
[Cancer Research 64, 3126-3136, May 1, 2004]
© 2004 American Association for Cancer Research
Myc-Transformed Epithelial Cells Down-Regulate Clusterin, Which Inhibits Their Growth in Vitro and Carcinogenesis in Vivo
Andrei Thomas-Tikhonenko1,
Isabelle Viard-Leveugle3,4,
Michael Dews1,
Philippe Wehrli3,
Cinzia Sevignani1,
Duonan Yu1,
Stacey Ricci2,
Wafik el-Deiry2,
Bruce Aronow5,
Gürkan Kaya3,
Jean-Hilaire Saurat3 and
Lars E. French3
1 Departments of Pathobiology and 2
Medicine, University of Pennsylvania, Philadelphia, Pennsylvania; 3
Louis-Jeantet Skin Cancer Lab, Department of Dermatology, Geneva University Medical School, Geneva, Switzerland; 4
IVL BioService, Saint-Barthélémy, Le Gua, France; and 5
Division of Developmental Biology, Childrens Hospital Research Foundation Cincinnati, Ohio
 |
ABSTRACT
|
|---|
Effective treatment of malignant carcinomas requires identification of proteins regulating epithelial cell proliferation. To this end, we compared gene expression profiles in murine colonocytes and their c-Myc-transformed counterparts, which possess enhanced proliferative potential. A surprisingly short list of deregulated genes included the cDNA for clusterin, an extracellular glycoprotein without a firmly established function. We had previously demonstrated that in organs such as skin, clusterin expression is restricted to differentiating but not proliferating cell layers, suggesting a possible negative role in cell division. Indeed, its transient overexpression in Myc-transduced colonocytes decreased cell accumulation. Furthermore, clusterin was down-regulated in rapidly dividing human keratinocytes infected with a Myc-encoding adenovirus. Its knockdown via antisense RNA in neoplastic epidermoid cells enhanced proliferation. Finally, recombinant human clusterin suppressed, in a dose-dependent manner, DNA replication in keratinocytes and other cells of epithelial origin. Thus, clusterin appears to be an inhibitor of epithelial cell proliferation in vitro. To determine whether it also affects neoplastic growth in vivo, we compared wild-type and clusterin-null mice with respect to their sensitivity to 7, 12-dimethylbenz(a)anthracene /12-Otetradecanoylphorbol-13-acetate (DMBA/TPA)-induced skin carcinogenesis. We observed that the mean number of papillomas/mouse was higher in clusterin-null animals. Moreover, these papillomas did not regress as readily as in wild-type mice and persisted beyond week 35. The rate of progression toward squamous cell carcinoma was not altered, although those developing in clusterin-null mice were on average better differentiated. These data suggest that clusterin not only suppresses epithelial cell proliferation in vitro but also interferes with the promotion stage of skin carcinogenesis.
 |
INTRODUCTION
|
|---|
c-Myc is an oncogene that is overexpressed in many human tumors ranging from B-cell lymphoma to colon carcinoma. However, despite aggressive research, the molecular mechanisms leading to neoplastic transformation are incompletely understood. Myc is a member of the Myc/Max/Mad network of transcription regulators (1)
. It interacts with Max, binds as a heterodimer to the E-box element (2)
, and activates expression of genes containing this sequence (3
, 4)
. Gene activation by Myc/Max is thought to occur primarily via chromatin remodeling (5, 6, 7)
. Besides activating gene expression, Myc is also known to inhibit transcription from promoters containing the initiator element (8)
, at least in part via recruitment of the Miz-1 corepressor (9)
. The identities of Myc-target genes might provide crucial clues as to its normal function and the role in cancer.
Myc affects expression of many proteins whose functions range from cell metabolism to ribosome biogenesis (10
, 11)
. However, the majority of putative Myc target genes pertain to cell proliferation. Among them are ornithine decarboxylase, the enzyme involved in DNA biosynthesis (12)
, cyclin A (13)
, and cdc25A, a phosphatase required to activate cyclin-dependent kinases (14)
. More recently, cyclin-dependent kinase 4 itself was shown to be up-regulated by Myc (15)
, and members of the Myc family were reported to activate Id2, an inhibitor of the retinoblastoma tumor/cell cycle suppressor (16)
. Myc also activates the telomerase gene (17)
, presumably extending the life span of the host cell. Furthermore, several Myc-repressed genes play roles in cell cycle control: cyclin D1 (18)
; assorted cyclin-dependent kinase inhibitors (19, 20, 21, 22)
; gadd45 (23)
; and gas (24)
. Consistent with these observations, activation of Myc forces quiescent fibroblasts to reenter cell cycle (25)
. Moreover, rodent fibroblasts with targeted disruption of Myc are severely deficient in cell proliferation (26)
. Consequently, in mice [but curiously not in Drosophila (27)
], decreased expression of Myc results in hypoplasia (28)
. A consensus has thus emerged that Myc functions in a cell-autonomous manner via tipping the balance between intracellular pro- and antimitogenic signals in favor of the former.
However, recent research has led to the augmentation of this paradigm as some Myc targets encode extracellular proteins that could potentially affect neighboring cells in a paracrine manner. For instance, we have previously demonstrated that Myc down-regulates thrombospondin-1, a large secreted glycoprotein (29
, 30)
. Thrombospondin-1 and thrombospondin-2 negatively affect proliferation of epithelial (31)
and endothelial cells (32
, 33)
, suggesting that its down-regulation (e.g., via Myc overexpression) could benefit the tumor in two ways: by increasing proliferation of neoplastic cells and also by stimulating the recruitment of vascular endothelium (34)
. Indeed, activation of Myc results in the acquisition of the angiogenic phenotype (35, 36, 37, 38)
.
We were interested in determining whether down-regulation of secreted glycoproteins with antiproliferative activities is a common theme underlying the transforming function of Myc. In addition, the vast majority of gene regulation studies have thus far been performed on Myc-overexpressing fibroblasts or B-lymphoid cells (39)
.6
Only of late have epithelial cell systems started being used, with some interesting results. For example, in a recent study (40)
, Myc was found to down-regulate thrombospondin-1 in rat kidney epithelial RK3E cells. To identify more targets for Myc in epithelial cells, we have established a new experimental system: p53-null murine colonocytes overexpressing Myc and thus undergoing neoplastic transformation. Microarray analysis of gene expression profiles has revealed that in addition to thrombospondin-1, Myc overexpression results in down-regulation of clusterin, a heterodimeric glycoprotein of 80 kDa with a homology to thrombospondin-1 type 1 repeat but without a firmly established function.
Clusterin is constitutively synthesized and secreted by a wide variety of cell types in many species (41)
. Because of its discovery in distinct settings, clusterin bears several names, including cytolysis inhibitor, sulfated glycoprotein-2, testosterone-repressed prostate message-2, SP-40,40, and apolipoprotein J. Clusterin has been tentatively implicated in several biological processes, including cell adhesion and cell-extracellular matrix interaction (42, 43, 44, 45)
, regulation of the complement cascade (46, 47, 48)
, lipid transport (49, 50, 51)
, cellular protection, and tissue remodeling (42
, 52)
. In this context, it has been shown that clusterin gene expression is strongly up-regulated in response to thermal and oxidative stress and protects cells from apoptotic cell death caused by these phenomena (53
, 54)
. Thus, clusterin might function as a molecular chaperon (55)
. However, not all forms of clusterin exhibit antiapoptotic properties. Recently, a truncated 55 kDa form of clusterin induced by irradiation in vitro has been found targeted to the nucleus where it appears to act as a death signal (56, 57, 58)
. Therefore, the exact biological function of clusterin remains to be elucidated. One interesting possibility is that clusterin could influence the choice between proliferation and differentiation. Indeed, Diemer et al. (59)
have shown that clusterin gene expression correlates with in vitro differentiation of aortic smooth muscle cells. In our group, we have shown that clusterin is widely expressed in developing epithelia during murine embryogenesis. In addition, clusterin mRNA is selectively localized within differentiating layers of tissues such as the developing skin, tooth, and duodenum, where proliferating and differentiating compartments are readily distinguishable (60)
. For instance, the epidermis is comprised of the basal layer of proliferating keratinocytes expressing keratins 5 and 14 and the suprabasal layers of terminally differentiating postmitotic keratinocytes expressing keratins 1 and 10. It turned out that in the skin, clusterin production is confined to suprabasal layers, and in the developing hair follicles, it is localized to the inner root sheath where cells undergo morphogenesis and differentiation (61)
. Thus, we hypothesized that clusterin synthesized by differentiating cells is involved in suppression of cell proliferation either directly (as a bona fide autocrine or paracrine growth factor) or indirectly (via sequestration of other growth factors). To test this hypothesis, the effects of its up- and down-regulation on cell accumulation were investigated. In addition, we studied the effects of purified recombinant clusterin on human epidermal keratinocytes (HEKs) in vitro as well as the effect of clusterin germ-line inactivation on skin carcinogenesis. Our data demonstrate that clusterin indeed negatively affects epithelial cell growth in culture and attenuates neoplastic growth in vivo.
 |
MATERIALS AND METHODS
|
|---|
Neoplastic Transformation of p53-Null Colonocytes by Myc.
Primary murine colonocytes were cultured as described previously (62)
. They were transfected with either LXSN or pBabePuro retroviral DNAs encoding human c-Myc or its 4-hydroxytamoxifen (4-OHT)-dependent version (MycER), respectively. Transfections were performed using the Lipofectamine Plus reagent (Invitrogen, Carlsbad, CA). G418- or puromycin-resistant cells were placed in soft agar, which in case of MycER, was supplemented with 4-OHT (Sigma, St. Louis, MO). Arising colonies were photographed 10 days later and subsequently isolated, pooled, and expanded into mass cultures. For tumorigenicity assays, Myc- and Ki-Ras-overexpressing colonocytes were transplanted into syngeneic C57BL6/J mice (The Jackson Laboratory, Bar Harbor, ME) either s.c. or orthotopically into the cecal wall. Orthotopic transplantation was performed as described by Fidler (63)
. Animals were sacrificed either 4 weeks later or when appearing moribund. Upon euthanasia, they were subjected to gross pathological examination.
[3H]Thymidine Incorporation and Cell Accumulation Assays.
Epithelial cells were seeded in 96-well plates at a density of 104 cells/well, with three replicates/sample. After 48 h, cells were fed with complete medium containing 250 nM 4-OHT (for MycER-expressing cells), clusterin (for primary human cells), or vehicle alone. Twenty-four to 30 h later, 1 µCi of [3H]thymidine (2 Ci/mmol; New England Nuclear, Boston, MA) was added, and cells were cultured for an additional 1218 h. At the end of incubation, the medium was aspirated, and cells were washed twice with 10% trichloroacetic acid and solubilized with 0.2 M NaOH for 30 min at room temperature. The incorporated radioactive thymidine was quantified by liquid scintillation counting. To assess cell accumulation, viable cells were quantified using the WST-1 reagent (Roche Diagnostics, Indianapolis, IN). The reagent was added to the final concentration of 10% and incubated with cells for 24 h. Absorbance was then measured at 450/690 nm using a plate reader.
Microarray and Real-Time Reverse Transcription-PCR Analyses.
RNAs from LMycSN and LXSN (control) colonocytes were isolated using the TRI reagent (Sigma). These RNAs were converted into Cy3- and Cy5-labeled cDNAs and hybridized with the Murine Genome Array U74Av2 (Affymetrix, Santa Clara, CA) per manufacturers recommendations. Data were analyzed using GeneSpring software (Silicon Genetics, Redwood City, CA). Additional microarray experiments were performed using ATLAS nylon array (Clontech, Palo Alto, CA). To confirm differences in gene expression, real-time reverse transcription-PCR reactions were performed using dual-labeled Taqman probes and an ABI Prizm 7700 machine (Applied Biosystems, Foster City, CA). Both the clusterin and the gapdh probes were labeled with 5'-fluorescein phosphoramidite/5'tetrachloro fluorescein phosphoramidite (FAM/TET) at the 5'-end and 6-carboxytetramethylrhodamine (TAMRA) at the 3' end. Their nucleotide compositions were as follows: agcagcctgcccttcctctggatt (clusterin) and tcccactcttccaccttcgatgcc (gapdh). Amplification primers had the following composition: gacccctagagaactccac (clusterin sense), gaatcagttcttcccgag (clusterin antisense), gctacactgaggaccaggttgtct (gapdh sense), and accaggaaatgagcttgacaaaga (gapdh antisense). Before PCR amplification, RNAs were converted into cDNA using SuperScript One-Step RT-PCR System (Invitrogen).
Western Blotting.
For clusterin expression analysis, either cell lysates or conditioned media were used. To prepare lysates, cells were harvested by scraping and solubilized in lysis buffer [50 mM HEPES (pH 7.5), 150 mM NaCl, 1.5 mM MgCl2, 1 mM EGTA, 10% glycerol, 1% Triton X-100, 0.1 mM phenylmethylsulfonyl fluoride, and 1% protease inhibitor mixture (Sigma)]. Protein content was determined using the Bio-Rad DC protein assay kit (Bio-Rad, Hercules, CA). Lysates (40 µg/lane) were resolved on 415% PAGE, transferred to nitrocellulose (Schleicher & Schuell, Keene, NH), and probed with an anti-clusterin antibody (C-18; Santa Cruz Biotechnology, Santa Cruz, CA or A241; Quidel, San Diego, CA) diluted according to manufacturers recommendations. Conditioned media were loaded on PAGE neat. Appropriate secondary antibodies were used in horseradish peroxidase-conjugated forms. Antibody binding was detected using the enhanced chemiluminescence system (Amersham Biosciences, Piscataway, NJ). When indicated, an antibody reactive with murine actin was used to control for equal loading.
Transient Up-Regulation of Clusterin Expression.
The mouse clusterin cDNA (64)
was subcloned into the MigR1 retroviral vector (65)
. Empty MigR1 vector was used as a negative control. p53-null MycER colonocytes were grown to 90% confluence in 24-well plates and transfected with appropriate plasmids using Lipofectamine 2000 (Invitrogen) according to the manufacturers instructions. Conditioned medium was collected 24 h later for Western analysis. At the same time cell accumulation was assessed using the WST-1 reagent (see above).
Stable Down-Regulation of Clusterin Expression via Antisense RNA.
The clusterin antisense construct was obtained by subcloning the 597-nt XbaI/MluI fragment of the full-length human clusterin cDNA from pGEM-4 ZLI (47)
into the pCIneo vector in reverse orientation. The resultant construct was transfected into A431 cells using calcium phosphate method, and individual clones with stable integration of the expression vector were obtained following neomycin selection. The two antisense clones (AS2 and AS10) in which clusterin expression was undetectable by Western were chosen for additional experiments. The empty pCIneo vector was similarly transfected, and neomycin-resistant clones were pooled to produce the control culture.
Culturing of Human Epithelial Cells and Fibroblasts.
HEKs (66)
and outer root sheath keratinocytes (67)
were maintained in Epilife medium containing human keratinocyte growth supplement (Cascade Biologics, Portland, OR). Renal proximal tubule epithelial cells (RPTEC) were obtained from Clonetics and maintained in the RGM-defined medium (Clonetics, San Diego, CA). A431 epidermoid carcinoma cells (68)
were cultured in RPMI 1640 supplemented with 10% FCS as described previously (54)
. The 293 adenovirally transformed embryonic kidney cells (69)
were cultured in DMEM supplemented with 10% FCS (Invitrogen). Primary human dermal fibroblasts were cultured in the same medium.
Overexpression of Myc in HEKs.
A human c-Myc-expressing adenovirus that also coexpresses green fluorescent protein (Ad-MYC-GFP) and an adenovirus expressing GFP alone were generated using reagents developed in the laboratory of Dr. Bert Vogelstein (70)
. Viruses were purified by CsCl gradient, and the effective titer was determined by the frequency of GFP-positive cells after infection. Human foreskin keratinocytes were seeded at a density of 2 x 105 cells/well in Keratinocyte-SFM medium (Invitrogen). The following day, cells were infected with adenovirus diluted in PBS for 90 min. Viral supernatants were replaced with fresh medium, and whole cell extracts were collected 24 and 48 h after infection in Laemmli sample buffer. Myc expression was confirmed using Western blotting.
Overexpression of Recombinant Human Clusterin in 293 Cells.
For clusterin overexpression, a 1430-bp SalI-fragment of the human clusterin gene containing the entire coding sequence (with the exception of the ATG codon and the signal peptide) was used. This fragment was inserted into the pCR3 vector (Invitrogen) encoding the hemagglutinin signal peptide as well as the FLAG-tag and a histidine heptad. Then, the PvuI-linearized construct was transfected into 293 cells using calcium phosphate transfection method, and stable transfectants were selected in G418-containing media. Individual clones were further analyzed using Northern and Western (with an anti-FLAG antibody) blotting. The clone expressing highest levels of recombinant protein was selected as a source of clusterin.
Purification of Recombinant Human Clusterin.
Large scale propagation of 293 cells producing clusterin was performed at Apotech Corp. (Lausanne, Switzerland). Cells were cultured for 7 days in DMEM/F12 medium containing 2% FCS. The supernatant was filtered and passed several times through a column containing anti-FLAG-M2 affinity gel. Retained clusterin was then eluted by 0.1 M citric acid (pH 2.5) and neutralized with 1 M Tris (pH 8.0). Eluted fractions were concentrated using a Jumbosep membrane with a cutoff size 30 kDa (Pall Corp., East Hills, NY). After several washes with endotoxin-free PBS, the protein concentration was determined using the BCA protein assay kit (Pierce Biotechnology, Rockford, IL). In parallel, fractions were obtained that had been depleted of clusterin by passing the preparation overnight at 4°C through a column containing 600 µl of anti-FLAG-M2 affinity gel (Sigma). The depletion was confirmed by Western blotting of aliquots collected prior to (2 µl) and after (20 µl) passing through the column.
Keratinocyte Clonogenic Assay.
A total of 5 x 103 HEKs was plated in 35-mm Petri dishes. Next day, cells were fed with control medium or medium containing 50 µg/ml recombinant clusterin. After culturing for additional 96 h, cells were washed with PBS, fixed with 4% paraformaldehyde for 30 min at room temperature, washed again, and stained with crystal blue in 0.1% borate buffer for 5 min. The numbers of macroscopic colonies was recorded and correlated with the presence or absence of clusterin.
Chemical Skin Carcinogenesis.
Clusterin gene knockout (Clu-null) mice (64)
were backcrossed to the FVB/N background for six generations because this strain is sensitive to 7,12-dimethylbenz(a)anthracene/12-O-tetradecanoylphorbol-13-acetate (DMBA/TPA)-induced skin carcinogenesis (71)
. Forty-five wild-type (wt) FVB/N mice and 42 Clu-null congenics were shaved on the back 2 days before tumor initiation and subjected to single topical applications of 25 µg of DMBA (Fluka, Buchs, Switzerland) in 200 µl of acetone. Tumor promotion was carried out by weekly applications of 4 µg of TPA (Sigma) in 100 µl of acetone. This procedure was continued for 20 weeks. The appearance of papillomas and carcinomas was assessed weekly. Any mice showing obvious invasive carcinomas were euthanized and excluded from additional statistical analysis. Tumor specimens were fixed in 4% phosphate-buffered formaldehyde, embedded in paraffin, cut into 5-µm sections, and stained with H&E. Three sections through different levels were evaluated in a blind fashion and categorized as well, moderately, or poorly differentiated. In well-differentiated carcinomas, morphological characteristics of the epidermis and the capacity to undergo keratinization were preserved. In poorly differentiated carcinomas, there were significant morphological differences between mostly atypical tumor cells and the normal epidermis. Moderately differentiated carcinomas possessed intermediate characteristics. Differences between strains were assessed using the nonparametrical Mann-Whitney U test for papillomas and the
2 test for carcinomas.
 |
RESULTS
|
|---|
Murine p53-Null Colonocytes Are Susceptible to Transformation by c-Myc.
Experimental models to study neoplastic transformation of epithelial cells, colonocytes in particular, remain scarce. To determine whether a previously established line of p53-null murine colonocytes (62)
could be transformed by the c-Myc proto-oncogene, we have used retroviruses expressing Myc in either constitutively active form or as a fusion with the estrogen receptor (MycER). The latter is expressed continuously but requires for activity the presence of the cognate ligand (4-OHT; Ref. 72
). These two forms were encoded by LMycSN (73)
and BabePuroMycER (72)
retroviruses, respectively. LMycSN and BabePuroMycER, along with the corresponding empty vectors (LXSN and BabePuro), were transfected into colonocytes, and transfectants were selected in an appropriate antibiotic (G418 or puromycin). In LMycSN cultures, there was
5-fold overexpression of the retrovirally encoded oncoprotein compared with endogenous c-Myc (Fig. 1A
, left). In MycER cultures, the fusion oncoprotein was constitutively expressed, regardless of the presence of absence of 4-OHT (Fig. 1A
, right). Selected cells were also seeded in soft agar as described in "Materials and Methods." Only colonocytes expressing active Myc (LMycSN- or 4-OHT-treated MycER-transduced) formed large colonies (Fig. 1B
and data not shown) that could be discerned with a naked eye. Such colonies were removed from soft agar, pooled, expanded into cultures, and used for additional analyses.

View larger version (40K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 1. Transformed phenotype of c-Myc-overexpressing p53-null murine colonocytes. A, detection of exogenous Myc proteins in retrovirally transfected colonocytes by Western blotting. Parental cells were used as negative controls. Migration of c-Myc (left panel) and the MycER fusion protein (right panel) is indicated by arrows. Murine ß-actin was used as a loading control. B, bright field microscopy of colonocyte cultures transfected with either empty vector (LXSN) or Myc-encoding retrovirus (LMycSN) and seeded in soft agar as described in "Materials and Methods." C, bright field microscopy of colonocytes expressing MycER protein and either treated continuously with 4-hydroxytamoxifen (4-OHT) or subsequently switched to the normal medium (without 4-OHT). Photographed cells were grown on uncoated Petri dishes and allowed to reach saturated density. D, tritiated thymidine incorporation assay. The rate of thymidine incorporation was determined under two growth conditions: with and without 4-OHT. The ratio of the former to the latter is plotted for each of the indicated cultures. MycER12, 13, 17, and 23 are randomly chosen single-cell clones where expression of MycER has been verified using Western blotting.
|
|
To demonstrate that their transformed phenotype depended on continuous presence of Myc, MycER-overexpressing cultures were deprived of the hormone. Within two to three passages, they were noted to revert to the normal epithelial phenotype, with characteristic cobblestone-like morphology and pronounced contact inhibition of growth resulting in relatively low cell density (Fig. 1C)
. They also grew at much slower rates, as evidenced by total cell accumulation (data not shown) and tritiated thymidine incorporation. The latter assay was performed on randomly chosen single-cell clones with verified expression of Myc. In all clones tested (e.g., 12, 13, 17, and 23), rates of thymidine incorporation were significantly higher in the presence of 4-OHT (Fig. 1D)
.
To determine whether LMycSN-transduced colonocytes were tumorigenic, they were engrafted, either s.c. or orthotopically, into syngeneic or Rag1-null mice. Tumorigenic colonocytes transformed with the Ki-Ras oncogene (62)
were used as a positive control. Although Ki-Ras-overexpressing cells typically formed tumors within 3 weeks, no neoplasms were apparent in mice injected with Myc-overexpressing colonocytes, even after prolonged observation (6 weeks) and when large numbers of cells (107) were used (data not shown). We thus concluded that only in vitro do Myc-overexpressing cells exhibit traits of the neoplastic phenotype. Chief among them is enhanced cell proliferation, both on solid supports and in semi-solid media.
Thrombospondin-1 and Clusterin Are Down-Regulated in Myc-Transformed Colonocytes.
To relate Myc-induced enhanced proliferation to changes in gene expression, we performed microarray analysis comparing cDNAs in LXSN- versus LMycSN-colonocytes. Corresponding RNAs were extracted, converted into Cy3- or Cy5-labeled cDNAs, and hybridized to an Affymetrix U74Av2 mouse chip representing
12,000 genes. Additional microarray experiments were performed, with similar results, using ATLAS nylon arrays. Despite pronounced changes in cellular phenotypes conferred by Myc overexpression, only
50 cDNAs (including expressed sequence tags) were up- or down-regulated >3-fold (Fig. 2A)
. Of these, only 14 up- and 15 down-regulated cDNAs corresponded to characterized genes (Table 2). Surprisingly, none of the up-regulated genes and only one down-regulated gene [gadd45, a well know-target for Myc (23)
], have been implicated in cell cycle control. On the other hand, a third of Myc-down-regulated genes encoded proteins with extracellular localization (shaded rows in Table 2), including thrombospondin-1, which we had identified as a Myc target previously (29
, 30)
. These findings supported the notion that an altered repertoire of extracellular proteins might play an important role in stimulation of cell division by Myc. Of these, clusterin was of particular interest to us because its function has not been firmly established. On the other hand, a homology has been noticed (41)
between amino acids 7798 in clusterin and cysteine-rich thrombospondin type 1 repeats (TSRs; Ref. 74
). Provocatively, TSRs of thrombospondin-1 are thought to mediate its antineoplastic properties (75
, 76)
.
To confirm that clusterin is indeed a target of Myc, we set up a real-time reverse transcription-PCR assay that could reproducibly detect even slight differences in expression levels of clusterin and gapdh (internal standard). This was apparent in the pilot experiment where serial 2-fold dilutions of cDNA were used (data not shown). When cDNAs from LXSN- and LMycSN-colonocytes were tested,
6-fold down-regulation by Myc was observed (
C0t
2.5; Fig. 2B
, bottom two panels), consistent with the microarray data. No differences in gapdh levels were observed. To demonstrate the corresponding difference in protein levels, we performed Western blotting on lysates from LMycSN- and LXSN-transduced colonocytes. As evidenced by data in Fig. 2C
, left panel, overexpression of Myc correlated with decreased clusterin levels. Importantly, no decrease in clusterin levels was observed in cells transformed by Ki-Ras oncogene (Fig. 2C
, parental versus LRasSN). Thus, deregulation of clusterin should be attributed to Myc, not merely to the transformed phenotype of Myc-transduced colonocytes.
To determine whether the clusterin gene was a direct target of Myc, we analyzed MycER colonocytes that had been stimulated with 4-OHT for 96 or 24 h. Down-regulation of clusterin was apparent after 96 h but not after 24 h or in control parental colonocytes (Fig. 1C
, three rightmost panels). This finding could be interpreted in two ways. One possibility is that clusterin is an indirect target of Myc and is repressed by intermediate Myc effectors. The other possibility is that Myc directly interacts with the clusterin gene promoter, but its down-regulation is contingent upon secondary changes conferred by Myc overexpression. This second possibility is consistent with the presence in the clusterin gene promoter (64)
of a sequence ACCA+1CCCGC bearing resemblance to the pyrimidine-rich con-sensus of the initiator element YYCA+1YYYYY, a putative Myc-response element (77)
. Although the detection of possible Myc binding to this sequence was beyond the scope of this study, we were interested in determining whether down-regulation of clusterin contributes to enhanced cell accumulation, the most salient feature of Myc-transformed colonocytes.
Clusterin Levels Affect Accumulation of Neoplastic Colonocytes.
As evidenced by thymidine incorporation assay (Fig. 1D)
, activation of Myc forces cells to enter the S-phase in greater numbers. To determine whether this results in increased cell accumulation and to correlate this increased accumulation with clusterin levels, we measured the number of viable MycER-transduced colonocytes with and without 4-OHT. By the time clusterin was down-regulated (96 h; Fig. 3A
, Western blot in insert), 4-OHT-treated cultures contained 60% more viable cells. However, slight but reproducible differences in cell numbers were apparent as early as 24 h after 4-OHT treatment, i.e., before clusterin levels fell (compare Figs. 3A
and 2C
). Thus, it seemed unlikely that clusterin alone accounts for Myc-dependent increase in cell accumulation. Still, clusterin could be one of the cell growth inhibitors (along with thrombospondin-1) that are down-regulated by Myc and thus contribute to enhanced accumulation.

View larger version (25K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 3. Clusterin expression and colonocyte accumulation. A, growth curves of 4-hydroxytamoxifen-treated (+4-OHT) versus untreated (4-OHT) MycER-expressing colonocytes. Down-regulation of clusterin in conditioned media was confirmed using Western blotting (insert). B, the effect of transient clusterin overexpression on cell accumulation. Eight cultures of MycER-transduced colonocytes were independently transfected with either the empty vector (GFP1 through GFP4, first four lanes) or the murine clusterin/green fluorescent protein (GFP)-encoding retrovirus (Clu1 through Clu4, last four lanes). Clusterin levels in conditioned media were determined using Western blotting (top panel). In the same cultures, the number of viable cells were determined using WST assay (plotted in the bottom panel). Average cell accumulation was also plotted (insert) and analyzed using unpaired Student t test. Observed differences were statistically significant (P < 0.05).
|
|
To test whether this was indeed the case, we have generated a murine clusterin-encoding retrovirus and transfected it into 4-OHT-treated MycER colonocytes with very low levels of endogenous clusterin. We chose not to select for stable clusterin-overexpressing clones because those would arise after in vitro selection and could be enured to potential inhibitory effects of clusterin. Instead, 24 h after transfection, we directly measured cell accumulation and correlated it to clusterin levels. The efficiency of transient transfection was moderate, in the range of 1520%, as judged by the number of GFP-expressing cells (data not shown). However, increased clusterin secretion was apparent when Western blotting was performed on culture supernatants (Fig. 3B
, top panel). Furthermore, because clusterin is a secreted protein, its increased levels in conditioned media could affect, in a paracrine fashion, all cells albeit modestly. Indeed, all cultures transfected with the clusterin construct (Clu1 through 4) contained fewer cells than their "vector only" (GFP1 through 4) counterparts (graph in Fig. 3B
). On average, transient overexpression of clusterin resulted in
12% decrease in cell accumulation (insert, light gray versus dark gray bars, P = 0.033). This decrease could not account for the full range of Myc effects but was consistent with clusterin being one of the Myc-down-regulated inhibitors of colonocyte proliferation. We next asked whether this "inhibit the inhibitor" strategy plays out in other types of epithelial cells, in particular in keratinocytes that are available both as primary explants (HEKs) and as epidermoid tumor cell lines.
Clusterin Inhibits Accumulation of Transformed Epidermal Cells and Is Down-Regulated in Myc-Overexpressing Keratinocytes.
To analyze the effect of clusterin on transformed keratinocytes, we have chosen A431 human epidermoid carcinoma cells (68)
where levels of clusterin are relatively high and further increase in its levels would be difficult to achieve. Thus, we generated an anti-sense RNA construct (see "Materials and Methods") and introduced it into A431 cells. The efficiency of clusterin expression inhibition was assessed using Western blotting (Fig. 4A
, insert). Clones with virtually undetectable clusterin levels were compared with empty vector-transfected cells with respect to cell accumulation. Both clones with silenced clusterin grew much faster than parental cells as evidenced by increased numbers of viable cells (Fig. 4A
, graph).

View larger version (65K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 4. Clusterin expression and accumulation of human keratinocytes. A, accumulation of neoplastic epidermoid A431 cells expressing varying levels of clusterin. Empty vector-transfected cells (Vect) were compared with two clones (AS2 and AS10) expressing antisense clusterin RNA (see "Materials and Methods"). Down-regulation of clusterin was confirmed using Western blotting (insert). Recombinant human clusterin (rClu) was used as a positive control. WT refers to parental A431 cells. B, infection of human epidermal keratinocytes with a Myc/GFP-encoding adenovirus (Ad-MYC-GFP, bottom panels). Top panels refer to the empty vector-infected cells. The two left panels were obtained using bright field microscopy, the two right panels were obtained using fluorescent microscopy [for green fluorescent protein (GFP) expression]. C, Western blotting performed on cells in B. For clusterin and actin detection, undiluted lysates were used; for Myc detection, they were diluted 1:50.
|
|
We next asked whether clusterin would be subjected to down-regulation by Myc in primary HEKs. In these cells, Myc is known to induce hyperproliferation (78)
. We thus generated a recombinant adenovirus coexpressing Myc and GFP and used it to infect HEK as described in "Materials and Methods." The efficiency of infection approached 100%, as judged by visual examination of infected cultures under fluorescent light (Fig. 4B
, right). When lysates were prepared from these cultures and used for Western blotting, it became apparent that clusterin levels in AdMycGFP-HEKs were several fold lower that in control AdGFP-HEKs (Fig. 4C)
. The effect of clusterin down-regulation on HEK proliferation could be studied using either transient expression assays (see above) or purified recombinant protein. Because HEKs are rather refractory to conventional transfection techniques, the second approach was chosen.
Recombinant Human Clusterin Inhibits Proliferation of Keratinocytes and Other Epithelial Cells.
To study the role of clusterin in HEK proliferation in vitro, we generated recombinant human clusterin. We fused the clusterin coding sequence to the hemagglutinin signal peptide and both FLAG and histidine tags, as described in "Materials and Methods." The recombinant construct was introduced into 293 embryonic kidney cells, and their supernatants were used for clusterin purification. Under reducing conditions, the purified fraction (Fig. 5A
"Coomassie") revealed the 40-kDa monomeric reduced, 7580-kDa heterodimeric nonreduced form, small quantities of BSA, and also several high molecular weight species that were not reactive with the anti-clusterin antibody (Fig. 5A
, "Immunoblot"). The latter were estimated to represent <10% of the total preparation. The reduced 40-kDa form of clusterin was predominant and comigrated in PAGE with clusterin detected by an anti-clusterin antibody in human serum (Fig. 5B)
.

View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 5. Growth inhibitory properties of recombinant human clusterin (Clu) produced in 293 cells. A, Coomassie Blue staining (left lane) and Western blotting with an anti-Clu antibody (right lane) of the Clu preparation. Both monomeric ( 40 kDa) and heterodimeric ( 80 kDa) forms are present under reducing conditions. In the left lane, copurifying BSA is also detectable. B, Western blotting performed on 0.21 µg of the Clu preparation (r-hClu) electrophoresed under reducing conditions alongside a 0.2 µl-aliquot of normal human serum (hSer). C, dose-dependent inhibition by Clu of the growth of human epithelial keratinocyte (HEK). [3H]Thymidine incorporation (left panel) and numbers of viable cells (middle panel) were plotted against concentrations of Clu in growth medium. The right panel depicts the outgrowth of single cell clones of sparsely seeded HEK after 5 days either in the absence (two duplicate plates in top row) or in the presence (two duplicate plates in bottom row) of r-hClu (50 µg/ml). D, the effect of Clu on proliferation of outer root sheath keratinocytes (ORS) and renal proximal tubule epithelial cells (RPTECs). The experimental setup was as in C, left panel. E, proliferation of cells in Clu-containing media (50 µg/ml) before and after depletion with an anti-FLAG antibody. The efficacy of depletion was assessed using Western blotting (top three panels; "+" and "" refer to undepleted and depleted media, respectively. [ 3]Thymidine incorporation was assessed in HEK, RPTEC, and primary human dermal fibroblasts (FBs). All experiments were performed in triplicates. Error bars refer to SEs of two to five independent experiments. F, accumulation of HEK in control medium ("Cont") or media supplemented with BSA (50 µg/ml) or Clu (50 µg/ml).
|
|
To test whether clusterin inhibits keratinocyte proliferation, we treated HEK cultures with recombinant clusterin and measured [3H]thymidine incorporation, total cell accumulation (both after 48 h), and clonal outgrowth (after 96 h) as described in "Materials and Methods." In the first two experiments, clusterin inhibited DNA replication and cell accumulation in a dose-dependent manner and also negatively affected clonal outgrowth when present at a concentration of 50 µg/ml (Fig. 5C
, left, center, and right panels, respectively). No cell toxicity or apoptosis was apparent in treated cultures. Importantly, inhibitory concentrations were physiologically relevant because clusterins concentration in serum is in the 50200 µg/ml range. To extend our observation to other epithelial cells, we also treated with clusterin outer root sheath keratinocytes and renal proximal tubule epithelial cells. With both outer root sheath keratinocytes and renal proximal tubule epithelial cells, the same inhibitory effect of clusterin on thymidine incorporation was observed (Fig. 5D)
. Importantly, this effect was caused by clusterin itself because the depletion of conditioned media on the affinity column efficiently removed clusterin and at the same time abolished the inhibitory effect on epithelial cell proliferation (Fig. 5E)
. In contrast, presence or absence of clusterin didnt affect proliferation of primary human dermal fibroblasts, even at high concentrations (50 µg/ml). To rule out that cell accumulation is negatively affected by copurifying BSA, we incubated HEK in media containing defined concentrations of BSA or Clu. In this experiment, BSA was found to slightly increase cell accumulation, whereas clusterin decreased it (Fig. 5F)
. Taken together, these results suggested that clusterin is a bona fide inhibitor of epithelial cell proliferation in vitro.
Clusterin Inhibits Mouse Skin Tumor Development and Persistence but Not Tumor Progression.
To determine whether clusterin attenuates neoplastic growth in vivo, we performed a chemical DMBA/TPA skin carcinogenesis assay in wt and clusterin-null mice (64)
. In both groups tumors began to emerge after a similar latency (78 weeks), and their sizes and histological appearances did not vary significantly (data not shown). However, at week 20, the mean number of papillomas/mouse was significantly higher in clusterin-null mice than in wt mice (P = 0.02, Mann-Whitney U test; Fig. 6, A and B
). The same was true for the entire first 18-week period (P = 0.036). During weeks 2035, mice began to develop invasive carcinomas and had to be euthanized. Thus, comprehensive statistical analysis of papilloma persistence was hindered by low number of animals. Still, by week 35, the mean number of remaining papillomas in clusterin-null mice was strikingly higher than in their wt counterparts (3.3 versus 0.8 papillomas/mouse). These data demonstrate that, at early stages of carcinogenesis, the production of clusterin attenuates the development and persistence of benign tumors, probably via growth suppression.
Both groups of mice were also monitored for the development of invasive squamous cell carcinomas, which in the FVB/N background occurs in
60% of mice (71)
. All squamous cell carcinomas were categorized as well-, moderately, or poorly differentiated, as described in "Materials and Methods." There were no statistically significant differences between clusterin-null and wt mice in the timing of carcinoma development and the rate of malignant conversion (19 and 15%, respectively; data not shown). However, squamous cell carcinomas developing in clusterin-null mice appeared on average better differentiated and less aggressive. Indeed, at 42 weeks, the percentage of poorly or undifferentiated squamous cell carcinomas in clusterin-null animals was 20% (12 of 60), compared with over 50% (32 of 61) in wt mice (Fig. 6, C and D
;
2 test, P < 0.001). Therefore, once the papilloma have developed, expression of clusterin favors the development of more poorly differentiated and more aggressive carcinoma phenotypes. This observation is consistent with the idea that tumor-attenuating properties of clusterin are realized early in tumor progression when cell proliferation is likely to be a limiting factor.
 |
DISCUSSION
|
|---|
Carcinogenesis in humans is a multistep process involving initiation and promotion mechanisms. These mechanisms rely on the inactivation of one or more tumor suppressor genes and the activation of certain proto-oncogenes, resulting in uncontrolled proliferation of tumor cell precursors. This enhanced proliferation could be aided by decreased synthesis of or decreased response to endogenous growth inhibitors. The latter are exemplified by the members of the transforming growth factor (TGF)-ß family such as TGF-ß1 and TGF-ß2. These are secreted proteins that are constitutively synthesized by a wide variety of cell types in many species and are potentially implicated in many biological processes, including cell proliferation and differentiation (79)
. The interplay between Myc and TGF-ß is now recognized as an important regulator of cell proliferation (80)
. TGF-ß is also regulated at the posttranslational level (81)
, and one of its key activators is none other than thrombospondin-1, which releases TGF-ß from a latent complex (82
, 83)
. The binding to TGF-ß is mediated by a distinct amino acid sequence flanked by two type 1 repeats (TSR) within thrombospondin-1 (reviewed in Ref. 84
). Interestingly, TSR-homologous sequences are present in dozens of otherwise unrelated proteins which comprise the TSR superfamily (74)
. On the basis of the homology with thrombospondin-1, we suggested that clusterin might belong to the same superfamily and share some of the functions attributed to its members, for instance, inhibition of cell proliferation. Furthermore, we have previously demonstrated that clusterin mRNA expression is restricted to differentiating rather than proliferating cells in several differentiated epithelia. On the basis of these facts, we asked whether clusterin is a negative regulator of cell proliferation in vitro and in vivo.
In this study, we present evidence that clusterin is down-regulated in cultured epithelial cells that accelerate their growth rate in response to c-Myc activation. Moreover, clusterin was found to directly inhibit growth and accumulation of murine colonocytes, human keratinocytes, and other epithelial cells in vitro. Inhibition of cell proliferation was somewhat cell type specific because purified recombinant clusterin has no effect on fibroblasts. Our results are in accordance with published data that proliferation of human fibroblasts genetically modified to overexpress clusterin is not inhibited (85)
, but exposure to clusterin of human prostate cancer cell line LNCaP (86)
as well as SV40-immortalized prostate epithelial cells (87)
resulted in slower growth rates.
Given the negative role that clusterin plays in epithelial cell proliferation, it seemed likely that it attenuates neoplastic growth in vivo. To address this possibility, we performed chemical skin carcinogenesis in wt and clusterin-null mice. In this system, topical application of DMBA/TPA leads to the formation of benign papillomas. These small neoplasms arise almost exclusively due to enhanced cell proliferation because invasive growth, angiogenesis, and metastasis are not required for their development (88)
. We demonstrated here for the first time that the lack of clusterin increases the susceptibility to tumorigenesis after carcinogenic challenge. Indeed, the mean number of benign papillomas/mouse is significantly increased in the absence of clusterin. Interestingly, clusterin-null mice have not been noted to develop any spontaneous tumors. Therefore, its absence is not sufficient to induce cell proliferation, but once a proliferative signal (e.g., DMBA/TPA) is provided, neoplastic growth is less constrained. Thus, we consider clusterin to be not a tumor suppressor but a tumor attenuator acting predominantly at early stages of neoplastic growth.
This idea could explain why clusterin expression has been reported in a variety of neoplasms. Existing data indicate that clusterin is abundantly produced in several types of human cancers such as breast (89)
, renal clear cell (90)
, and prostate (91)
carcinomas. However, it has not been demonstrated that clusterin is produced in the same cells that undergo proliferation. It is thus possible that clusterin is activated to counteract oncogenic stimuli in non- or slowly proliferating tumor compartments. Activation of growth inhibitors in tumor tissues has been reported, p16 cyclin-dependent kinase-inhibitor being a prime example (92)
. It would be interesting to determine, using laser microdissection, whether or not expression of clusterin correlates with lower bromodeoxyuridine incorporation and lower mitotic indices. When such a detailed analysis was performed followed by serial analysis of gene expression, strong down-regulation of clusterin was immediately apparent in highly malignant MD PR317 prostate adenocarcinoma cells (Tag Odds Normal:Cancer = 5.85, The Cancer Genome Anatomy Project).7
Interestingly, during late stages of skin carcinogenesis, clusterin expression seems to favor tumor progression because in clusterin-null mice papillomas progress into more differentiated squamous cell carcinomas than in wt mice. In addition, some previous studies have shown that clusterin could favor the metastatic process (93)
. Thus, clusterin might act in a biphasic fashion during skin carcinogenesis as a tumor attenuator early on and as an enhancer of the malignant phenotype in full-fledged tumors. Similar effects have already been attributed to TGF-ß during skin carcinogenesis (94)
and thrombospondin-1 in breast and other carcinomas (95)
. This raises the question whether inactivation of clusterin should be attempted or avoided in cancer patients. Although the former approach is currently being tested (96
, 97)
, our data indicate that high levels of clusterin might be protective against early stages of neoplastic growth. This discrepancy will have to be resolved before additional clinical interventions are attempted.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Gertraud Radlgruber and Bernadette Mermillod (University of Geneva) for technical assistance and for assistance with statistical analyses, respectively. We thank Dr. Jeffrey Ilardi, Gautam Rajpal, and Monica Lee (University of Pennsylvania) for their help with generation of murine clusterin-expressing retroviruses. We also thank Isaiah Fidler (M. D. Anderson Cancer Center) for his help with learning the technique of orthotopic transplantation.
 |
FOOTNOTES
|
|---|
Grant support: National Science Foundation, Geneva and Swiss Cancer Leagues, and Ernst & Lucie Schmidheiny and Stanley Thomas Johnson Foundations (L. French), and National Cancer Institute Grant CA 071881 and National Institute of Diabetes and Digestive and Kidney Diseases Grant DK 050306 (A. Thomas-Tikhonenko).
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Note: A. Thomas-Tikhonenko and I. Viard-Leveugle contributed equally to this work.
Requests for reprints: Andrei Thomas-Tikhonenko, University of Pennsylvania, 3800 Spruce Street, M/C 6051, Philadelphia, PA 19104-6051 or Lars French, Louis-Jeantet Skin Cancer Lab 5.222, Geneva University Medical Center, 1, rue Michel Servet, 1211 Genève 4, Switzerland.
6 Internet address: http://www.myccancergene.org. 
7 Internet address: http://cgap.nci.nih.gov. 
Received 7/ 2/03.
Revised 2/10/03.
Accepted 2/23/04.
 |
REFERENCES
|
|---|
- Grandori C, Cowley SM, James LP, Eisenman RN The Myc/Max/Mad network and the transcriptional control of cell behavior. Ann Rev Cell Dev Biol, 16: 653-99, 2000.[CrossRef][Medline]
- Blackwell TK, Kretzner L, Blackwood EM, Eisenman RN, Weintraub H Sequence-specific DNA binding by the c-myc protein. Science (Wash. DC), 250: 1149-51, 1990.[Abstract/Free Full Text]
- Kretzner L, Blackwood EM, Eisenman RN Myc and Max proteins possess distinct transcriptional activities. Nature (Lond.), 359: 426-9, 1992.[CrossRef][Medline]
- Amati B, Dalton S, Brooks MW, Littlewood TD, Evan GI, Land H Transcriptional activation by the human c-Myc oncoprotein in yeast requires interaction with Max. Nature (Lond.), 359: 423-6, 1992.[CrossRef][Medline]
- McMahon SB, Van BA, Dugan KA, Copeland TD, Cole MD The novel ATM-related protein TRRAP is an essential cofactor for the c-Myc and E2F oncoproteins. Cell, 94: 363-74, 1998.[CrossRef][Medline]
- McMahon SB, Wood MA, Cole MD The essential cofactor TRRAP recruits the histone acetyltransferase hGCN5 to c-Myc. Mol Cell Biol, 20: 556-62, 2000.[Abstract/Free Full Text]
- Amati B, Frank SR, Donjerkovic D, Taubert S Function of the c-Myc oncoprotein in chromatin remodeling and transcription. Biochim Biophys Acta, 1471: M135-45, 2001.[Medline]
- Li L, Nerlov C, Prendergast GC, Ziff EB c-Myc represses transcription in vivo by a novel mechanism dependent on the initiator element and Myc box II. EMBO J, 13: 4070-9, 1994.[Medline]
- Staller P, Peukert K, Kiermaier A, et al Repression of p15INK4b expression by Myc through association with Miz-1. Nat Cell Biol, 3: 392-9, 2001.[CrossRef][Medline]
- Oster SK, Ho CS, Soucie EL, Penn LZ The myc oncogene: marvelously complex. Adv Cancer Res, 84: 81-154, 2002.[Medline]
- OConnell BC, Cheung AF, Simkevich CP, et al A large scale genetic analysis of c-Myc-regulated gene expression patterns. J Biol Chem, 278: 12563-73, 2003.[Abstract/Free Full Text]
- Bello-Fernandez C, Packham G, Cleveland JL The ornithine decarboxylase gene is a transcriptional target of c-Myc. Proc Natl Acad Sci USA, 90: 7804-8, 1993.[Abstract/Free Full Text]
- Jansen-Durr P, Meichle A, Steiner P, et al Differential modulation of cyclin gene expression by MYC. Proc Natl Acad Sci USA, 90: 3685-9, 1993.[Abstract/Free Full Text]
- Galaktionov K, Chen X, Beach D cdc25 cell cycle phosphatase as a target of c-myc. Nature (Lond.), 382: 511-7, 1996.[CrossRef][Medline]
- Hermeking H, Rago C, Schuhmacher M, et al Identification of CDK4 as a target of c-MYC. Proc Natl Acad Sci USA, 97: 2229-34, 2000.[Abstract/Free Full Text]
- Lasorella A, Noseda M, Beyna M, Iavarone A Id2 is a retinoblastoma protein target and mediates signalling by Myc oncoproteins. Nature (Lond.), 407: 592-8, 2000.[CrossRef][Medline]
- Wang J, Xie LY, Allan S, Beach D, Hannon GJ Myc activates telomerase. Genes Dev, 12: 1769-74, 1998.[Abstract/Free Full Text]
- Philipp A, Schneider A, Vasrik I, et al Repression of cyclin D1: a novel function of MYC. Mol Cell Biol, 14: 4032-43, 1994.[Abstract/Free Full Text]
- Mitchell KO, El-Deiry WS Overexpression of c-Myc inhibits p21WAF1/CIP1 expression and induces S-phase entry in 12-O-tetradecanoylphorbol-13-acetate (TPA)-sensitive human cancer cells. Cell Growth Differ, 10: 223-30, 1999.[Abstract/Free Full Text]
- Claassen GF, Hann SR A role for transcriptional repression of p21CIP1 by c-Myc in overcoming transforming growth factor ß-induced cell cycle arrest. Proc Natl Acad Sci USA, 97: 9498-503, 2000.[Abstract/Free Full Text]
- Gartel AL, Ye X, Goufman E, et al Myc represses the p21(WAF1/CIP1) promoter and interacts with Sp1/Sp3. Proc Natl Acad Sci USA, 98: 4510-5, 2001.[Abstract/Free Full Text]
- Seoane J, Pouponnot C, Staller P, Schader M, Eilers M, Massague J TGF-ß influences Myc, Miz-1 and Smad to control the CDK inhibitor p15INK4b. Nat Cell Biol, 3: 400-8, 2001.[CrossRef][Medline]
- Marhin WW, Chen S, Facchini LM, Fornace AJ, Penn LZ Myc represses the growth arrest gene gadd45. Oncogene, 14: 2825-34, 1997.[CrossRef][Medline]
- Lee TC, Li L, Philipson L, Ziff EB Myc represses transcription of the growth arrest gene gas1. Proc Natl Acad Sci USA, 94: 12886-91, 1997.[Abstract/Free Full Text]
- Eilers M, Picard D, Yamamoto KR, Bishop JM Chimaeras of Myc oncoprotein and steroid receptors cause hormone-dependent transformation of cells. Nature (Lond.), 340: 66-8, 1989.[CrossRef][Medline]
- Mateyak MK, Obaya AJ, Adachi S, Sedivy JM Phenotypes of c-Myc-deficient rat fibroblasts isolated by targeted homologous recombination. Cell Growth Differ, 8: 1039-48, 1997.[Abstract]
- Johnston LA, Prober DA, Edgar BA, Eisenman RN, Gallant P Drosophila myc regulates cellular growth during development. Cell, 98: 779-90, 1999.[CrossRef][Medline]
- Trumpp A, Refaeli Y, Oskarsson T, et al c-Myc regulates mammalian body size by controlling cell number but not cell size. Nature (Lond.), 414: 768-73, 2001.[CrossRef][Medline]
- Tikhonenko AT, Black DJ, Linial ML Viral Myc oncoproteins in infected fibroblasts down-modulate thrombospondin-1, a possible tumor suppressor gene. J Biol Chem, 271: 30741-7, 1996.[Abstract/Free Full Text]
- Janz A, Sevignani C, Kenyon K, Ngo C, Thomas-Tikhonenko A Activation of the Myc oncoprotein leads to increased turnover of thrombospondin-1 mRNA. Nucleic Acids Res, 28: 2268-75, 2000.[Abstract/Free Full Text]
- Guo N, Templeton NS, Al-Barazi H, et al Thrombospondin-1 promotes alpha3beta1 integrin-mediated adhesion and neurite-like outgrowth and inhibits proliferation of small cell lung carcinoma cells. Cancer Res, 60: 457-66, 2000.[Abstract/Free Full Text]
- Armstrong LC, Bjorkblom B, Hankenson KD, Siadak AW, Stiles CE, Bornstein P Thrombospondin 2 inhibits microvascular endothelial cell proliferation by a caspase-independent mechanism. Mol Biol Cell, 13: 1893-905, 2002.[Abstract/Free Full Text]
- Tomii Y, Kamochi J, Yamazaki H, et al Human thrombospondin 2 inhibits proliferation of microvascular endothelial cells. Int J Oncol, 20: 339-42, 2002.[Medline]
- Lawler J Thrombospondin-1 as an endogenous inhibitor of angiogenesis and tumor growth. J Cell Mol Med, 6: 1-12, 2002.[Medline]
- Ngo C, Gee MS, Akhtar N, et al An in vivo function for the transforming myc protein: elicitation of the angiogenic phenotype. Cell Growth Differ, 11: 201-10, 2000.[Abstract/Free Full Text]
- Watnick RS, Cheng YN, Rangarajan A, Ince TA, Weinberg RA Ras modulates Myc activity to repress thrombospondin-1 expression and increase tumor angiogenesis. Cancer Cell, 3: 219-31, 2003.[CrossRef][Medline]
- Brandvold KA, Neiman P, Ruddell A Angiogenesis is an early event in the generation of myc-induced lymphomas. Oncogene, 19: 2780-5, 2000.[CrossRef][Medline]
- Pelengaris S, Littlewood T, Khan M, Elia G, Evan GI Reversible activation of c-Myc in skin: induction of a complex neoplastic phenotype by a single oncogenic lesion. Mol Cell, 3: 565-77, 1999.[CrossRef][Medline]
- Zeller KI, Jegga AG, Aronow B, ODonnell KA, Dang CV An integrated database of genes responsive to the Myc oncogenic transcription factor: identification of direct genomic targets. Genome Biol, 4: R69.1-10, 2003.
- Louro ID, Bailey EC, Li X, et al Comparative gene expression profile analysis of GLI and c-MYC in an epithelial model of malignant transformation. Cancer Res, 62: 5867-73, 2002.[Abstract/Free Full Text]
- Jenne DE, Tschopp J Clusterin: the intriguing guises of a widely expressed glycoprotein. Trends Biochem Sci, 17: 154-9, 1992.[CrossRef][Medline]
- Rosenberg M, Silkensen J Clusterin: physiologic and pathophysiologic considerations. Int J Biochem Cell Biol, 27: 633-45, 1995.[CrossRef][Medline]
- Blaschuk O, Burdzy K, Fritz IB Purification and characterization of a cell-aggregating factor (clusterin), the major glycoprotein in ram rete testis fluid. J Biol Chem, 258: 7714-20, 1983.[Abstract/Free Full Text]
- Fritz IB, Burdzy K, Setchell B, Blaschuk O Ram rete testis fluid contains a protein (clusterin) which influences cell-cell interactions in vitro. Biol Reprod, 28: 1173-88, 1983.[Abstract]
- Tung PS, Burdzy K, Wong K, Fritz IB Competition between cell-substratum interactions and cell-cell interactions. J Cell Physiol, 152: 410-21, 1992.[CrossRef][Medline]
- Choi NH, Mazda T, Tomita M A serum protein SP40,40 modulates the formation of membrane attack complex of complement on erythrocytes. Mol Immunol, 26: 835-40, 1989.[CrossRef][Medline]
- Jenne DE, Tschopp J Molecular structure and functional characterization of a novel human cytolysis inhibitor (CLI) found in blood and seminal plasma. Identity to sulfated glycoprotein 2 (SGP-2), a constituent of rat testis fluid. Proc Natl Acad Sci USA, 86: 7123-7, 1989.[Abstract/Free Full Text]
- Kirszbaum L, Sharpe JA, Murphy B, et al Molecular cloning and characterization of the novel, human complement-associated protein, SP-40,40: a link between the complement and reproductive systems. EMBO J, 8: 711-8, 1989.[Medline]
- de Silva HV, Stuart WD, Duvic CR, et al A 70-kDa apolipoprotein designated ApoJ is a marker for subclasses of human plasma high density lipoproteins. J Biol Chem, 265: 13240-7, 1990.[Abstract/Free Full Text]
- James RW, Hochstrasser AC, Borghini I, Martin B, Pometta D, Hochstrasser D Characterization of a human high density lipoprotein-associated protein, NA1/NA2. Identity with SP-40,40, an inhibitor of complement-mediated cytolysis. Arterioscler Thromb, 11: 645-52, 1991.[Abstract/Free Full Text]
- Jenne DE, Lowin B, Peitsch MC, Böttcher A, Schmitz G, Tschopp J Clusterin (complement lysis inhibitor) forms a high density lipoprotein complex with apolipoprotein A-I in human plasma. J Biol Chem, 266: 11030-6, 1991.[Abstract/Free Full Text]
- French LE, Wohlwend A, Sappino AP, Tschopp J, Schifferli JA Human clusterin gene expression is confined to surviving cells during in vitro programmed cell death. J Clin Investig, 93: 877-84, 1994.
- Schwochau GB, Nath KA, Rosenberg ME Clusterin protects against oxidative stress in vitro through aggregative and nonaggregative properties. Kidney Int, 53: 1647-53, 1998.[CrossRef][Medline]
- Viard I, Wehrli P, Jornot L, et al Clusterin gene expression mediates resistance to apoptotic cell death induced by heat shock and oxidative stress. J Investig Dermatol, 112: 290-6, 1999.[CrossRef][Medline]
- Wilson MR, Easterbrook-Smith SB Clusterin is a secreted mammalian chaperone. Trends Biochem Sci, 25: 95-8, 2000.[CrossRef][Medline]
- Yang CR, Leskov K, Hosley-Eberlein K, et al Nuclear clusterin/XIP8, an X-ray-induced Ku70-binding protein that signals cell death. Proc Natl Acad Sci USA, 97: 5907-12, 2000.[Abstract/Free Full Text]
- Criswell T, Klokov D, Beman M, Lavik JP, Boothman DA Repression of IR-inducible clusterin expression by the p53 tumor suppressor protein. Cancer Biol Ther, 2: 372-80, 2003.[Medline]
- Leskov KS, Klokov DY, Li J, Kinsella TJ, Boothman DA Synthesis and functional analyses of nuclear clusterin, a cell death protein. J Biol Chem, 278: 11590-600, 2003.[Abstract/Free Full Text]
- Diemer V, Hoyle M, Baglioni C, Millis A Expression of porcine complement inhibitor mRNA in cultured aortic smooth muscle cells: changes during differentiation in vitro. J Biol Chem, 267: 5257-64, 1992.[Abstract/Free Full Text]
- French LE, Chonn A, Ducrest D, et al Murine clusterin: molecular cloning and mRNA localization of a gene associated with epithelial differentiation processes during embryogenesis. J Cell Biol, 122: 1119-30, 1993.[Abstract/Free Full Text]
- Seiberg M, Marthinuss J Clusterin expression within skin correlates with hair growth. Dev Dyn, 202: 294-301, 1995.[Medline]
- Sevignani C, Wlodarski P, Kirillova J, et al Tumorigenic conversion of p53-deficient colon epithelial cells by an activated Ki-ras gene. J Clin Investig, 101: 1572-80, 1998.[Medline]
- Fidler IJ Orthotopic implantation of human colon carcinomas into nude mice provides a valuable model for the biology and therapy of metastasis. Cancer Metastasis Rev, 10: 229-43, 1991.[CrossRef][Medline]
- McLaughlin L, Mistry M, Zhu G, et al Apolipoprotein J/Clusterin limits the severity of murine autoimmune myocarditis. J Clin Investig, 106: 1105-13, 2000.[Medline]
- Pear WS, Miller JP, Xu L, et al Efficient and rapid induction of a chronic myelogenous leukemia-like myeloproliferative disease in mice receiving P210 bcr/abl-transduced bone marrow. Blood, 92: 3780-92, 1998.[Abstract/Free Full Text]
- Limat A, Hunziker T, Boillat C, Bayreuther K, Noser F Post-mitotic human dermal fibroblasts efficiently support the growth of human follicular keratinocytes. J Investig Dermatol, 92: 758-62, 1989.[CrossRef][Medline]
- Limat A, Noser F Serial cultivation of single keratinocytes from the outer root sheath of human scalp hair follicles. J Investig Dermatol, 87: 485-8, 1986.[CrossRef][Medline]
- Giard DJ, Aaronson S, Todaro GJ, et al In vitro cultivation of human tumors: establishment of cell lines derived from a series of solid tumors. J Natl Cancer Inst (Bethesda), 51: 1417-23, 2003.
- Graham FL, Smiley J, Russell WC, Nairn R Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J Gen Virol, 36: 59-74, 1977.[Abstract/Free Full Text]
- He TC, Zhou S, da Costa LT, Yu J, Kinzler KW, Vogelstein B A simplified system for generating recombinant adenoviruses. Proc Natl Acad Sci USA, 95: 2509-14, 1998.[Abstract/Free Full Text]
- Hennings H, Glick AB, Lowry DT, et al FVB/N mice: an inbred strain sensitive to the chemical induction of squamous cell carcinomas in the skin. Carcinogenesis, 14: 2353-8, 1993.[Abstract/Free Full Text]
- Littlewood TD, Hancock DC, Danielian PS, Parker MG, Evan GI A modified oestrogen receptor ligand-binding domain as an improved switch for the regulation of heterologous proteins. Nucleic Acids Res, 23: 1686-90, 1995.[Abstract/Free Full Text]
- Blackwood EM, Lugo TG, Kretzner L, et al Functional analysis of the AUG- and CUG-initiated forms of the c-Myc protein. Mol Biol Cell, 5: 597-609, 1994.[Abstract]
- Adams JC, Tucker RP The thrombospondin type 1 repeat (TSR) superfamily: diverse proteins with related roles in neuronal development. Dev Dyn, 218: 280-99, 2000.[CrossRef][Medline]
- Guo N, Krutzsch HC, Inman JK, Roberts DD Thrombospondin 1 and type I repeat peptides of thrombospondin 1 specifically induce apoptosis of endothelial cells. Cancer Res, 57: 1735-42, 1997.[Abstract/Free Full Text]
- Iruela-Arispe ML, Lombardo M, Krutzsch HC, Lawler J, Roberts DD Inhibition of angiogenesis by thrombospondin-1 is mediated by 2 independent regions within the type 1 repeats. Circulation, 100: 1423-31, 1999.[Abstract/Free Full Text]
- Claassen GF, Hann SR Myc-mediated transformation: the repression connection. Oncogene, 18: 2925-33, 1999.[CrossRef][Medline]
- Cerezo A, Stark HJ, Moshir S, Boukamp P Constitutive overexpression of human telomerase reverse transcriptase but not c-myc blocks terminal differentiation in human HaCaT skin keratinocytes. J Investig Dermatol, 121: 110-9, 2003.[CrossRef][Medline]
- Derynck R, Akhurst RJ, Balmain A TGF-ß signaling in tumor suppression and cancer progression. Nat Genet, 29: 117-29, 2001.[CrossRef][Medline]
- Amati B Integrating Myc and TGF-ß signalling in cell-cycle control. Nat Cell Biol, 3: E112-3, 2001.[CrossRef][Medline]
- Gumienny TL, Padgett RW The other side of TGF-ß superfamily signal regulation: thinking outside the cell. Trends Endocrinol Metabol, 13: 295-9, 2002.[CrossRef][Medline]
- Crawford SE, Stellmach V, Murphy-Ullrich JE, et al Thrombospondin-1 is a major activator of TGF-ß1 in vivo. Cell, 93: 1159-70, 1998.[CrossRef][Medline]
- Ribeiro SM, Poczatek M, Schultz-Cherry S, Villain M, Murphy-Ullrich JE The activation sequence of thrombospondin-1 interacts with the latency-associated peptide to regulate activation of latent transforming growth factor ß. J Biol Chem, 274: 13586-93, 1999.[Abstract/Free Full Text]
- Chen H, Herndon ME, Lawler J The cell biology of thrombospondin-1. Matrix Biol, 19: 597-614, 2000.[CrossRef][Medline]
- Petropoulo C, Trougakos I, Kolettas E, Toussaint O, Gonos E Clusterin/apolipoprotein J is a novel biomarker of cellular senescence that does not affect the proliferative capacity of human diploid fibroblasts. FEBS Lett, 509: 287-97, 2001.[CrossRef][Medline]
- Zhou W, Janulis L, Park II, Lee C A novel anti-proliferative property of clusterin in prostate cancer cells. Life Sci, 72: 11-21, 2002.[CrossRef][Medline]
- Bettuzzi S, Scorcioni F, Astancolle S, Davalli P, Scaltriti M, Corti A Clusterin (SGP-2) transient overexpression decreases proliferation rate of SV40-immortalized human prostate epithelial cells by slowing down cell cycle progression. Oncogene, 21: 4328-34, 2002.[CrossRef][Medline]
- DiGiovanni J Multistage carcinogenesis in mouse skin. Pharmacol Ther, 54: 63-128, 1992.[CrossRef][Medline]
- Redondo M, Villar E, Torres-Munoz J, Tellez T, Morell M, Petito CK Overexpression of clusterin in human breast carcinoma. Am J Pathol., 157: 393-9, 2000.[Abstract/Free Full Text]
- Parczyk K, Pilarsky C, Rachel U, Koch BC Gp80 (clusterin; TRPM-2) mRNA level is enhanced in human renal clear cell carcinomas. J Cancer Res Clin Oncol, 120: 186-8, 1994.[CrossRef][Medline]
- Steinberg J, Oyasu R, Lang S, et al Intracellular levels of SGP-2 (Clusterin) correlate with tumor grade in prostate cancer. Clin Cancer Res, 3: 1707-11, 1997.[Abstract]
- Dai CY, Furth EE, Mick R, et al p16(INK4a) expression begins early in human colon neoplasia and correlates inversely with markers of cell proliferation. Gastroenterology, 119: 929-42, 2000.[Medline]
- Miyake H, Gleave M, Arakawa S, Kamidono S, Hara I Introducing the clusterin gene into human renal cell carcinoma cells enhances their metastatic potential. J Urol, 167: 2203-8, 2002.[CrossRef][Medline]
- Cui W, Fowlis DJ, Bryson S, et al TGF-ß1 inhibits the formation of benign skin tumors, but enhances progression to invasive spindle carcinomas in transgenic mice. Cell, 86: 531-42, 1996.[CrossRef][Medline]
- Qian X, Tuszynski GP Expression of thrombospondin-1 in cancer: a role in tumor progression. Proc Soc Exp Biol Med, 212: 199-207, 1996.[CrossRef][Medline]
- Miyake H, Hara I, Kamidono S, Gleave ME Synergistic chemosensitization and inhibition of tumor growth and metastasis by the antisense oligodeoxynucleotide targeting clusterin gene in a human bladder cancer model. Clin Cancer Res, 7: 4245-52, 2001.[Abstract/Free Full Text]
- Gleave ME, Miyake H, Zellweger T, et al Use of antisense oligonucleotides targeting the antiapoptotic gene, clusterin/testosterone-repressed prostate message 2, to enhance androgen sensitivity and chemosensitivity in prostate cancer. Urology, 58: 39-49, 2001.[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
O. Chayka, D. Corvetta, M. Dews, A. E. Caccamo, I. Piotrowska, G. Santilli, S. Gibson, N. J. Sebire, N. Himoudi, M. D. Hogarty, et al.
Clusterin, a Haploinsufficient Tumor Suppressor Gene in Neuroblastomas
J Natl Cancer Inst,
May 6, 2009;
101(9):
663 - 677.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. P. Trougakos, J. Y. Djeu, E. S. Gonos, and D. A. Boothman
Advances and Challenges in Basic and Translational Research on Clusterin
Cancer Res.,
January 15, 2009;
69(2):
403 - 406.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. P. Trougakos, M. Lourda, M. H. Antonelou, D. Kletsas, V. G. Gorgoulis, I. S. Papassideri, Y. Zou, L. H. Margaritis, D. A. Boothman, and E. S. Gonos
Intracellular Clusterin Inhibits Mitochondrial Apoptosis by Suppressing p53-Activating Stress Signals and Stabilizing the Cytosolic Ku70-Bax Protein Complex
Clin. Cancer Res.,
January 1, 2009;
15(1):
48 - 59.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. R. Wise, R. J. DeBerardinis, A. Mancuso, N. Sayed, X.-Y. Zhang, H. K. Pfeiffer, I. Nissim, E. Daikhin, M. Yudkoff, S. B. McMahon, et al.
Myc regulates a transcriptional program that stimulates mitochondrial glutaminolysis and leads to glutamine addiction
PNAS,
December 2, 2008;
105(48):
18782 - 18787.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Jo, Y. Jia, K. K. Subramanian, H. Hattori, and H. R. Luo
Cancer Cell-Derived Clusterin Modulates the Phosphatidylinositol 3'-Kinase-Akt Pathway through Attenuation of Insulin-Like Growth Factor 1 during Serum Deprivation
Mol. Cell. Biol.,
July 1, 2008;
28(13):
4285 - 4299.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Jovanovic, A.-S. Dugast, J.-M. Heslan, J. Ashton-Chess, M. Giral, N. Degauque, A. Moreau, A. Pallier, E. Chiffoleau, D. Lair, et al.
Implication of Matrix Metalloproteinase 7 and the Noncanonical Wingless-Type Signaling Pathway in a Model of Kidney Allograft Tolerance Induced by the Administration of Anti-Donor Class II Antibodies
J. Immunol.,
February 1, 2008;
180(3):
1317 - 1325.
[Abstract]
[Full Text]
[PDF]
|
 |
|