previously described (10)
, plated at 12,500 cells/well of a 24-well plate, and incubated overnight at 37°C, 5% CO2. Fresh media (EBM-2, Clonetics, + 2% fetal bovine serum) containing fumagillin were added for 30 min. After this pretreatment, cells received either vehicle control or 10 nM basic fibroblast growth factor and cultured for 72 h. Cells were trypsinized, and cell number was determined by Coulter counter.
 |
Results
|
|---|
A number of analogues of the bengamide LAF389 were prepared and screened for MetAp2 specificity. A methyl-substituted analogue of LAF389 (Fig. 1)
, despite a relatively modest structural modification, was found to be specific for the desired isoform. LBM648 inhibited MetAp2 with a 0.38 µM IC50, equivalent to LAF389 but had no activity on MetAp1, even at 10 µM (Table 1)
.
View this table:
[in this window]
[in a new window]
|
Table 1 IC50s for LAF389 and LBM648 on human methionine aminopeptidase (MetAp)1 and MetAp2
MetAp1 and MetAp2 enzyme assays were performed using recombinant enzyme and a methionine-alanine-serine substrate as described previously (10)
.
|
|
The effect of LBM648 on cell proliferation was assayed on several epithelial cell lines and on human umbilical vein endothelial cells. Compared with the nonselective MetAp inhibitor LAF389, LBM648 was 310-fold less potent on epithelial tumor lines (Table 2)
. The increase in MetAp2 enzyme selectivity of LBM648 did not result in increased selectivity for endothelial growth inhibition, compared with LAF389. Several additional MetAp2-selective bengamide analogues were also as potent on epithelial cells as on endothelial cells (data not shown), thus challenging the hypothesis that small molecule inhibition of MetAp2 necessarily results in selective inhibition of endothelial cell growth.
View this table:
[in this window]
[in a new window]
|
Table 2 Antiproliferative IC50s for LAF389 and LBM648
Cell proliferation was measured at 72 h by 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxy-phenyl)-2-(4-sulfonyl)-2H-tetrazolium. Details of the procedures have been reported previously (10)
.
|
|
In an alternative approach to address the role of MetAp2 in cell proliferation, we prepared cells depleted in MetAp2 using siRNA. As has previously been reported (10)
, treatment of epithelial cells with MetAp2 siRNA reduced MetAp2 protein within 24 h to a level at or below the detection level of Western blots (Fig. 2)
. In H1299 epithelial cells, reduction of MetAp2 by the targeting sequence was specific; MetAp2 protein levels were not reduced in cells treated with a sequence containing 3 mismatch bases, and actin levels were identical in cells treated with the MetAp2 targeting sequence and the mismatch sequence. Reduction of MetAp2 protein by siRNA caused appearance of an unprocessed form of 14-3-3
, showing that MetAp2 enzyme function was also substantially reduced in these cells. No difference in growth was observed in H1299 cells depleted of MetAp2, as measured by incorporation of BrdUrd (Fig. 2B)
, suggesting that in these cells MetAp2 activity is not limiting for cell growth. Surprisingly, H1299 cells depleted of MetAp2 by siRNA remained completely responsive to growth inhibition by LBM648; growth inhibition curves were superimposable in H1299 cells treated with the mismatch siRNA sequence versus cells treated with the MetAp2 siRNA sequence (Fig. 2C)
. A549 cells treated with MetAp2 siRNA also showed no change in response to LBM648 compared with cells treated with the mismatch sequence (Fig. 2D)
.
A more stringent test of MetAp2s role in cell growth was performed using primary endothelial cells. Endothelial cells have been suggested to have an absolute requirement for MetAp2 function for growth based on the antiproliferative effects seen with fumagillin and analogues (6
, 7
, 14)
. This would suggest that reduction of MetAp2 protein should inhibit endothelial cell growth. To test this hypothesis, MetAp2 protein levels were specifically reduced by treatment with siRNA in human umbilical vein and human aortic endothelial cells. In both types of endothelial cells, proliferation in complete growth medium was unaffected by reduction of MetAp2 protein to <5% of control levels (Fig. 3A)
. This experiment could not rule out the possibility that the remaining levels of MetAp2 protein in siRNA-treated cells were sufficient for endothelial cell growth. Human aortic endothelial cells treated with MetAp2-specific siRNA were therefore challenged with the MetAp2 enzyme inhibitors LBM648 (Fig. 3B)
and fumagillin (Fig. 3C)
. The ability of both compounds to inhibit proliferation of human aortic endothelial cells was unaltered in cells depleted of MetAp2 protein compared with either control, untreated human aortic endothelial, or to human aortic endothelial cells treated with the mismatch siRNA sequence. Human umbilical vein endothelial cells depleted of MetAp2 also retained the ability to respond to fumagillin, whether growth was measured under serum-depleted conditions, or in response to a basic fibroblast growth factor stimulus (Fig. 3D)
.
Taken together, these data demonstrate that MetAp2 is not required for endothelial cell proliferation and that two different classes of MetAp2 enzyme inhibitors remain effective inhibitors of cell growth on cells depleted of their putative target. One question left unanswered by these surprising results is the nature of the target(s) for fumagillin and LBM648 and whether this target is common to both inhibitors. The activity of the compounds in MetAp2-depleted endothelial cells is particularly puzzling because both classes of inhibitors have been cocrystalized with human MetAp2 (10
, 15)
. One possibility is that another member of the MetAp family exists in humans; the current data could be resolved by showing the presence of a third MetAp enzyme expressed and active in endothelial cells but able to be inhibited by both fumagillin and bengamide analogues. Indeed, a recent publication has proposed such an enzyme based on sequence homology, although no enzymatic activity of the putative new MetAp isoform, was shown (16)
. Regardless of the existence of a third MetAp isoform or some other unrelated antiproliferative target, the current data are sufficient to challenge the hypothesis that inhibition of MetAp2 by fumagillin or bengamide analogues is the mechanism by which these compounds exert their antiangiogenic effects. Given that clinical trials are in progress with fumagillin analogues (17)
, additional target-finding experiments are clearly called for to elucidate the molecular targets of these compounds.
 |
FOOTNOTES
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Requests for reprints: Penny Phillips, Novartis Pharmaceuticals, One Health Plaza, East Hanover, NJ 07936.
Received 1/ 7/04.
Revised 3/12/04.
Accepted 3/17/04.
 |
REFERENCES
|
|---|
- Lowther WT, Matthews BW Structure and function of the methionine aminopeptidases. Biochim Biophys Acta, 1477: 157-67, 2000.[CrossRef][Medline]
- Li X, Chang Y-H Molecular cloning of a human complementary DNA encoding an initiation factor 2-associated protein (p67). Biochim Biophys Acta, 1260: 333-6, 1995.[Medline]
- Li X, Chang Y-H Evidence that the human homologue of a Rat initiation factor-2 associated protein (p67) is a methionine aminopeptidase. Biochem Biophys Res Comm, 227: 152-9, 1996.[CrossRef][Medline]
- Nagase T, Miyajima N, Tanaka A, et al Prediction of the coding sequences of unidentified human genes. III. The coding sequences of 40 new genes (KIAA0081-KIAA0120) deduced by analysis of cDNA clones from human cell line KG-1. DNA Res, 2: 37-43, 1995.[Abstract]
- Ingber D, Fujita T, Kishimoto S, et al Synthetic analogues of fumagillin that inhibit angiogenesis and suppress tumour growth. Nature (Lond.), 348: 555-7, 1990.[CrossRef][Medline]
- Sin N, Meng L, Wang MQW, Wen JJ, Bornmann WG, Crews CM The anti-angiogenic agent fumagillin covalently binds and inhibits the methionine aminopeptidase, MetAP-2. Proc Natl Acad Sci USA, 94: 6099-103, 1997.[Abstract/Free Full Text]
- Griffith EC, Su Z, Turk BE, et al Methionine aminopeptidase (type 2) is the common target for angiogenesis inhibitors AGM-1470 and ovalicin. Chem Biol, 4: 461-71, 1997.[CrossRef][Medline]
- Kruger EA, Figg WD TNP-470: an angiogenesis inhibitor in clinical development for cancer. Exp Opin Investig Drugs, 9: 1383-96, 2000.
- Logothetis CJ, Wu KK, Finn LD, et al Phase I trial of the angiogenesis inhibitor TNP-470 for progressive androgen-independent prostate cancer. Clin Cancer Res, 7: 1198-203, 2001.[Abstract/Free Full Text]
- Towbin H, Bair KW, DeCaprio JA, et al Proteomics based target identification: Bengamides as a new class of methionine aminopeptidase inhibitors. J Biol Chem, 278: 52964-71, 2003.[Abstract/Free Full Text]
- Clark TJ. Part I. Total synthesis of bengamide z. Part II. Studies toward asymmetric acylation of
-oxygenated imides. (2001), 225 pp. CAN 137:278990 AN 2002:750153 CAPLUS.
- Kinder FR, Versace RW, Bair KB, et al Synthesis and antitumor activity of ester-modified analogues of bengamide B. J Med Chem, 44: 3692-9, 2001.[CrossRef][Medline]
- Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature (Lond.), 411: 494-8, 2001.[CrossRef][Medline]
- Griffith EC, Su Z, Niwayama S, Ramsay CA, Chang Y-H, Liu JO Molecular recognition of angiogenesis inhibitors fumagillin and ovalicin by methionine aminopeptidase 2. Proc Natl Acad Sci USA, 95: 15183-8, 1998.[Abstract/Free Full Text]
- Liu S, Widom J, Kemp CW, Crews CM, Clardy J Structure of human methionine aminopeptidase-2 complexed with fumagillin. Science (Wash. DC), 282: 1324-7, 1998.[Abstract/Free Full Text]
- Serero A, Giglione C, Sardini A, Martinez-Sanz J, Meinnel T An unusual peptide deformylase features in the human mitochondrial N-terminal methionine excision pathway. J Biol Chem, 278: 52953-63, 2003.[Abstract/Free Full Text]
- Lazarus DD, Bernier SG, Labenski MT, et al. Inhibition of primary tumor growth by PPI-2458, a methionine aminopeptidase-2 inhibitor: dose and schedule responses. AACR-EORTC International Conference, abstract no. A174 2003.
This article has been cited by other articles:

|
 |

|
 |
 
J.-R. J. Yeh, R. Ju, C. M. Brdlik, W. Zhang, Y. Zhang, M. E. Matyskiela, J. D. Shotwell, and C. M. Crews
Targeted gene disruption of methionine aminopeptidase 2 results in an embryonic gastrulation defect and endothelial cell growth arrest
PNAS,
July 5, 2006;
103(27):
10379 - 10384.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Morowitz, R. Barr, Q. Wang, R. King, N. Rhodin, B. Pawel, H. Zhao, S. A. Erickson, G. S. Sheppard, J. Wang, et al.
Methionine Aminopeptidase 2 Inhibition Is an Effective Treatment Strategy for Neuroblastoma in Preclinical Models
Clin. Cancer Res.,
April 1, 2005;
11(7):
2680 - 2685.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Ross, C. Giglione, M. Pierre, C. Espagne, and T. Meinnel
Functional and Developmental Impact of Cytosolic Protein N-Terminal Methionine Excision in Arabidopsis
Plant Physiology,
February 1, 2005;
137(2):
623 - 637.
[Abstract]
[Full Text]
[PDF]
|
 |
|