Cancer Research Infection and Cancer: Biology, Therapeutics, and Prevention 09 AM Call for Abstracts
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Phan, D.
Right arrow Articles by Lin, S.-H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Phan, D.
Right arrow Articles by Lin, S.-H.
[Cancer Research 64, 3072-3078, May 1, 2004]
© 2004 American Association for Cancer Research

Regular Articles

Identification of Sp2 as a Transcriptional Repressor of Carcinoembryonic Antigen-Related Cell Adhesion Molecule 1 in Tumorigenesis

Dillon Phan1, Chien-Jui Cheng1, Matthew Galfione1, Funda Vakar-Lopez2, James Tunstead1, Nancy E. Thompson4, Richard R. Burgess4, Sonia M. Najjar5, Li-Yuan Yu-Lee6 and Sue-Hwa Lin1,3

Departments of 1 Molecular Pathology, 2 Pathology, and 3 Genitourinary Oncology, The University of Texas M. D. Anderson Cancer Center, Houston, Texas; 4 Department of Oncology, University of Wisconsin, Madison, Wisconsin; 5 Department of Pharmacology and Therapeutics, Medical College of Ohio, Toledo, Ohio; and 6 Departments of Medicine, Molecular and Cellular Biology, Immunology, and Program in Cell and Molecular Biology, Baylor College of Medicine, Houston, Texas


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Down-regulation of carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM1) tumor suppressor gene expression is common in several malignancies including prostate, colon, and breast cancer. The mechanism that mediates this down-regulation is not known. Here, we report that down-regulation of CEACAM1 expression in prostate cancer cells occurs primarily at the transcriptional level and is mediated by Sp2, a member of the Sp family of transcription factors. Sp2 binds to the CEACAM1 promoter in vitro and in vivo, and transient overexpression of Sp2 down-regulates endogenous CEACAM1 expression in normal prostate epithelial cells. Sp2 appears to repress CEACAM1 gene expression by recruiting histone deacetylase activity to the CEACAM1 promoter. In human prostate cancer specimens, Sp2 expression is high in prostate cancer cells but low in normal prostate epithelial cells and is inversely correlated with CEACAM1 expression. Our studies show that transcriptional repression by Sp2 represents one mechanism by which CEACAM1 tumor suppressor gene is down-regulated in prostate cancer.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Loss of tumor suppressors is one of the major mechanisms that lead to tumor formation. Although tumor suppressors were originally identified as genes whose deletions or mutations cause cancer, their down-regulation occurs more commonly in tumorigenesis (1) . Sager et al. (1) thus classified the former as type I and the latter as type II tumor suppressors.

Carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM1), a member of the CEA family, is a Mr 105,000 glycoprotein originally identified as a protein that mediates intercellular adhesion (2) . Down-regulation of CEACAM1 was observed in many tumor types including prostate (3 , 4) , colon (5) , endometrium (6) , breast (7 , 8) , and hepatocellular (9) carcinomas, suggesting that CEACAM1 may have an important role in the maintenance of normal epithelial phenotype. In experimental tumor models, reduction of CEACAM1 levels in normal rat prostate NbE cells promoted tumorigenesis (10) , whereas re-expression of CEACAM1 in prostate cancer cells suppressed their tumorigenicity in vivo (10) . Suppression of tumorigenicity by CEACAM1 was also observed in breast (11) , bladder (12) , and colon carcinoma (13) . In addition, the human (14) , rat (10) , and mouse homologues of CEACAM1 (13) were all shown to have tumor-suppressive activity. These results support the role of CEACAM1 as a tumor suppressor.

The mechanism of CEACAM1-mediated tumor suppression is through inhibition of tumor angiogenesis. Volpert et al. (15) showed that conditioned medium from CEACAM1-expressing cells inhibited endothelial cell migration in vitro and corneal angiogenesis in vivo. This inhibitory effect is due to induction of apoptosis in endothelial cells (15) . Thus, it is likely that expression of CEACAM1 in tumor cells induces the production of inhibitory factors that affect tumor angiogenesis, leading to suppression of tumor growth in vivo.

The mechanism by which CEACAM1 is lost during tumorigenesis is not clear. Allelic loss of CEACAM1 gene, localized at chromosome 19 in humans (16) and 7 in mouse (17) , has not been reported to occur in either prostate or colon cancer. Although an extensive analysis on human prostate cancer specimens has not been performed, studies by Rosenberg et al. (18) using tissues or cells from mouse colon carcinoma showed that neither chromosomal rearrangements nor gene deletions occurred close to the CEACAM1 gene. Thus, it is likely that down-regulation rather than irreversible loss of CEACAM1 expression is the major cause of tumorigenesis in vivo.

In this study, we identify for the first time a mechanism for the loss of CEACAM1 expression in prostate cancer. We found that down-regulation of CEACAM1 expression in prostate tumors occurs mainly at the transcriptional level. In addition, we provide evidence that down-regulation of CEACAM1 gene in prostate cancer is mediated by the transcription factor Sp2 that is highly expressed in prostate cancer cells. Furthermore, Sp2 recruits histone deacetylase (HDAC) to repress transcription of the CEACAM1 gene. Thus, loss of CEACAM1 tumor suppressor gene expression in prostate cancer cells is attributed to aberrant chromatin acetylation. Extensive immunohistochemical analysis showed that there is an inverse relationship between CEACAM1 and Sp2 expression in human prostate cancer specimens, providing strong support that high Sp2 levels correlate with the loss of CEACAM1 expression during tumorigenesis.


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Western and Northern Blot Analyses.
For Western blot analysis, cells were lysed, and protein concentrations were determined by Coomassie Blue Plus (Pierce). Equal amounts of protein were resolved on SDS-PAGE and immunoblotted with anti-CEACAM1 antibody Ab669 (19) . For Northern blot analysis, total cellular RNA (20 µg), prepared by using RNAzolB (Biotecx), was resolved on a 1% agarose gel containing 0.02% formaldehyde and hybridized with a CEACAM1 cDNA probe (20) . 36B4 was used as a control for RNA loading (21) .

CEACAM1 Promoter Plasmid Construction.
The 5'-flanking region of rat CEACAM1 gene was cloned as described previously (22) . Using PCR, 5' CEACAM1 promoter deletion products (–1609, –439, –249, and –194 bp) were generated and subcloned into the XhoI and HindIII sites of pGL3-BASIC (22) . The –194pLuc vector was used in site-directed mutagenesis of the putative Sp2-binding site (underlined) by using Oligo 309 (forward primer, 5'-CTCGAGTGAGAGAACAGCATTGTCAGAAATTACTTTACCACCCCCCAGCCCA) and Oligo 304 (reverse primer, 5'-AAGCTTCTTCTCTTGGGGAAGAGAT). The Sp2 site mutation in –194mut pLuc was confirmed by sequencing.

Transfection of NbE and Mat-LyLu Cells.
NbE (23) and Mat-LyLu (24) cells were maintained in DMEM medium supplemented with 10% FCS, plated at 50,000 cells/well in a 12-well plate, and transfected with 0.3 µg plasmid/well using LipofectAMINE (Life Technologies, Inc.). After 24 h, cells were lysed in 200 µl of lysis buffer, and the luciferase activity was measured (Promega). Where indicated, 5 h after transfection, cells were incubated with 1 µg/ml trichostatin A (TSA; Sigma) for 24 h before luciferase activity was determined. Samples were assayed in triplicate, and each experiment was performed at least three independent times.

Electrophoretic Mobility Shift Assay (EMSA).
Ten µg of nuclear proteins were subjected to EMSAs using a bandshift assay system (Promega). Double-stranded oligonucleotides corresponding to –147 to –194 bp (194probe or 194mut probe) of the CEACAM1 promoter were synthesized (Sigma/Genosys) and used as probes. For supershift analysis, nuclear extracts were incubated with 1 µl of rabbit polyclonal antibody specific for Sp1, Sp2, Sp3, or Sp4 (Santa Cruz Biotechnology).

Immunostaining.
Cells were fixed in formalin, blocked with normal goat serum for 30 min, and incubated with Sp2 (K-20) antibody (Santa Cruz Biotechnology) at 4°C overnight. Antibody binding was detected by using the ABC kit with 3,3'-diaminobenzidine as the chromogen (Vector). The immunostained cells were then counterstained with hematoxylin.

Chromatin Immunoprecipitation (ChIP) Assay.
Quantitative ChIP assays were carried out as described (25 , 26) using the ChIP assay kit (Upstate Biotechnology). Chromatin prepared from NbE or Mat-LyLu cells (10-cm dish) was used to determine total DNA input and for overnight incubation with either anti-acetyl histone H4 (Anti-AcH4) antibody (06-866; UBI) or Sp2 antibody. Primers corresponding to nucleotide (nt) –162 to –240 of the CEACAM1 promoter were used in both PCR and quantitative real-time PCR analyses: CEACAM1 forward, 5'-AACAATGAACCGAAAAGAGAGGAA (nt –240 to –217); CEACAM1 reverse, 5'-GAGCCTGCGACTCTGACAATG (nt –183 to –163); and CEACAM1 TaqMan probe, 5'-GTTCTCTCAGTGCTGTCCTCCCATCCTTCT (nt –215 to –186; Perkin-Elmer). Histone 3.3 was used as control for total chromatin: H3.3 forward, 5'-GCAAGAGTGCGCCCTCTACTG; and H3.3 reverse, 5'-GGCCTCACTTGCCTCCTGCAA. Data are representative of four independent experiments.

Immunohistochemistry of Prostate Cancer Specimens.
Formalin-fixed, paraffin-embedded tissue samples representing a spectrum of localized and metastatic prostate cancer, including radical prostatectomy specimens and lymph nodes with prostate cancer metastases, were selected from the Prostate Specialized Program of Research Excellence Tissue Bank at The University of Texas M. D. Anderson Cancer Center. A CEACAM1-specific monoclonal antibody (Ab 89) was produced by injecting BALB/c ByJ mice (The Jackson Laboratory, Bar Harbor, ME) with full-length human CEACAM1, which was expressed and purified from Sf9 cells as described previously (27) . Serum samples, obtained by supraorbital bleedings, showed high titers (>1:3200) to both CEACAM1 and the closely related CEA (28) by ELISA. Hybridomas were prepared by standard procedures (29) . Monoclonal antibodies were screened by ELISA, using CEACAM1 as the antigen, and then cross-screened with human CEA (DAKO, Carpinteria, CA) as the antigen. Ab 89 reacted strongly with CEACAM1, but did not react with CEA. Four-µm-thick sections were dewaxed with xylene, rehydrated in graded alcohol, treated with 3% H2O2 in methanol for 15 min, washed with PBS, blocked with normal goat serum for 30 min, and incubated at 4°C overnight with Ab 89 at 1:1000 dilution. For the detection of Sp2, antigen retrieval by boiling the slides in 0.01 M sodium citrate (pH 6.0) and 0.1% NP40 for 10 min was performed before incubation with Sp2 antibody at 1:2000 dilution. Antibody binding was detected by using the LSAB kit with 3,3'-diaminobenzidine as the chromogen (DAKO). The sections were then counterstained with hematoxylin.

A scoring system was devised to determine the relative expression of CEACAM1 and Sp2 in the glands of the prostate cancer specimens. For CEACAM1, 0 represents no staining; 1, weak apical staining in part of the gland; 2, variable intensity apical staining in the entire gland; and 3, strong apical staining in the entire gland. For Sp2, 0 represents no staining in both nucleus and cytoplasm; 1, weak cytoplasmic staining; 2, weak cytoplasmic and nuclear staining; and 3, strong nuclear staining. The malignancy of the tumor was graded 1–5 according to Gleason (30) .


   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
CEACAM1 Expression in Normal and Prostate Carcinoma Cell Lines.
To study the regulation of CEACAM1 gene during prostate tumorigenesis, we used the Dunning rat prostate cancer cells AT-2, AT-3, and Mat-LyLu to determine whether CEACAM1 protein expression levels show distinct tumor-specific down-regulation. These cell lines represent tumors ranging from relatively benign, slowly growing, differentiated, androgen-sensitive tumors to rapidly growing, anaplastic, hormone-insensitive malignant tumors (24 , 31) . A prostate cell line NbE, derived from ventral prostate of Noble rat (23) , was used as a normal control. A significant decrease in CEACAM1 protein levels occurred in AT-2, AT-3, and Mat-LyLu cells by comparison with NbE normal controls (Fig. 1A)Citation . In Mat-LyLu cells, CEACAM1 level was about 4% that of NbE normal controls. These results are consistent with our previous observation of reduced CEACAM1 levels in human prostate cancer cells (14) and in mouse prostate cancer tissues (3) . Reduced CEACAM1 protein levels are associated with a significant decrease in the steady-state levels of the 4-kb CEACAM1 message in these prostate cancer cells (Fig. 1B)Citation . These observations indicate that loss of CEACAM1 protein in prostate cancer cells is due to a reduction in the level of the CEACAM1 message.



View larger version (34K):
[in this window]
[in a new window]
  		Fig. 1. Down-regulation of CEACAM1 in prostate cancer cells. A, immunoblot analysis of CEACAM1 protein expression in NbE and Dunning rat prostate cancer cell lines, using polyclonal anti-CEACAM1 antibody (Ab669). The blot was reprobed with antiactin antibody as a loading control. The intensity of signal from CEACAM1 protein was quantitated by Quantity1 (Bio-Rad). In the Mat-LyLu cell line, the CEACAM1 expression level is about 4% compared with that of normal NbE cells. B, Northern blot analysis of CEACAM1 expression. The levels of CEACAM1 messages in NbE, AT2, AT3, and Mat-LyLu cells were tested by Northern blot analysis using a probe generated from the full-length CEACAM1 cDNA (20) .

 
Transcriptional Regulation of CEACAM1 Gene Expression in Prostatic Cancer Cell Lines.
Down-regulation of CEACAM1 expression in prostatic cancer cells could be due to altered transcriptional activity resulting from changes in promoter methylation or the recruitment of factors that attenuate CEACAM1 promoter activity. To distinguish between these possibilities, NbE cells that express CEACAM1 protein and Mat-LyLu cells that have the lowest CEACAM1 level were chosen for additional studies. Treatment of Mat-LyLu cells with the DNA methylation inhibitor 5-aza-2'-deoxycytidine (32) did not result in an increase in CEACAM1 protein expression in Western blot analysis (data not shown). Thus, promoter methylation is unlikely to be involved in human CEACAM1 regulation in prostate cancer, in agreement with the report by Rosenberg et al. (18) that methylation was not detected in mouse CEACAM1 gene in colon carcinoma.

We next examined how transcriptional regulation of CEACAM1 gene occurs in tumorigenesis. Previous deletion analysis identified a minimal promoter located between nt –194 and –147 proximal to the CEACAM1 translation start site (22 , 33) . To compare promoter activities in the CEACAM1-positive and -negative cells, we transfected the CEACAM1 promoter-luciferase constructs into normal NbE and Mat-LyLu prostatic cancer cells. A similar pattern of promoter activity was observed in the –1609-bp, –439-bp, –249-bp, and –194-bp CEACAM1 promoter reporter constructs in the Mat-LyLu cells as compared with the NbE cells (Fig. 2A)Citation . However, there is a reproducible 4-fold decrease in the overall CEACAM1 promoter activity in the fast-growing malignant Mat-LyLu cells. The –147-bp CEACAM1 promoter was inactive in either cell types (data not shown). These results suggest that down-regulation of CEACAM1 in prostate cancer cells is correlated with altered CEACAM1 promoter activity and that a tumor-specific promoter regulatory activity lies between nt –194 and –147 in the minimal CEACAM1 promoter.



View larger version (56K):
[in this window]
[in a new window]
  		Fig. 2. Comparison of CEACAM1 promoter activities in NbE and Mat-LyLu cells. A, a series of reporter plasmids containing various lengths of the CEACAM1 promoter were transfected into NbE or Mat-LyLu cells as described in "Materials and Methods." CEACAM1 promoter (–1609 bp) cloned in reverse orientation (–1609Rev pLuc) was used as a reference. NbE or Mat-LyLu cells transfected with pTK-Renilla were used to normalize the transfection efficiency. After normalization by Renilla luciferase activities, the average luciferase activities ± SD of triplicate transfections were shown. Values located at the right of each construct indicate the fold difference in the promoter activity in NbE cells compared with that observed for Mat-LyLu cells. The experiment was repeated three times with triplicate transfections for each construct, and similar results were obtained. Results from one of the experiments are shown. B, EMSA of the interaction between NbE or Mat-LyLu nuclear extract with the 194probe. Oligonucleotides corresponding to the region between –194 to –147 bp of the CEACAM1 promoter were synthesized and used as probe (194probe). Nuclear extracts from NbE or Mat-LyLu cells were used. Positions of shifted complexes (complexes I–IV) are indicated by arrows. C, EMSA in the presence of Sp1, Sp2, Sp3, and Sp4 antibodies. Gel shift analysis using the 194probe was performed in the absence or presence of antibodies against Sp1, Sp2, Sp3, or Sp4 (Lanes 4–7). Lane 4, anti-Sp1 antibody generated a weak supershifted band, however, no significant decrease was observed in any of the complexes, suggesting that Sp1 might be a minor component in these complexes. Lane 5, complex I was shifted by anti-Sp2 antibody as judged by the decrease in complex I intensity. Lane 6, complex II was shifted by anti-Sp3 antibody. Lane 7, none of the complexes was shifted by anti-Sp4 antibody. Lane 8, complex I was not competed by the presence of 100-fold molar excess of the 194mut probe.

 
Binding of NbE and Mat-LyLu Nuclear Extracts to CEACAM1 Promoter.
To identify the tumor-specific activity at the CEACAM1 promoter, we used gel shift assays (EMSA) to examine binding of nuclear proteins from NbE versus Mat-LyLu cells to a double-stranded oligonucleotide containing the minimum CEACAM1 promoter (nt –194 to –147, 194probe). Four major bands (complex I–IV) were detected in the Mat-LyLu (Fig. 2BCitation , Lane 4) nuclear extract. The binding of complex I–IV is specific as it can be competed by an excess of unlabeled 194probe (Fig. 2BCitation , Lane 5). In contrast, three major bands (complex II–IV), which can be competed by an excess of unlabeled 194probe, were detected in the NbE nuclear extract (Fig. 2BCitation , Lane 2 versus 3). As complex I is only present in the Mat-LyLu extract, we investigated the possibility that the protein in this complex may play a role in the decreased CEACAM1 promoter activity in Mat-LyLu cells.

Involvement of Sp Transcription Factor Family at the CEACAM1 Promoter.
Sequence analysis showed that the 194-bp region of the CEACAM1 promoter is highly GC-rich and contains elements that match the consensus binding sequence for Sp1 (22) . To determine whether the Sp family of transcription factors is present at the CEACAM1 promoter, we used antibodies against Sp1, Sp2, Sp3, and Sp4 to identify the protein(s) present in complex I in Mat-LyLu cells. Complex I was shifted by anti-Sp2 antibody, as shown by the decrease in complex I intensity (Fig. 2CCitation , Lane 5). Complex II was shifted by anti-Sp3 antibody (Fig. 2CCitation , Lane 6). Anti-Sp1 antibody generated a weak supershifted band with no significant decrease in the intensity of any of the complexes, suggesting that Sp1 is a minor component in these complexes (Fig. 2CCitation , Lane 4). Anti-Sp4 antibody did not generate any supershifted band (Fig. 2CCitation , Lane 7). Because Sp2 is present in complex I, it is likely that Sp2 is one of the transcription factors that suppresses CEACAM1 promoter activity in Mat-LyLu cells.

Levels of Sp2 Protein in Cells Correlate with CEACAM1 Down-Regulation.
Down-regulation of CEACAM1 in Mat-LyLu cells might be due to an increase in the concentrations of Sp2 in Mat-LyLu cells in comparison with NbE cells. Western blot analysis showed that the Sp2 level in Mat-LyLu cells was 10-fold higher than that in NbE cells and is inversely correlated with CEACAM1 levels in these cells (Fig. 3A)Citation . Furthermore, staining of Sp2 protein was higher in Mat-LyLu than NbE cells by both immunofluorescence (not shown) and immunoperoxidase detection (Fig. 3, B–E)Citation . Consistent with the role of Sp2 as a transcription factor, immunolocalization analysis revealed stronger nuclear than cytoplasmic staining of Sp2 in Mat-LyLu cells (Fig. 3D)Citation . Higher levels of Sp2 in Mat-LyLu than NbE cells suggest a potential repressive function of Sp2 on CEACAM1 gene expression in prostate cancer cells.



View larger version (95K):
[in this window]
[in a new window]
  		Fig. 3. Sp2 expression correlates with CEACAM1 down-regulation. A, differential expression of Sp2 in NbE versus Mat-LyLu cells. Cell lysates (20 µg) prepared from NbE or Mat-LyLu cells were boiled in SDS sample buffer, and the proteins were separated by SDS-PAGE. The proteins were transferred onto nitrocellulose membrane and blotted sequentially with anti-Sp2, anti-CEACAM1, and antiactin antibodies. B, localization of Sp2 in NbE cells. D, localization of Sp2 in Mat-LyLu cells. Mat-LyLu or NbE cells grown on coverslips were fixed by formaldehyde and immunostained with anti-Sp2 antibody. The localization of Sp2 protein was detected by diaminobenzidine. NbE (C) or Mat-LyLu (E) cells stained with secondary antibody alone were used as controls.

 
Suppression of CEACAM1 Gene Expression by Sp2.
To investigate whether Sp2 has a direct suppressive effect on the CEACAM1 promoter, we transfected NbE cells, which have low to undetectable levels of Sp2 (Fig. 3A)Citation , with Sp2 expression vector and CEACAM1 promoter reporter construct. Overexpression of Sp2 resulted in a dose-dependent inhibition of CEACAM1 promoter activity as compared with an empty pcDNA3.1 vector control (Fig. 4A)Citation . This Sp2-mediated suppression was also observed on endogenous CEACAM1 protein levels in Sp2-transfected NbE cells (Fig. 4B)Citation . These results suggest that Sp2 is one of the factors that mediate a decrease in CEACAM1 expression in Mat-LyLu cells. Taken together, these results are consistent with the interpretation that Sp2 suppresses the expression of CEACAM1 in prostate cancer cells.



View larger version (32K):
[in this window]
[in a new window]
  		Fig. 4. Suppression of CEACAM1 expression by Sp2. A, Sp2 decreases transcriptional activity of CEACAM1 promoter in NbE cells. NbE cells were cotransfected with CEACAM1 promoter reporter plasmid (–1609pLuc) and various amounts of pcDNA-Sp2 expression vector (35) or control vector pcDNA3.1 as indicated. The luciferase activity is presented as a percentage of that of control plasmid-transfected cells. The data are presented as the mean ± SE of three independent experiments. B, increased expression of Sp2 inhibited endogenous CEACAM1 expression in NbE cells. NbE cells were transfected with control expression vector pcDNA3.1 or pcDNA-Sp2 expression vector. Twenty-four h after transfection, the cells were harvested and lysed in radioimmunoprecipitation assay buffer. Equal amounts of proteins were loaded and electrophoresed on a 4–12% SDS-polyacrylamide gel. Western immunoblot analysis was performed by using anti-Sp2 antibody and anti-CEACAM1 antibody (Ab669). The expression of actin was used as a control. C, mutation of Sp2-binding site increases CEACAM1 promoter activity. Mat-LyLu cells were transfected with luciferase reporter plasmids containing wild-type CEACAM1 promoter (–194pLuc) or CEACAM1 promoter with mutations in the Sp2-binding site (–194mut pLuc). Fold induction of luciferase activity was calculated relative to that of –194pLuc. D, association of Sp2 with CEACAM1 promoter in vivo. ChIP analysis of the CEACAM1 gene in NbE and Mat-LyLu cells was performed using anti-Sp2 antibody or anti-acetylated histone H4 antibody. PCR was used to detect nt –162 to –240 region of the CEACAM1 promoter. PCR of histone 3.3 DNA was used as a control for total chromatin input. E, inhibition of HDAC activity by TSA activates CEACAM1 promoter activity. Mat-LyLu cells were transfected with –194pLuc or –194mut pLuc in the presence or absence of 1 µM TSA. Fold induction of luciferase activity was calculated relative to that of –194pLuc in the absence of TSA.

 
Sp2 Binding at the CEACAM1 Promoter.
Sp2 is known to bind to GT-box sequences (34 , 35) , and a GT-box-like sequence is located between nt –172 to –163 at the CEACAM1 promoter. We mutated the GT-box sequences to generate a 194-mut oligo and used it as a competitor in EMSA. Addition of 100-fold excess of the 194-mut oligo blocked complex II–IV formation but did not alter complex I formation (Fig. 2CCitation , Lane 8). This suggests that Sp2 binds to the GT-rich sequence between nt –172 to –163 in the CEACAM1 promoter. We next generated a –194pLuc reporter containing the Sp2 site mutation (–194mutpLuc) and determined whether the loss of Sp2 binding results in an increase in CEACAM1 promoter activity in Mat-LyLu cells. Mutation of the Sp2-binding site reproducibly resulted in a 6–7-fold increase in CEACAM1 promoter activity in Mat-LyLu cells when compared with that of the wild-type CEACAM1 promoter (Fig. 4C)Citation . This suggests that binding of Sp2 to nt –172 to –163 of the CEACAM1 promoter suppresses CEACAM1 promoter activity in prostate cancer cells.

Association of Sp2 with CEACAM1 Promoter in Vivo.
We further investigated whether Sp2 is associated with the CEACAM1 promoter in vivo by using a ChIP assay (25 , 26) . After sonication, chromatin prepared from Mat-LyLu or NbE cells was immunoprecipitated with anti-Sp2 antibody to examine its specific association with the CEACAM1 promoter. Higher levels of Sp2 were found to be associated with the CEACAM1 promoter in Mat-LyLu than NbE cells (Fig. 4D)Citation . The increase was shown to be ~2.7-fold by quantitative PCR (data not shown). PCR of histone 3.3 was used to show equal chromatin input. This observation suggests that Sp2 is associated with the CEACAM1 promoter in vivo in Mat-LyLu cells.

Inhibition of HDAC Activity by TSA Activates CEACAM1 Promoter Activity.
The conformation of genes within chromatin determines whether a gene is in its active or inactive state. These structural features are regulated by enzymes that modify chromatin structure. Histone acetylation leads to open chromatin conformation that promotes gene transcription by making promoter sequences accessible to transcription factors. Association with HDAC contributes to the suppressive activity of several transcription factors (36) . To investigate whether the inhibitory effect of Sp2 on CEACAM1 promoter activity in Mat-LyLu cells involves the recruitment of HDAC, we used the HDAC inhibitor TSA (37) to examine whether TSA can relieve Sp2-mediated repression at the CEACAM1 promoter. Mat-LyLu cells were transfected with –194pLuc or –194mutpLuc and treated with or without TSA (Fig. 4E)Citation . TSA treatment resulted in about 19-fold increase in the –194pLuc promoter activity but had little effect on the –194mutpLuc promoter activity. This result suggests that HDAC is involved in the suppression of CEACAM1 promoter activity in Mat-LyLu cells, and the repression requires the presence of a functional Sp2-binding site.

ChIP assays using anti-acetylated histone H4 antibody followed by quantitative PCR showed a ~1.7-fold increase in H4 acetylation at the CEACAM1 promoter in NbE cells than in Mat-LyLu cells (Fig. 4D)Citation , thus further demonstrating that the CEACAM1 promoter is in a more "active" state in NbE cells than in Mat-LyLu cells. These results agree with the finding that CEACAM1 protein levels are higher in nontumorigenic NbE cells than in the more tumorigenic Mat-LyLu cells. Taken together, these observations suggest that interaction of Sp2 with the CEACAM1 promoter and the subsequent recruitment of HDAC to the CEACAM1 promoter lead to decreased chromatin acetylation at the CEACAM1 promoter, and this results in decreased CEACAM1 gene expression in Mat-LyLu cells.

Inverse Relationship between CEACAM1 and Sp2 Expression in Prostate Cancer Specimens.
To address whether the suppressive effect of Sp2 on CEACAM1 expression observed in the prostate cancer cell lines reflects the regulation of CEACAM1 expression in vivo in prostate cancer, the correlation between CEACAM1 and Sp2 expression was determined in consecutive slides from prostate cancer specimens. Studies by Busch et al. (4) showed that down-regulation of CEACAM1 in human prostate cancer occurred at Gleason grade 3 to 4 transition. Using CEACAM1-specific monoclonal antibody Ab 89, CEACAM1 is shown to be expressed in normal and Gleason grade 3 prostate glands but down-regulated in Gleason grade 4 prostate glands (Fig. 5A)Citation . In contrast, Sp2 was not detected in the normal and Gleason grade 3 glands but was highly expressed in the nuclei of the epithelial cells of Gleason grade 4 prostate glands (Fig. 5A)Citation . A semiquantitative assessment of the expression of CEACAM1 and Sp2 in Gleason grade 3–5 prostate glands showed an inverse relationship between the expression of CEACAM1 and Sp2 (Fig. 5, B–E)Citation . Metastatic prostate cancer cells in lymph node showed a similar pattern of expression as in Gleason grades 4 and 5 (Fig. 5, A and E)Citation , suggesting that high Sp2 expression concomitant with a loss of CEACAM1 expression occurs in both localized high-grade and metastatic prostate cancer cells.



View larger version (71K):
[in this window]
[in a new window]
  		Fig. 5. Expression of CEACAM1 and Sp2 in human prostate cancer specimens. Human prostate cancer specimens were immunostained with antibodies against CEACAM1 (Ab 89) or Sp2. Representative panels are shown in A (magnification, x200). In a normal prostate gland, CEACAM1 was expressed in the apical surface of epithelial cells, whereas Sp2 was negative. In low-grade prostate cancer (Gleason grade 3), CEACAM1 was expressed in the epithelial cells, whereas Sp2 was negative. In high-grade prostate cancer (Gleason grade 4), fused prostate glands were negative with CEACAM1 staining, whereas strong staining of Sp2 was detected in the nucleus of epithelial cells. In metastatic prostate cancer cells in the lymph node, metastatic prostate cancer cells were completely negative with CEACAM1 staining, whereas they stained strongly with Sp2 in the nucleus. Correlations between Gleason grade and immunostaining score for the expression pattern of CEACAM1 versus Sp2 in prostate cancer specimens are shown in B–E. The expression levels of CEACAM1 and Sp2 were scored as described in "Materials and Methods." B, Gleason grade 3 glands (n = 137). C, Gleason grade 4 glands (n = 53). D, Gleason grade 5 glands (n = 12). E, lymph node metastasis specimens (n = 15). There is an inverse relationship between CEACAM1 and Sp2 expression in prostate cancer specimens.

 

   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
We investigated the mechanism by which CEACAM1 gene expression is down-regulated in prostate cancer. Our studies show that the transcription factor Sp2 is involved in the down-regulation of CEACAM1 in prostate cancer and that this occurs primarily at the level of CEACAM1 gene transcription. Sp2-mediated down-regulation of CEACAM1 expression is clinically relevant because the expression pattern of Sp2 is inversely correlated with CEACAM1 expression in prostate cancer cells and in human prostate cancer specimens. Thus, our studies elucidate a novel role for Sp2 as a transcriptional repressor of the CEACAM1 tumor suppressor gene.

Sp2 is a member of the Sp family of transcription factors, which consists of Sp1 through Sp5 (34 , 38) . Extensive studies have been reported on the functions of Sp1, Sp3, and Sp4 (34) . Sp1 is a general transcription factor that regulates many ubiquitously expressed genes by binding to GC boxes at their promoters (34) . In contrast, very little is known about the function and expression of Sp2. Sp2 has been shown to bind to a GT-box promoter element within the T-cell receptor {alpha} promoter in vitro (35) . Recently, Sp2 was shown to repress Sp1- and Sp3-mediated activation of the CTP:phosphocholine cytidylyltransferase {alpha} promoter in Drosophila SL2 cells (39) . Although Sp2 expression was detected in several tumor cell lines (35) , Sp2 expression in normal tissues has not been examined. In the human prostate specimens, we found that Sp2 expression is low to undetectable in normal epithelial cells but high in prostate cancer cells, suggesting that Sp2 expression is related to tumorigenesis. Sp2 may be involved in tumorigenesis via its inhibition of the CEACAM1 tumor suppressor gene and/or other growth regulatory genes.

Chromatin remodeling is a fundamental mechanism governing gene regulation during embryonic development, and it also plays a significant role in tumorigenesis. HDAC has an important role in these processes (36 , 40) . At least 10 HDACs (both class I and II) have been identified in mammalian systems (41 , 42) . Transcriptional repression through HDACs can arise from a direct interaction of transcription factors with HDACs or indirect interaction via corepressors or adaptors (43 , 44) . Our observations that CEACAM1 promoter activity was increased by TSA treatment and that the CEACAM1 promoter was hypoacetylated in cancer compared with normal cells suggest that histone deacetylation constitutes a basic mechanism underlying the down-regulation of CEACAM1 gene expression during tumorigenesis. Co-immunoprecipitation assays indicated that Sp2 does not directly interact with HDAC1 (data not shown). However, it remains possible that Sp2 interacts with other members of the HDAC family or that Sp2 recruits HDAC through corepressors or other adaptor proteins. Additional investigation is required to elucidate this interaction.

In conclusion, our studies suggest that Sp2 mediates the down-regulation of CEACAM1 expression in prostate tumors in part by recruiting HDAC to the CEACAM1 promoter. HDAC, which may be tethered to the CEACAM1 promoter by Sp2, deacetylates promoter proximal histones and leads to an altered chromatin conformation that prevents transcriptional activation of the CEACAM1 gene. The identification of Sp2 as a transcriptional repressor raises interesting questions concerning the role of Sp2 in regulating the expression of genes involved in cell growth and differentiation, cancer progression, and tumorigenesis.


   ACKNOWLEDGMENTS
 
We thank Dr. Astar Winoto for providing the Sp2 expression vector, Dr. Leland Chung for providing NbE cells, Dr. Guido Jenster for helpful discussion, and Dr. Raji Luthra for assistance in quantitative PCR.


   FOOTNOTES
 
Grant support: NIH Grants DK 54254 and DK 57497 (S. Najjar), CA64856 and CA86342 (S-H. Lin), and CA60896 (R. Burgess); and U.S. Department of the Army Grants DAMD17-98-1-8465-1 and DAMD17-1-00-0031 (S-H. Lin).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Requests for reprints: Sue-Hwa Lin, Department of Molecular Pathology, Box 89, The University of Texas M. D. Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, TX 77030. Phone: (713) 794-1559; Fax: (713) 794-4672; E-mail: slin{at}mdanderson.org

Received 11/30/03. Accepted 2/23/04.


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Sager R, Sheng S, Anisowicz A, et al RNA genetics of breast cancer: maspin as paradigm. Cold Spring Harbor Symp Quant Biol LIX, : 537-46, 1994.
  2. Ocklind C, Obrink B Intercellular adhesion of rat hepatocytes: identification of a cell surface glycoprotein involved in the initial adhesion process. J Biol Chem, 257: 6788-95, 1982.[Abstract/Free Full Text]
  3. Pu YS, Luo W, Lu H-H, Gingrich J, Greenberg N, Lin S-H Differential expression of C-CAM protein in prostate cancer progression in a transgenic adenocarcinoma mouse model. J Urol, 162: 892-6, 1999.[CrossRef][Medline]
  4. Busch C, Hanssen TA, Wagener C, Obrink B Down-regulation of CEACAM1 in human prostate cancer: correlation with loss of cell polarity, increased proliferation rate, and Gleason grade 3 to 4 transition. Hum Pathol, 33: 290-8, 2002.[CrossRef][Medline]
  5. Neumaier M, Paululat S, Chan A, Matthaes P, Wagener C Biliary glycoprotein, a potential human cell adhesion molecule, is down-regulated in colorectal carcinomas. Proc Natl Acad Sci USA, 90: 10744-8, 1993.[Abstract/Free Full Text]
  6. Bamberger AM, Riethdorf L, Nollau P, et al Dysregulated expression of CD66a (BGP, C-CAM), an adhesion molecule of the CEA family, in endometrial cancer. Am J Pathol, 152: 1401-6, 1998.[Abstract]
  7. Huang J, Simpson JF, Glackin C, Riethorf L, Wagener C, Shively J Expression of biliary glycoprotein (CD66a) in normal and malignant breast epithelial cells. Anticancer, 18: 3203-12, 1998.
  8. Riethdorf L, Lisboa BW, Henkel U, Naumann M, Wagener C, Loning T Differential expression of CD66a (BGP), a cell adhesion molecule of the carcinoembryonic antigen family, in benign, premalignant, and malignant lesions of the human mammary gland. J Histochem Cytochem, 45: 957-63, 1997.[Abstract/Free Full Text]
  9. Hixson DC, McEntire KD, Obrink B Alterations in the expression of a hepatocyte cell adhesion molecule by transplantable rat hepatocellular carcinomas. Cancer Res, 45: 3742-9, 1985.[Abstract/Free Full Text]
  10. Hsieh JT, Luo W, Song W, et al Tumor suppressive role of an androgen-regulated epithelial cell adhesion molecule (CCAM) in prostate carcinoma cell revealed by sense and antisense approaches. Cancer Res, 55: 190-7, 1995.[Abstract/Free Full Text]
  11. Luo W, Wood C, Earley K, Hung M-C, Lin S-H Suppression of tumorigenicity of breast cancer cells by an epithelial cell adhesion molecule (C-CAM1): the adhesion and growth suppression are mediated by different domains. Oncogene, 14: 1697-704, 1997.[CrossRef][Medline]
  12. Kleinerman DI, Dinney CPN, Zhang W-W, Lin S-H, Van NT, Hsieh JT Suppression of human bladder cancer growth by increased expression of C-CAM1 gene in an orthotopic model. Cancer Res, 56: 3431-5, 1996.[Abstract/Free Full Text]
  13. Kunath T, Ordonez-Garcia C, Turbide C, Beauchemin N Inhibition of colonic tumor cell growth by biliary glycoprotein. Oncogene, 11: 2375-82, 1995.[Medline]
  14. Luo W, Talposky M, Earley K, Wood C, Wilson D, Logothetis CJ, Lin S-H The tumor suppressive activity of CD66a in prostate cancer. Cancer Gene Ther, 6: 313-21, 1999.[CrossRef][Medline]
  15. Volpert O, Luo W, Liu T-J, Estrera VT, Logothetis C, Lin S-H Inhibition of prostate tumor angiogenesis by the tumor suppressor CEACAM1. J Biol Chem, 277: 35696-702, 2002.[Abstract/Free Full Text]
  16. Brandriff BF, Gordon LA, Tynan KT, et al Order and genomic distances among members of the carcinoembryonic antigen (CEA) gene family determined by fluorescence in situ hybridization. Genomics, 12: 773-9, 1992.[CrossRef][Medline]
  17. Robbins J, Robbins PF, Kozak CA, Callahan R The mouse biliary glycoprotein gene (Bgp): partial nucleotide sequence, expression, and chromosomal assignment. Genomics, 10: 583-7, 1991.[CrossRef][Medline]
  18. Rosenberg M, Nedellec P, Jothy S, Fleiszer D, Turbide C, Beauchemin N The expression of mouse biliary glycoprotein, a carcinoembryonic antigen-related gene, is down-regulated in malignant mouse tissues. Cancer Res, 53: 4938-45, 1993.[Abstract/Free Full Text]
  19. Cheung PH, Luo W, Qiu Y, et al Structure and function of C-CAM1: the first immunoglobulin domain is required for intercellular adhesion. J Biol Chem, 268: 24303-10, 1993.[Abstract/Free Full Text]
  20. Lin S-H, Guidotti G Cloning and expression of a cDNA coding for a rat liver plasma membrane ecto-ATPase: the primary structure of the ecto-ATPase is similar to that of the human biliary glycoprotein. J Biol Chem, 264: 14408-14, 1989.[Abstract/Free Full Text]
  21. Laborda J 36B4 cDNA used as an estradiol-independent mRNA control is the cDNA for human acidic ribosomal phosphoprotein PO. Nucleic Acids Res, 19: 3998 1991.[Free Full Text]
  22. Najjar SM, Boisclair YR, Nabih ZT, et al Cloning and characterization of a functional promoter of the rat pp120 gene, encoding a substrate of the insulin receptor tyrosine kinase. J Biol Chem, 271: 8809-17, 1996.[Abstract/Free Full Text]
  23. Chung LWK, Chang S-M, Bell C, Zhau HE, Ro JY, von Eschenbach AC Co-inoculation of tumorigenic rat prostate mesenchymal cells with non-tumorigenic epithelial cells results in the development of carcinosarcoma in syngeneic and athymic animals. Int J Cancer, 43: 1179-87, 1989.[Medline]
  24. Isaacs JT, Isaacs WB, Feitz WFJ, Scheres J Establishment and characterization of seven Dunning rat prostate cancer cell lines and their use in developing methods for predicting metastatic abilities of prostatic cancers. Prostate, 9: 261-81, 1986.[Medline]
  25. Braunstein M, Rose AB, Holmes SG, Allis CD, Broach JR Transcriptional silencing in yeast is associated with reduced nucleosome acetylation. Genes Dev, 7: 592-604, 1993.[Abstract/Free Full Text]
  26. Hecht A, Strahl-Bolsinger S, Grunstein M Spreading of transcriptional repressor SIR3 from telomeric heterochromatin. Nature, 383: 92-6, 1996.[CrossRef][Medline]
  27. Phan D, Han E, Birrell G, et al Purification and characterization of human cell-cell adhesion molecule 1 (C-CAM1) expressed in insect cells. Protein Expr Purif, 21: 343-51, 2001.[CrossRef][Medline]
  28. Beauchemin N, Draber P, Dveksler G, et al Redefined nomenclature for members of the carcinoembryonic antigen family. Exp Cell Res, 252: 243-9, 1999.[CrossRef][Medline]
  29. Harlow E, Lane D . Antibodies, a laboratory manual, Cold Spring Harbor Laboratory Press Cold Spring Harbor, NY 1988.
  30. Gleason DF . Histologic grading and clinical staging of prostatic carcinoma, p. 171-98, Lea and Febiger Philadelphia, PA 1977.
  31. Dunning WF Prostate cancer in the rat. Monogr Natl Cancer Inst, 12: 351-69, 1963.
  32. Jones PA, Taylor SM Cellular differentiation, cytidine analogs and DNA methylation. Cell, 20: 85-93, 1980.[CrossRef][Medline]
  33. Phan D, Sui X, Luo W, Najjar SM, Jenster G, Lin S-H Androgen regulation of the cell-cell adhesion molecule-1 (C-CAM1) gene. Mol Cell Endo, 184: 115-23, 2001.[CrossRef][Medline]
  34. Suske G The Sp-family of transcription factors. Gene, 238: 291-300, 1999.[CrossRef][Medline]
  35. Kingsley C, Winoto A Cloning of GT box-binding proteins: a novel Sp1 multigene family regulating T-cell receptor gene expression. Mol Cell Biol, 12: 4251-61, 1992.[Abstract/Free Full Text]
  36. Kuo MH, Allis CD Roles of histone acetyltransferases and deacetylases in gene regulation. Bioessays, 20: 615-26, 1998.[CrossRef][Medline]
  37. Yoshida M, Horinouchi S, Beppu T Trichostatin A and trapoxin: novel chemical probes for the role of histone acetylation in chromatin structure and function. Bioessays, 17: 423-30, 1995.[CrossRef][Medline]
  38. Harrison SM, Houzelstein D, Dunwoodie SL, Beddington RSP Sp5, a new member of the Sp1 family, is dynamically expressed during development and genetically interacts with Brachyury. Dev Biol, 227: 358-72, 2000.[CrossRef][Medline]
  39. Bakovic M, Waite KA, Vance DE Functional significance of Sp1, Sp2, and Sp3 transcription factors in regulation of the murine CTP: phosphocholine cytidylyltransferase {alpha} promoter. J Lipid Res, 41: 583-94, 2000.[Abstract/Free Full Text]
  40. Timmermann S, Lehrmann H, Polesskaya A, Harel-Bellan A Histone acetylation and disease. Cell Mol Life Sci, 58: 728-36, 2001.[CrossRef][Medline]
  41. Kao H-Y, Downes M, Ordentlich P, Evans RM Isolation of a novel histone deacetylase reveals that class I and class II deacetylases promote SMRT-mediated repression. Genes Dev, 14: 55-66, 2000.[Abstract/Free Full Text]
  42. Bertos NR, Wang AH, Yang XJ Class II histone deacetylases: structure, function, and regulation. Biochem Cell Biol, 79: 243-52, 2001.[CrossRef][Medline]
  43. Yang W-M, Inouye C, Zeng Y, Bearss D, Seto E Transcriptional repression by YY1 is mediated by interaction with a mammalian homolog of the yeast global regulator RPD3. Proc Natl Acad Sci USA, 93: 12845-50, 1996.[Abstract/Free Full Text]
  44. Laherty CD, Yang W-M, Sun J-M, Davie JR, Seto E, Eisenman RN Histone deacetylases associated with the mSin3 corepressor mediate Mad transcriptional repression. Cell, 89: 349-56, 1997.[CrossRef][Medline]



This article has been cited by other articles:


Home page
 J. Histochem. Cytochem.Home page
B. Albarran-Somoza, R. Franco-Topete, V. Delgado-Rizo, F. Cerda-Camacho, L. Acosta-Jimenez, M. Lopez-Botet, and A. Daneri-Navarro
CEACAM1 in Cervical Cancer and Precursor Lesions: Association With Human Papillomavirus Infection
J. Histochem. Cytochem., December 1, 2006; 54(12): 1393 - 1399.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
M. A. Trujillo, M. Sakagashira, and N. L. Eberhardt
The Human Growth Hormone Gene Contains a Silencer Embedded within an Alu Repeat in the 3'-Flanking Region
Mol. Endocrinol., October 1, 2006; 20(10): 2559 - 2575.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
K. S. Moorefield, H. Yin, T. D. Nichols, C. Cathcart, S. O. Simmons, and J. M. Horowitz
Sp2 Localizes to Subnuclear Foci Associated with the Nuclear Matrix
Mol. Biol. Cell, April 1, 2006; 17(4): 1711 - 1722.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
A.-M. Bamberger, J. Briese, J. Gotze, I. Erdmann, H. M. Schulte, C. Wagener, and P. Nollau
Stimulation of CEACAM1 expression by 12-O-tetradecanoylphorbol-13-acetate (TPA) and calcium ionophore A23187 in endometrial carcinoma cells
Carcinogenesis, March 1, 2006; 27(3): 483 - 490.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
B. F. Clem and B. J. Clark
Association of the mSin3A-Histone Deacetylase 1/2 Corepressor Complex with the Mouse Steroidogenic Acute Regulatory Protein Gene
Mol. Endocrinol., January 1, 2006; 20(1): 100 - 113.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
G. Markel, R. Gruda, H. Achdout, G. Katz, M. Nechama, R. S. Blumberg, R. Kammerer, W. Zimmermann, and O. Mandelboim
The Critical Role of Residues 43R and 44Q of Carcinoembryonic Antigen Cell Adhesion Molecules-1 in the Protection from Killing by Human NK Cells
J. Immunol., September 15, 2004; 173(6): 3732 - 3739.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Phan, D.
Right arrow Articles by Lin, S.-H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Phan, D.
Right arrow Articles by Lin, S.-H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online