| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell and Tumor Biology |
1 Molecular Therapy Research Center, Samsung Medical Center, School of Medicine, Sung Kyun Kwan University, Seoul, Korea and 2 Department of Molecular Biology, Pusan National University, Busan, Korea
Requests for reprints: Je-Ho Lee or Seung-Hoon Lee, Molecular Therapy Research Center, Samsung Medical Center, Annex 8F, 50 Ilwondong, Kangnamgu, Seoul, Korea. Phone: 82-2-3410-6833; Fax: 82-2-3410-6829; E-mail: jeholee{at}samsung.co.kr; hoon61{at}smc.samsung.co.kr.
| Abstract |
|---|
|
|
|---|
Key Words: thymosin ß10 angiogenesis Ras cancer therapy
| Introduction |
|---|
|
|
|---|
Previously, we reported that thymosin ß10 was down-regulated in human ovarian cancer tissues (7). When thymosin ß10 was overexpressed in ovarian cancer cells, it acted as a tumor suppressor by disrupting the actin structure. The ß-thymosins are a family of highly conserved small peptides that inhibit barbed end actin polymerization by sequestering actin monomers (8). Among them, thymosin ß4 and thymosin ß10 are the two most abundant ß-thymosins in the mammalian species and coexist in some tissue types at varying ratios (9). Although both peptides share a high degree of sequence homology, they show distinct patterns of expression in several tissues (10) and play different roles during rodent development (11). Recently, the angiogenic effects of several members of the thymosin family of peptides were studied in the chick chorioallantoic membrane model (12). Thymosin ß4, prothymosin, and thymosin
1 were associated with enhancement of angiogenesis, whereas parathymosin, thymosin ß9, and thymosin ß10 were associated with inhibition of angiogenesis. Thymosin ß4 also stimulated tumor metastasis by activating cell migration and angiogenesis (13, 14).
Here, we did cDNA chip analysis to identify genes regulated by thymosin ß10. The expression of genes related to angiogenesis,cell migration, and proliferation was dramatically inhibited by thymosin ß10 in ovarian cancer cells, including Rac1 (15), nitric-oxide synthase (16), focal adhesion kinase (17), Lim kinase (LIMK1; ref. 18), Wave (WASF1; ref. 19), hypoxia-inducible factor-1
(20), platelet-derived growth factor receptor (21), ELK1 (22), and ARHGEF (23). From this data, it seems that thymosin ß10 is involved in the inhibition of angiogenesis and tumor growth, although the underlying mechanisms are not fully understood. Using an adenovirus vector expressing thymosin ß10, we found that thymosin ß10 significantly inhibited VEGF-induced angiogenesis and tumor growth in vitro, ex vivo, and in vivo. These effects were mediated by thymosin ß10 directly binding to Ras and interfering with its downstream signaling pathways. Therefore, thymosin ß10 is a multifunctional protein that inhibits Ras and its signaling pathways. These interactions regulate potent antiangiogenic and antitumor effects.
| Materials and Methods |
|---|
|
|
|---|
Animals. Specific pathogen-free BALB/c and nu/nu mice were supplied by Biogenomics (Seoul, Korea) and Charles River Labs (Wilmington, MA), respectively. All animal studies were approved by the Animal Care and Use Committee of Samsung Medical Center.
Adenovirus and Vector Construction. The construction of an adenovirus vector for green fluorescence protein-thymosin ß10 (GFP-AdTß10) was done as described previously (7). For the adenovirus vector for thymosin ß10 (AdTß10) construct, PCR-amplified full-length human thymosin ß10 fragment was cloned into a HindIII/XhoI site of p
ACMVp(A) vector. The adenoviruses were used at 100 multiplicity of infection for infection experiments. To construct pcDNA3.1-thymosin ß4, pcDNA3.1-thymosin ß10, and pcDNA4HisMax-thymosin ß4, PCR-amplified full-length human thymosin ß4 and thymosin ß10 fragments were cloned into the EcoRI/XhoI site of the pcDNA3.1 vector (Invitrogen) and of the pcDNA4HisMax vector (Invitrogen), respectively.
Small Interfering RNA Construction and Transfection. The siRNA oligonucleotide sequence targeting thymosin ß10 (AAGCGGAGUGAAAUUUCCUAA) corresponded to nucleotides 199 to 217 in the human sequence. Small interfering RNA (siRNA) was synthesized by using asiRNA construction kit (Ambion, Austin, TX) and transfected by using the RNAi shuttle (Orbigen, San Diego, CA) according to the manufacturer's protocols. HUVECs were then infected with either GFP-AdTß10 alone or GFP-AdTß10 with siRNA transfection. GFP images were captured using a fluorescence microscope (Zeiss, Oberoken, Germany). Total RNA was isolated with TRIZOL Reagent (Life Technologies) and reverse transcription-PCR was done.
[3H]Methylthymidine Incorporation Assay. To measure cell proliferation, HUVECs were infected with either empty adenovirus, AdTß10, or AdTß10 + siRNA. To determine the effect of thymosin ß4, HUVECs were transfected with either pcDNA3.1 or pcDNA3.1-thymosin ß4 using the FuGENE 6 reagent (Roche, Mannheim, Germany). After 18 hours, cells were incubated for 6 hours in M199 containing 1% FBS and then stimulated with VEGF (10 ng/mL, R&D Systems, Minneapolis, MN) for 24hours in M199 containing 1% FBS. [3H]methylthymidine (0.5 µCi/mL, Amersham, Arlington Heights, IL) was added 4 hours prior to the assay. The cpm values from cultures were counted with a liquid scintillation counter (Beckman, Fullerton, CA). Independent experiments were repeated thrice and each value represents the mean ± SD of triplicate samples.
Migration and Invasion Assay. Migration and invasion were assayed using Transwells (8-µm pore size, Costar, Cambridge, MA) as described previously (24). For the migration assay, the lower surface of filter was coated with 10-µm of gelatin. M199 containing 1% FBS with VEGF (25ng/mL) was placed in the lower wells. Uninfected, Ad-, AdTß10-, or AdTß10 + siRNAinfected HUVECs at a final concentration of 1 x 104cells/100 µL were seeded into each of the upper wells and incubated for 24 hours. Cells were fixed and stained with H&E. Nonmigrating cells on the upper surface of the filter were removed by wiping with a cotton swab. The number of cells that migrated to the lower side of the filter was counted under a light microscope and mean values of eight fields were determined. For the invasion assay, the lower surface and upper surface of filter was coated with 10 µg of gelatin and 10 µg of Matrigel (BD Biosciences, Bedford, MA), respectively. Uninfected, Ad-, AdTß10-, or AdTß10 + siRNAinfected HUVECs at a final concentration of 1 x 104cells/100 µL in M199 containing 1% FBS with VEGF (25 ng/mL) were seeded into each of the upper wells and incubated for 30 hours. The fixation and quantification methods are the same as that of the migration assay. To determine the effect of thymosin ß4, HUVECs were transfected with either pcDNA3.1 or pcDNA3.1-thymosin ß4 using the FuGENE 6 reagent. Independent experiments were repeated thrice and each value represents the mean ± SD of triplicate samples.
Tube Formation Assay. Growth factorreduced Matrigel (200 µL of 10mg/mL) was added into a 24-well plate and polymerized for 30minutes at37°C. Uninfected, Ad-, GFP-AdTß10, or GFP-AdTß10 + siRNAinfected HUVECs (1 x 105 cells) were seeded on the surface of the Matrigel. Cells were then incubated for 48 hours with or without 10ng/mL of VEGF in M199 containing 1% FBS. Morphologic changes of the cells were photographed at x40 magnification. HUVEC tube length was determined using an inverted microscope with a digital CCD camera (Zeiss) and quantified using ImageLab imaging software (MCM Design). To determine the combined effect of thymosin ß4 and thymosin ß10, HUVECs were transfected with either pcDNA3.1, pcDNA3.1-thymosin ß4, or pcDNA3.1-thymosin ß10 using the FuGENE 6 reagent. Independent experiments were repeated thrice and each value represents the mean ±SD of triplicate samples.
Ex vivo Angiogenesis Assay. A novel ex vivo angiogenesis assay using explant culture of mouse skeletal muscle on Matrigel was done with some modifications, according to Jang et al. (25). Six-week-old BALB/c mice were anesthetized and the legs were shaved. The tibialis anterior muscle was extracted and then cross-sections of muscle were washed thrice with PBS. The washed muscle was placed in a 24-well plate containing 200 µL of growth factor-reduced Matrigel and polymerized for 30 minutes at 37°C. M199 containing 1% FBS with or without 10 ng/mL of VEGF was added. After 6 days, outgrowth of capillary-like structures was observed and then fresh medium containing either 2 x 108 plaque-forming unit (pfu) of adenovirus or 10 nmol/L of paclitaxel was added. Media were changed every other day. After an additional 5 days, the mean area of microvessels was measured by an optical imaging technique and quantified using ImageLab imaging software. Independent experiments were repeated thrice and each value represents the mean ±SD of triplicate samples.
Yeast Two Hybrid Analysis. LexA-human thymosin ß10 or thymosin ß4 fusion protein was constructed and used to screen binding proteins from a human ovary cDNA library (Clontech, Palo Alto, CA). The binding proteins were expressed as B42 fusion proteins. cDNA encoding full length human K-Ras or H-Ras were PCR amplified and ligated separately into the EcoRI/XhoI sites of the B42. Positive interactions were confirmed by cell growth on leucine-depleted yeast synthetic medium and blue colony formation on 5-bromo-4-chloro-3-indolyl-ß-D-galactoside (X-gal, 5mmol/L)-containing medium. The activity of the interaction between thymosin ß10 or thymosin ß4 and Ras was determined by measuring the relative expression level of ß-galactosidase. The ß-galactosidase activity was calculated using the formula units = [1,000 x (A420 1.75 x A550)]/(time x volume x A600).
Glutathione S-transferase Pull-Down Assay and Coimmunoprecipitation. Glutathione S-transferasefused thymosin ß10 and His-fused K-Ras were purified on a glutathione Sepharose 4B (Amersham Pharmacia Biotech, Piscataway, NJ) and on a Ni-NTA Agarose (Qiagen, Chatsworth, CA) according to the manufacturers' instructions, respectively. Equal amounts of glutathione S-transferase or glutathione S-transferase-thymosin ß10 immobilized on glutathione Sepharose beads were incubated with His-K-Ras. Coimmunoprecipitated K-Ras was detected by Western blot with anti-His antibody. For coimmunoprecipitation invivo, HUVECs were transiently transfected with GFP or GFP-Tß10 using the FuGENE 6 reagent. The endogenous Ras was immunoprecipitated with anti-Ras antibody (Oncogene, Uniondale, NY) and coimmunoprecipitated thymosin ß10 was detected by Western blot with an anti-GFP antibody. For coimmunoprecipitation with Ras and thymosin ß4, 2774 cells were transiently transfected with GFP-thymosin ß10 or His-thymosin ß4 using the FuGENE 6 reagent. The thymosin ß10 or thymosin ß4 was immunoprecipitated with anti-GFP antibody or anti-His antibody, respectively. The coimmunoprecipitated Ras was detected by Western blot with an anti-Ras antibody.
Labeling of the Actin Cytoskeleton. HUVECs were transfected with either pcDNA3.1, pcDNA3.1-thymosin ß4, pcDNA3.1-thymosin ß10, or pcDNA3.1-thymosin ß4 with pcDNA3.1-thymosin ß10 (1:1) using the FuGENE 6 reagent. After 72 hours, the cells were incubated for 2 hours in M199 containing 1% FBS and then stimulated with or without 50 ng/mL of VEGF for 15 minutes. Cells were fixed and stained with Alexa fluor 488 phalloidin (Molecular Probes, Eugene, OR). Images were analyzed using a fluorescence microscope with a digital CCD camera (Olympus, Lake Success, NY).
Ras activation Assay. Uninfected, Ad-, or AdTß10-infected HUVECs were serum-deprived overnight and stimulated with or without VEGF (50ng/mL) for 5 minutes in M199 containing 1% FBS (6). The cell lysate was incubated with glutathione S-transferase-Raf1-Ras-binding domain (RBD) in the presence of an immobilized Glutathione Disc (Pierce). The assay was done according to the manufacturers' instructions. The pull-down active Ras was detected by Western blot analysis using anti-Ras antibody.
Ras Guanidine Nucleotide Binding Assay. The assay was done as described (26) with minor modifications. Uninfected, Ad-, or AdTß10 infected HUVECs were serum-deprived overnight, labeled with 0.2 mCi/mL of [32P] orthophosphate (Amersham) for 3 hours in a phosphate-free medium (Life Technologies), and stimulated with or without VEGF (50ng/mL) for 5 minutes. Cell lysates were harvested and Ras proteins were immunoprecipitated with anti-Ras antibody. Bound guanine nucleotides were eluted from precipitated protein complexes and analyzed by TLC using polyethyleneimine-cellulose plates (Sigma). The presence of Ras GDP and GTP was assessed by autoradiography and the ratio of GTP to GTP + GDP was determined by densitometry. Similar results were obtained in three independent experiments.
Subcellular Fractionation of Cell Lysates, Western Blot, and Immunoprecipitation. Uninfected, Ad-, or GFP-AdTß10infected HUVECs were stimulated with or without VEGF (50 ng/mL) for 5minutes and separated into cytosol, membrane, and nuclear fractions according to the manufacturer's protocols (Calbiochem, La Jolla, CA). Fractionated or total proteins were immunoblotted with specific antibodies to GFP, pMEK, pERK, extracellular signal-regulated kinase (ERK), and VEGF (all obtained from Santa Cruz Biotechnology, Santa Cruz, CA), as well as tubulin antibody (Innogenex, San Ramon, CA). For VEGF immunoprecipitation, concentrated 2774 cell conditioned medium (27) was incubated with VEGF antibody as previously described (28).
S.C. and Orthotopic Tumor Models and Immunohistochemistry. To establish tumors in mice, 1 x 106 of 2774 tumor cells were injected s.c. in the mid-dorsal region. Tumors were allowed to grow for 14 days. Then, an intratumor al injection of 1 x 109 pfu/40 µL of AdTß10 was done thrice, once every 3 days. Tumor size was evaluated by caliper measurements every 3 days. Mice were sacrificed on day 27 after final virus injection. Tumors were then excised and prepared for immunohistochemistry. For the orthotopic model of 2774 tumor growth, 1 x 106 of GFP-2774 cells were injected into the right ovary through the fat pad. GFP-2774 cells were prepared by stable transfection of pEGFP-C1 (Clontech). GFP-expressing tumors were examined using the Illumatool tunable lighting system (Lightools Research, Encinitas, CA). An intratumoral injection of 1x 109 pfu/20 µL of AdTß10 was done on day 7 after tumor injection. Mice were sacrificed on day 10 after virus injection. Tumors were then excised and prepared for immunohistochemistry. Frozen sections were stained with rat monoclonal anti-mouse CD31 (PECAM-1) antibody (PharMingen, San Diego, CA). Vascular density in the tumors was calculated by counting the number of blood vessels in three separate tumor cross-sections per group. The specificity of the staining was confirmed with isotype-matched antibodies (normal rat IgG1
).
Data Analysis and Statistics. Values are presented as the mean ± SD or ± SE. Statistical comparisons between groups were done using the Student's t test. P < 0.05 was considered statistically significant.
| Results |
|---|
|
|
|---|
|
Thymosin ß10 Inhibits Tube Formation In vitro and Vessel Sprouting Ex vivo. To confirm that thymosin ß10 has direct antiangiogenic effects, we investigated whether overexpression of thymosin ß10 could alter endothelial tube formation. Uninfected or empty virus-infected cells incubated with VEGF formed an organized network of endothelial cells on Matrigel (Fig. 2A). In contrast, overexpression of thymosin ß10 markedly inhibited VEGF-induced tube formation. The inhibitory effect of thymosin ß10 on VEGF-induced tube formation was completely restored by siRNA transfection.
|
Thymosin ß10 Interacts With Ras. We next tried to determine the mechanism involved in the inhibition of angiogenesis by identifying proteins which bind to thymosin ß10. Thus, we screened for thymosin ß10 binding proteins using the yeast two-hybrid system. One prominent gene identified was Ras. Positive interaction was verified by both cell growth and the ß-galactosidase assay (Fig. 3A). Direct interaction of Ras with thymosin ß10 in vitro wasconfirmed using a glutathione S-transferase pull-down assay (Fig. 3B). The interaction of the two proteins was also shown by co-immunoprecipitation between the endogenous Ras and the exogenously introduced GFP-tagged thymosin ß10 (GFP-Tß10; Fig. 3C). These results indicate that thymosin ß10 directly interacts with Ras.
|
|
|
Thymosin ß10 Inhibits ERK Signaling in Endothelial Cells and Reduces VEGF Expression in Both Endothelial and Tumor Cells. Based on the above findings, we investigated whether thymosin ß10 inhibits Ras downstream mitogen-activated protein kinase kinase (MEK) and ERK activation (Fig. 5D). Ras-ERK mediated transcriptional up-regulation of angiogenic factors, such as VEGF, is a well-known mechanism that promotes angiogenesis (29). VEGF-stimulated MEK and ERK phosphorylation were markedly reduced by overexpressed thymosin ß10. However, the total ERK level was unaffected by thymosin ß10. Therefore, it seems that thymosin ß10 inhibits the Ras-ERK signaling pathway in HUVECs. Consistent with these findings, overexpressed thymosin ß10 completely inhibited VEGF expression in HUVECs (Fig. 5E). This suggests that thymosin ß10 inhibits the autocrine effect of VEGF in endothelial cells and thus, has a direct antiangiogenic effect.
Next, we investigated the effect of thymosin ß10 on VEGF production in tumor cells. VEGF is mainly secreted by tumor cells to recruit VEGF receptorexpressing endothelial cells to the tumor (29). Overexpression of thymosin ß10 in 2774 ovarian cancer cells resulted in a marked reduction of VEGF expression and secretion into the medium (Fig. 5F). Thus, thymosin ß10 decreases VEGF production in tumor cells leading to a suppressed paracrine effect of VEGF on angiogenesis.
Thymosinß10 Inhibits Tumor Growth and Associated Angiogenesis. To explore whether thymosin ß10 has direct antitumor activity, we tested the effects of overexpressed thymosin ß10 on tumor cell growth in vitro. We found that thymosin ß10 markedly decreased 2774 ovarian cancer cell growth when compared with controls (Fig. 6A).
|
These antitumor and antiangiogenic effects of thymosin ß10 were confirmed in orthotopically injected tumor cells (Fig. 6D). We injected GFP-2774 tumor cells into the right ovary and did intratumoral injections of thymosin ß10 on day 7 after tumor injection. GFP-expressing tumors were significantly decreased in thymosin ß10treated mice. The volume of excised tumors on day 10 after virus injection was 54% smaller than those from control mice. Also, the erythema of the tumor due to induction of angiogenesis was dramatically reduced in thymosin ß10treated mice when compared with control mice. Immunohistologic staining of endothelial cells in thymosin ß10treated tumors showed a 77%decrease in the number of blood vessels. Together these resultsshow that overexpressed thymosin ß10 potently suppresses angiogenesis and tumor growth in vivo.
| Discussion |
|---|
|
|
|---|
In this study, overexpressed thymosin ß10 potently inhibited multiple angiogenic processes, including endothelial cell proliferation, migration, invasion, tube formation, and vessel sprouting Figs. 1 and 2. Cell viability was not affected by empty adenoviruses or by thymosin ß10expressing adeonovirus in the angiogenesis assays (data not shown). The combined inhibitory effects of thymosin ß10 on critical endothelial functions in angiogenesis may result in a synergistic effect greater than that of blocking any one cellular response alone. This could be explained by the fact that Ras proteins operate as molecular switches in signaling pathways that regulate diverse cell growth and differentiation processes (34, 36). Ras proteins are involved in intracellular signaling from receptor tyrosine kinases which results in the activation of a phosphorylation cascade (37). Growth factors, such as VEGF, fibroblast growth factor, platelet-derived growth factor, nerve growth factor, epidermal growth factor, and insulin activate Ras proteins, but in some cases other factors, such as transforming growth factor-ß (38) and angiotensin-2 (39) activate Ras as well. Multiple downstream effectors have also been identified which may lead to alternate pathways. Indeed, we found that thymosin ß10 also inhibited Rac activation by suppressing the mRNA expression of the guanosine nucleotide exchange factor, vav (40).3 Therefore, when the function of the key regulator, Ras was blocked by thymosin ß10 overexpression, upstream signals from receptors for various factors and downstream pathways were inhibited. These functions eventually lead to the suppression of angiogenesis.
We had expected another possible mechanism by which thymosin ß10 inhibits angiogenesis via disruption of the actin cytoskeleton of HUVECs, because depolymerization of actin stress fiber is well known function of ß-thymosins (8, 9). However, thymosin ß4 and thymosin ß10 showed the same inhibitory effect on actin polymerization, although they had opposite effects on angiogenesis (Fig. 4). In addition, within the ß-thymosin family, the actin binding motif (LKKTETQ) is highly conserved (41), and the seven amino acids motif is essential for their angiogenic activity (42). Thus, angiogenesis inhibition by thymosin ß10 is distinct from the common actin binding property of ß-thymosins. One possible explanation is that thymosin ß4 and thymosin ß10 bind to G-actin ina 1:1 complex forming a large pool of unpolymerized actin that can be easily released when needed for polymerization of actin filaments. However, thymosin ß10 inhibits multiple signaling molecules needed for polymerization of actin filaments, such as Rac and Wave4 by interfering with Ras or directly, which results in disrupting actin dynamics. This may explain why the two homologous proteins have very different effects on angiogenesis.
On the other hand, thymosin ß4 and thymosin ß10 showed distinct patterns of expression in several tissues (10) and played different roles during rodent development (11). Thymosin ß10 mRNA levels were very low in the cardiovascular system of early mouse embryo, in contrast to thymosin ß4 mRNA levels (43). Angiogenesis actively occurs in early development and is commonly controlled by the balance between angiogenic and antiangiogenic factors depending on the demand of the physiologic environment in a development-dependent manner. These literature findings further support the assumption that thymosin ß4 and thymosin ß10 act on vessel development in a complementary way in vivo, and this may also be extended to the angiogenesis process. This hypothesis is also supported by the fact that overexpression ofthymosin â4 and thymosin ß10 induces an increased (14) and decreased (Fig. 5E and F) expression of VEGF, respectively.
Thymosin ß10 has direct effects on tumor cells. It inhibits 2774 ovarian cancer cell growth. In addition, we found that thymosin ß10 inhibited Ras-ERK signaling (data not shown) as well as VEGF secretion (Fig. 5) in these cells. Together, these observations suggest that overexpression of thymosin ß10 in whole tumors could disrupt tumor growth and associated angiogenesis through both tumor cell-mediated effects and effects on endothelial cells. This would be expected to be more potent than targeting either cell type alone. It was also observed that thymosin ß10 increased phospho-p53 in ovarian cancer cells (data not shown) suggesting the possibility thatthymosin ß10 may be related to multiple effector pathways.
Targeting the Ras proteins and their signaling pathways could be very valuable in developing cancer therapies (35). Over 20 cancer therapeutic agents have been developed thus far, but specific inhibitors of upstream activators or downstream mediators showed limited effect on Ras activity. Prenylation, the post-translational modification step, is required for the localization and function of Ras. However, attempting to inhibit prenylation by using farnesyltransferase inhibitors has not been successful in human trials. Although H-Ras is exclusively modified by farnesyltransferase, K-Ras and, to a lesser extent, N-Ras can also be modified by geranylgeranyltransferase. The combined use of farnesyltransferase inhibitors and geranylgeranyltransferase inhibitors (44) has failed because they act on other proteins which are necessary for normal cell growth and show cellular toxicity. We now propose that thymosin ß10 may overcome the deficiencies of these existing therapies that target Ras or its signaling pathways. Because thymosin ß10 directly binds to Ras and interferes with Ras itself, it acts selectively in its specific inhibition of Ras. Therefore, thymosin ß10 could have a greater inhibitory effect on tumor cells and/or tumor vessels containing highly activated Ras compared with normal cells.
In conclusion, thymosin ß10 is not only an actin-sequestering protein. It has also been found to block the cellular signaling cascades involved in angiogenesis and in tumor growth. This newly discovered mechanism may lead to the future development of effective cancer therapies using thymosin ß10.
| Acknowledgments |
|---|
The cost of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Drs. Hyun Seok Song and Seung Hee Hong for critically reviewing the manuscript.
| Footnotes |
|---|
Received 5/ 6/04. Revised 8/24/04. Accepted 10/22/04.
| References |
|---|
|
|
|---|
is required for solid tumor formation and embryonic vascularization. EMBO J 1998;17:300515.[CrossRef][Medline]
and PKC-
contributes to sustained Raf/ERK1/2 activation in endothelial cells under mechanical strain. J Biol Chem 2001;276:3136875.
vß3 requirement for sustained mitogen-activated protein kinase activity during angiogenesis. J Cell Biol 1998;140:125563.
subunits and the Raf-1 protein kinase. J Biol Chem 1995;270:142514.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |