Cancer Research Cell Death Mechanisms and Cancer Therapy  Sign up for Cancer Research eTOC's
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, S.-H.
Right arrow Articles by Lee, J.-H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, S.-H.
Right arrow Articles by Lee, J.-H.
[Cancer Research 65, 137-148, January 1, 2005]
© 2005 American Association for Cancer Research


Cell and Tumor Biology

Thymosin ß10 Inhibits Angiogenesis and Tumor Growth by Interfering with Ras Function

Seung-Hoon Lee1, Myung Jin Son1,2, Sun-Hee Oh1, Seung-Bae Rho1, Kyungsook Park1, Yung-Jin Kim2, Mi-Sun Park1 and Je-Ho Lee1

1 Molecular Therapy Research Center, Samsung Medical Center, School of Medicine, Sung Kyun Kwan University, Seoul, Korea and 2 Department of Molecular Biology, Pusan National University, Busan, Korea

Requests for reprints: Je-Ho Lee or Seung-Hoon Lee, Molecular Therapy Research Center, Samsung Medical Center, Annex 8F, 50 Ilwondong, Kangnamgu, Seoul, Korea. Phone: 82-2-3410-6833; Fax: 82-2-3410-6829; E-mail: jeholee{at}samsung.co.kr; hoon61{at}smc.samsung.co.kr.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Thymosin ß10 is a monomeric actin sequestering protein that regulates actin dynamics. Previously, we and others have shown that thymosin ß10 acts as an actin-mediated tumor suppressor. In this study, we show that thymosin ß10 is not only a cytoskeletal regulator, but that it also acts as a potent inhibitor of angiogenesis and tumor growth by its interaction with Ras. We found that overexpressed thymosin ß10 significantly inhibited vascular endothelial growth factor–induced endothelial cell proliferation, migration, invasion, and tube formation in vitro. Vessel sprouting was also inhibited ex vivo. We further show that thymosin ß10 directly interacted with Ras. This interaction resulted in inhibition of the Ras downstream mitogen-activated protein kinase/extracellular signal-regulated kinase kinase signaling pathway, leading to decreased vascular endothelial growth factor production. Thymosin ß10 injected into a xenograft model of human ovarian cancer in nude mice markedly inhibited tumor growth and reduced tumor vascularity. In contrast, a related thymosin family member, thymosin ß4, did not bind to Ras and showed positive effects on angiogenesis. These findings show that the inhibition of Ras signal transduction by thymosin ß10 results in antiangiogenic and antitumor effects, suggesting that thymosin ß10 may be valuable in anticancer therapy.

Key Words: thymosin ß10 • angiogenesis • Ras • cancer therapy


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Angiogenesis, the sprouting of new capillaries from preexisting vasculature, is an essential process in tumor growth (1, 2). Thus, angiogenesis-based therapies have become a very promising modality in the treatment of cancer (3). One of the key mediators of angiogenesis is the vascular endothelial growth factor (VEGF), which can promote the survival, proliferation, and migration of endothelial cells (4). VEGF expression and secretion are stimulated in tumor cells by activation of oncogenes such as Ras (5). VEGF-mediated Ras signaling in endothelial cells is also essential in angiogenic responses (6).

Previously, we reported that thymosin ß10 was down-regulated in human ovarian cancer tissues (7). When thymosin ß10 was overexpressed in ovarian cancer cells, it acted as a tumor suppressor by disrupting the actin structure. The ß-thymosins are a family of highly conserved small peptides that inhibit barbed end actin polymerization by sequestering actin monomers (8). Among them, thymosin ß4 and thymosin ß10 are the two most abundant ß-thymosins in the mammalian species and coexist in some tissue types at varying ratios (9). Although both peptides share a high degree of sequence homology, they show distinct patterns of expression in several tissues (10) and play different roles during rodent development (11). Recently, the angiogenic effects of several members of the thymosin family of peptides were studied in the chick chorioallantoic membrane model (12). Thymosin ß4, prothymosin, and thymosin {alpha}1 were associated with enhancement of angiogenesis, whereas parathymosin, thymosin ß9, and thymosin ß10 were associated with inhibition of angiogenesis. Thymosin ß4 also stimulated tumor metastasis by activating cell migration and angiogenesis (13, 14).

Here, we did cDNA chip analysis to identify genes regulated by thymosin ß10. The expression of genes related to angiogenesis,cell migration, and proliferation was dramatically inhibited by thymosin ß10 in ovarian cancer cells, including Rac1 (15), nitric-oxide synthase (16), focal adhesion kinase (17), Lim kinase (LIMK1; ref. 18), Wave (WASF1; ref. 19), hypoxia-inducible factor-1{alpha} (20), platelet-derived growth factor receptor (21), ELK1 (22), and ARHGEF (23). From this data, it seems that thymosin ß10 is involved in the inhibition of angiogenesis and tumor growth, although the underlying mechanisms are not fully understood. Using an adenovirus vector expressing thymosin ß10, we found that thymosin ß10 significantly inhibited VEGF-induced angiogenesis and tumor growth in vitro, ex vivo, and in vivo. These effects were mediated by thymosin ß10 directly binding to Ras and interfering with its downstream signaling pathways. Therefore, thymosin ß10 is a multifunctional protein that inhibits Ras and its signaling pathways. These interactions regulate potent antiangiogenic and antitumor effects.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell Culture. Human umbilical vein endothelial cell (HUVEC; Clonetics, San Diego, CA) was grown on 0.3% gelatin (Sigma, St. Louis, MO) coated dishes using the EGM-2 Kit (Clonetics). Human ovarian cancer cells (2774) and 293 cells were cultured in DMEM and EMEM, respectively, and were supplemented with 10% fetal bovine serum (FBS) and antibiotics (Life Technologies, Gaithersburg, MD).

Animals. Specific pathogen-free BALB/c and nu/nu mice were supplied by Biogenomics (Seoul, Korea) and Charles River Labs (Wilmington, MA), respectively. All animal studies were approved by the Animal Care and Use Committee of Samsung Medical Center.

Adenovirus and Vector Construction. The construction of an adenovirus vector for green fluorescence protein-thymosin ß10 (GFP-AdTß10) was done as described previously (7). For the adenovirus vector for thymosin ß10 (AdTß10) construct, PCR-amplified full-length human thymosin ß10 fragment was cloned into a HindIII/XhoI site of p{Delta}ACMVp(A) vector. The adenoviruses were used at 100 multiplicity of infection for infection experiments. To construct pcDNA3.1-thymosin ß4, pcDNA3.1-thymosin ß10, and pcDNA4HisMax-thymosin ß4, PCR-amplified full-length human thymosin ß4 and thymosin ß10 fragments were cloned into the EcoRI/XhoI site of the pcDNA3.1 vector (Invitrogen) and of the pcDNA4HisMax vector (Invitrogen), respectively.

Small Interfering RNA Construction and Transfection. The siRNA oligonucleotide sequence targeting thymosin ß10 (AAGCGGAGUGAAAUUUCCUAA) corresponded to nucleotides 199 to 217 in the human sequence. Small interfering RNA (siRNA) was synthesized by using asiRNA construction kit (Ambion, Austin, TX) and transfected by using the RNAi shuttle (Orbigen, San Diego, CA) according to the manufacturer's protocols. HUVECs were then infected with either GFP-AdTß10 alone or GFP-AdTß10 with siRNA transfection. GFP images were captured using a fluorescence microscope (Zeiss, Oberoken, Germany). Total RNA was isolated with TRIZOL Reagent (Life Technologies) and reverse transcription-PCR was done.

[3H]Methylthymidine Incorporation Assay. To measure cell proliferation, HUVECs were infected with either empty adenovirus, AdTß10, or AdTß10 + siRNA. To determine the effect of thymosin ß4, HUVECs were transfected with either pcDNA3.1 or pcDNA3.1-thymosin ß4 using the FuGENE 6 reagent (Roche, Mannheim, Germany). After 18 hours, cells were incubated for 6 hours in M199 containing 1% FBS and then stimulated with VEGF (10 ng/mL, R&D Systems, Minneapolis, MN) for 24hours in M199 containing 1% FBS. [3H]methylthymidine (0.5 µCi/mL, Amersham, Arlington Heights, IL) was added 4 hours prior to the assay. The cpm values from cultures were counted with a liquid scintillation counter (Beckman, Fullerton, CA). Independent experiments were repeated thrice and each value represents the mean ± SD of triplicate samples.

Migration and Invasion Assay. Migration and invasion were assayed using Transwells (8-µm pore size, Costar, Cambridge, MA) as described previously (24). For the migration assay, the lower surface of filter was coated with 10-µm of gelatin. M199 containing 1% FBS with VEGF (25ng/mL) was placed in the lower wells. Uninfected, Ad-, AdTß10-, or AdTß10 + siRNA–infected HUVECs at a final concentration of 1 x 104cells/100 µL were seeded into each of the upper wells and incubated for 24 hours. Cells were fixed and stained with H&E. Nonmigrating cells on the upper surface of the filter were removed by wiping with a cotton swab. The number of cells that migrated to the lower side of the filter was counted under a light microscope and mean values of eight fields were determined. For the invasion assay, the lower surface and upper surface of filter was coated with 10 µg of gelatin and 10 µg of Matrigel (BD Biosciences, Bedford, MA), respectively. Uninfected, Ad-, AdTß10-, or AdTß10 + siRNA–infected HUVECs at a final concentration of 1 x 104cells/100 µL in M199 containing 1% FBS with VEGF (25 ng/mL) were seeded into each of the upper wells and incubated for 30 hours. The fixation and quantification methods are the same as that of the migration assay. To determine the effect of thymosin ß4, HUVECs were transfected with either pcDNA3.1 or pcDNA3.1-thymosin ß4 using the FuGENE 6 reagent. Independent experiments were repeated thrice and each value represents the mean ± SD of triplicate samples.

Tube Formation Assay. Growth factor–reduced Matrigel (200 µL of 10mg/mL) was added into a 24-well plate and polymerized for 30minutes at37°C. Uninfected, Ad-, GFP-AdTß10–, or GFP-AdTß10 + siRNA–infected HUVECs (1 x 105 cells) were seeded on the surface of the Matrigel. Cells were then incubated for 48 hours with or without 10ng/mL of VEGF in M199 containing 1% FBS. Morphologic changes of the cells were photographed at x40 magnification. HUVEC tube length was determined using an inverted microscope with a digital CCD camera (Zeiss) and quantified using ImageLab imaging software (MCM Design). To determine the combined effect of thymosin ß4 and thymosin ß10, HUVECs were transfected with either pcDNA3.1, pcDNA3.1-thymosin ß4, or pcDNA3.1-thymosin ß10 using the FuGENE 6 reagent. Independent experiments were repeated thrice and each value represents the mean ±SD of triplicate samples.

Ex vivo Angiogenesis Assay. A novel ex vivo angiogenesis assay using explant culture of mouse skeletal muscle on Matrigel was done with some modifications, according to Jang et al. (25). Six-week-old BALB/c mice were anesthetized and the legs were shaved. The tibialis anterior muscle was extracted and then cross-sections of muscle were washed thrice with PBS. The washed muscle was placed in a 24-well plate containing 200 µL of growth factor-reduced Matrigel and polymerized for 30 minutes at 37°C. M199 containing 1% FBS with or without 10 ng/mL of VEGF was added. After 6 days, outgrowth of capillary-like structures was observed and then fresh medium containing either 2 x 108 plaque-forming unit (pfu) of adenovirus or 10 nmol/L of paclitaxel was added. Media were changed every other day. After an additional 5 days, the mean area of microvessels was measured by an optical imaging technique and quantified using ImageLab imaging software. Independent experiments were repeated thrice and each value represents the mean ±SD of triplicate samples.

Yeast Two Hybrid Analysis. LexA-human thymosin ß10 or thymosin ß4 fusion protein was constructed and used to screen binding proteins from a human ovary cDNA library (Clontech, Palo Alto, CA). The binding proteins were expressed as B42 fusion proteins. cDNA encoding full length human K-Ras or H-Ras were PCR amplified and ligated separately into the EcoRI/XhoI sites of the B42. Positive interactions were confirmed by cell growth on leucine-depleted yeast synthetic medium and blue colony formation on 5-bromo-4-chloro-3-indolyl-ß-D-galactoside (X-gal, 5mmol/L)-containing medium. The activity of the interaction between thymosin ß10 or thymosin ß4 and Ras was determined by measuring the relative expression level of ß-galactosidase. The ß-galactosidase activity was calculated using the formula units = [1,000 x (A420 – 1.75 x A550)]/(time x volume x A600).

Glutathione S-transferase Pull-Down Assay and Coimmunoprecipitation. Glutathione S-transferase–fused thymosin ß10 and His-fused K-Ras were purified on a glutathione Sepharose 4B (Amersham Pharmacia Biotech, Piscataway, NJ) and on a Ni-NTA Agarose (Qiagen, Chatsworth, CA) according to the manufacturers' instructions, respectively. Equal amounts of glutathione S-transferase or glutathione S-transferase-thymosin ß10 immobilized on glutathione Sepharose beads were incubated with His-K-Ras. Coimmunoprecipitated K-Ras was detected by Western blot with anti-His antibody. For coimmunoprecipitation invivo, HUVECs were transiently transfected with GFP or GFP-Tß10 using the FuGENE 6 reagent. The endogenous Ras was immunoprecipitated with anti-Ras antibody (Oncogene, Uniondale, NY) and coimmunoprecipitated thymosin ß10 was detected by Western blot with an anti-GFP antibody. For coimmunoprecipitation with Ras and thymosin ß4, 2774 cells were transiently transfected with GFP-thymosin ß10 or His-thymosin ß4 using the FuGENE 6 reagent. The thymosin ß10 or thymosin ß4 was immunoprecipitated with anti-GFP antibody or anti-His antibody, respectively. The coimmunoprecipitated Ras was detected by Western blot with an anti-Ras antibody.

Labeling of the Actin Cytoskeleton. HUVECs were transfected with either pcDNA3.1, pcDNA3.1-thymosin ß4, pcDNA3.1-thymosin ß10, or pcDNA3.1-thymosin ß4 with pcDNA3.1-thymosin ß10 (1:1) using the FuGENE 6 reagent. After 72 hours, the cells were incubated for 2 hours in M199 containing 1% FBS and then stimulated with or without 50 ng/mL of VEGF for 15 minutes. Cells were fixed and stained with Alexa fluor 488 phalloidin (Molecular Probes, Eugene, OR). Images were analyzed using a fluorescence microscope with a digital CCD camera (Olympus, Lake Success, NY).

Ras activation Assay. Uninfected, Ad-, or AdTß10-infected HUVECs were serum-deprived overnight and stimulated with or without VEGF (50ng/mL) for 5 minutes in M199 containing 1% FBS (6). The cell lysate was incubated with glutathione S-transferase-Raf1-Ras-binding domain (RBD) in the presence of an immobilized Glutathione Disc (Pierce). The assay was done according to the manufacturers' instructions. The pull-down active Ras was detected by Western blot analysis using anti-Ras antibody.

Ras Guanidine Nucleotide Binding Assay. The assay was done as described (26) with minor modifications. Uninfected, Ad-, or AdTß10 infected HUVECs were serum-deprived overnight, labeled with 0.2 mCi/mL of [32P] orthophosphate (Amersham) for 3 hours in a phosphate-free medium (Life Technologies), and stimulated with or without VEGF (50ng/mL) for 5 minutes. Cell lysates were harvested and Ras proteins were immunoprecipitated with anti-Ras antibody. Bound guanine nucleotides were eluted from precipitated protein complexes and analyzed by TLC using polyethyleneimine-cellulose plates (Sigma). The presence of Ras GDP and GTP was assessed by autoradiography and the ratio of GTP to GTP + GDP was determined by densitometry. Similar results were obtained in three independent experiments.

Subcellular Fractionation of Cell Lysates, Western Blot, and Immunoprecipitation. Uninfected, Ad-, or GFP-AdTß10–infected HUVECs were stimulated with or without VEGF (50 ng/mL) for 5minutes and separated into cytosol, membrane, and nuclear fractions according to the manufacturer's protocols (Calbiochem, La Jolla, CA). Fractionated or total proteins were immunoblotted with specific antibodies to GFP, pMEK, pERK, extracellular signal-regulated kinase (ERK), and VEGF (all obtained from Santa Cruz Biotechnology, Santa Cruz, CA), as well as tubulin antibody (Innogenex, San Ramon, CA). For VEGF immunoprecipitation, concentrated 2774 cell conditioned medium (27) was incubated with VEGF antibody as previously described (28).

S.C. and Orthotopic Tumor Models and Immunohistochemistry. To establish tumors in mice, 1 x 106 of 2774 tumor cells were injected s.c. in the mid-dorsal region. Tumors were allowed to grow for 14 days. Then, an intratumor al injection of 1 x 109 pfu/40 µL of AdTß10 was done thrice, once every 3 days. Tumor size was evaluated by caliper measurements every 3 days. Mice were sacrificed on day 27 after final virus injection. Tumors were then excised and prepared for immunohistochemistry. For the orthotopic model of 2774 tumor growth, 1 x 106 of GFP-2774 cells were injected into the right ovary through the fat pad. GFP-2774 cells were prepared by stable transfection of pEGFP-C1 (Clontech). GFP-expressing tumors were examined using the Illumatool tunable lighting system (Lightools Research, Encinitas, CA). An intratumoral injection of 1x 109 pfu/20 µL of AdTß10 was done on day 7 after tumor injection. Mice were sacrificed on day 10 after virus injection. Tumors were then excised and prepared for immunohistochemistry. Frozen sections were stained with rat monoclonal anti-mouse CD31 (PECAM-1) antibody (PharMingen, San Diego, CA). Vascular density in the tumors was calculated by counting the number of blood vessels in three separate tumor cross-sections per group. The specificity of the staining was confirmed with isotype-matched antibodies (normal rat IgG1{kappa}).

Data Analysis and Statistics. Values are presented as the mean ± SD or ± SE. Statistical comparisons between groups were done using the Student's t test. P < 0.05 was considered statistically significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Thymosin ß10 Inhibits VEGF-Induced Proliferation, Migration, and Invasion of HUVECs. To determine the effects of thymosin ß10 on endothelial cell functions crucial to angiogenesis, its effects on VEGF-induced proliferation, migration and invasion of endothelial cells were investigated (Fig. 1). HUVECs were either uninfected or infected with Ad, AdTß10, or AdTß10 with siRNA (thymosin ß10–targeted small interfering RNA), then DNA synthesis was assayed using [3H]thymidine incorporation (Fig. 1A). As expected, VEGF increased DNA synthesis of uninfected HUVECs and of empty virus-infected HUVECs when compared with unstimulated cells (29). Overexpression of thymosin ß10 significantly inhibited VEGF-induced DNA synthesis. This inhibitory effect was not due to cytotoxicity of thymosin ß10 in endothelial cells, since thymosin ß10 had no effect on the viability of HUVECs in the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay (data not shown). In addition, thymosin ß10 did not have cytotoxic effects on other normal cell types tested, such as normal fibroblasts, MRC-5 and IMR-90 (data not shown). To further confirm the effect of thymosin ß10 on endothelial proliferation, we used RNA interference (30). As shown in Fig. 1B, siRNA markedly inhibited the expression of GFP-thymosin ß10 protein and mRNA in HUVECs. However, siRNA did not affect the expression of an irrelevant gene (GAPDH). The inhibitory effect of thymosin ß10 on VEGF-induced endothelial cell proliferation was completely restored by siRNA transfection. The results indicate that VEGF-induced endothelial cell proliferation is specifically inhibited by thymosin ß10.



View larger version (26K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Thymosin ß10 inhibits endothelial cell proliferation, migration, and invasion in vitro. A, HUVECs were either uninfected (Un) or infected with Ad, AdTß10, or AdTß10 with siRNA transfection (AdTß10 + siRNA) for 18 hours followed by treatment with or without VEGF (10 ng/mL) for 24 hours. cpm value of [3H]thymidine was determined with a liquid scintillation counter. B, ablation of GFP-Tß10 protein and mRNA expression by siRNA in HUVECs. Bar, 50 µm. C and D, uninfected HUVECs and adenovirus-infected HUVECs were seeded on Transwells for the migration assays (C) or on Matrigel-coated Transwells for the invasion assays (D) followed by stimulation with or without VEGF (25 ng/mL) for 24 or 30 hours, respectively. Number of migrated or invaded cells was counted under a light microscope and mean values were determined. *, P < 0.05; **, P < 0.01; ***, P < 0.001 compared with VEGF alone.

 
To investigate whether overexpressed thymosin ß10 modulates the effects of VEGF on endothelial cell migration and invasion, we did Transwell migration and invasion assays. VEGF enhanced the migration (Fig. 1C) and invasion (Fig. 1D) of uninfected HUVECs and of empty virus-infected HUVECs when compared with that of unstimulated cells as expected. However, overexpression of thymosin ß10 significantly reduced VEGF-induced migration and invasion of HUVECs. The ablation of overexpressed thymosin ß10 by siRNA maintained the stimulatory effects of VEGF on migration and invasion of HUVECs. Therefore, overexpressed thymosin ß10 potently inhibited key events of the angiogenic process induced by VEGF, such as proliferation, migration, and invasion of endothelial cells in vitro.

Thymosin ß10 Inhibits Tube Formation In vitro and Vessel Sprouting Ex vivo. To confirm that thymosin ß10 has direct antiangiogenic effects, we investigated whether overexpression of thymosin ß10 could alter endothelial tube formation. Uninfected or empty virus-infected cells incubated with VEGF formed an organized network of endothelial cells on Matrigel (Fig. 2A). In contrast, overexpression of thymosin ß10 markedly inhibited VEGF-induced tube formation. The inhibitory effect of thymosin ß10 on VEGF-induced tube formation was completely restored by siRNA transfection.



View larger version (50K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Thymosin ß10 inhibits tube formation in vitro and vessel sprouting ex vivo. A, uninfected HUVECs and indicated adenovirus-infected HUVECs were plated on growth factor-reduced Matrigel and treated with or without VEGF (10 ng/mL) for 48 hours. The formation of tubular structures was detected by an inverted microscope. Arrows, thin and broken tubes. GFP Images were captured using a fluorescence microscope. Bar, 100 µm. Tube length was quantified and expressed as the means ± SD. *, P < 0.05; ***, P < 0.001 compared with VEGF alone. B, cross-sections of mouse tibialis anterior muscle were embedded in growth factor–reduced Matrigel with or without VEGF for 6 days and treated with Ad, AdTß10, or paclitaxel for 5 days. Outgrowth of capillary-like structures was observed with an inverted microscope (magnifications, x12.5 and x40, top and bottom, respectively). Bar, 500 µm. Mean area of vascular sprouting was quantified and expressed as the means ± SD. **, P < 0.01 compared with VEGF alone.

 
To evaluate whether the thymosin ß10 inhibits vessel sprouting, an ex vivo explant assay (25) was done (Fig. 2B). Abundant vessel sprouting was detected in uninfected or empty virus-infected explants in the presence of VEGF. In contrast, overexpression of thymosin ß10 showed significantly reduced VEGF-induced vessel sprouting at levels lower than paclitaxel, a cytotoxic cancer drug with antiangiogenic activities. These observations suggest that thymosin ß10 effectively suppressed capillary formation in vitro and ex vivo.

Thymosin ß10 Interacts With Ras. We next tried to determine the mechanism involved in the inhibition of angiogenesis by identifying proteins which bind to thymosin ß10. Thus, we screened for thymosin ß10 binding proteins using the yeast two-hybrid system. One prominent gene identified was Ras. Positive interaction was verified by both cell growth and the ß-galactosidase assay (Fig. 3A). Direct interaction of Ras with thymosin ß10 in vitro wasconfirmed using a glutathione S-transferase pull-down assay (Fig. 3B). The interaction of the two proteins was also shown by co-immunoprecipitation between the endogenous Ras and the exogenously introduced GFP-tagged thymosin ß10 (GFP-Tß10; Fig. 3C). These results indicate that thymosin ß10 directly interacts with Ras.



View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Thymosin ß10 interacts with Ras in vitro and in vivo. A, transformants were assayed for their ability to grow on medium lacking leucine (left) and for â-galactoside expression (right). Activity of the interaction between thymosin ß10 and Ras was represented by the relative activity of â-galactosidase expression. B, the GST pull-down assay was done using an anti-GST antibody. K-Ras was detected with an anti-His antibody. C, HUVECs were transiently transfected with GFP or GFP-Tß10. Total cell lysates were immunoprecipitated with an anti-Ras antibody. The presence of thymosin ß10 in the immunoprecipitates was detected using an anti-GFP antibody. The immunoprecipitates and total cell extracts were analyzed by Western blots with an anti-Ras antibody and anti-GFP antibody, respectively.

 
Thymosin ß 4 neither Interacts with Ras nor Inhibits Angiogenesis. To establish the functional consequence of the binding of thymosin ß10 to Ras, we compared the Ras binding ability and the effects on angiogenesis of thymosin ß4 with those of thymosin ß10, since these proteins apparently share some structural features and functionalities (8, 9), but have divergent effects on angiogenesis (12, 14). First, we determined whether thymosin ß4 also binds to Ras. Interestingly, thymosin ß4 did not bind to Ras in vivo (Fig. 4A and B). Furthermore, consistent with other reports (14, 31), thymosin ß4 had no effect on proliferation and invasion of HUVECs (Fig. 4C and D), whereas thymosin ß10 showed inhibitory effects on the activities (Fig. 1). In addition, thymosin ß4 increased migration and tube formation of HUVECs (Fig. 4EF) in contrast to thymosin ß10 which was inhibitory (Figs. 1 and 2). To investigate the combined effect of thymosin ß4 and thymosin ß10 on the tube formation, both thymosins were simultaneously overexpressed (Fig. 4G). The positive effect of thymosin ß4 on tube formation was overridden by increasing concentrations of thymosin ß10, and vice versa. However, thymosin ß4 and thymosin ß10 disrupted VEGF-induced stress fiber formation of HUVECs at a similar degree (Fig. 4H). In addition, simultaneous overexpression significantly inhibited the reorganization of the actin architecture in response to VEGF. Therefore, the effects of thymosin ß10 when compared with that of thymosin ß4, suggest that inhibition of angiogenesis by thymosin ß10 is via a direct interaction with Ras, independent of actin binding.



View larger version (37K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. Thymosin ß4 neither interacts with Ras nor inhibits angiogenesis. A, transformants were assayed for their ability to grow on medium lacking leucine (left) and for â-galactoside expression (right). The activity of the interaction between thymosin ß4 and Ras was represented by the relative activity of â-galactosidase expression. B, 2774 cells were transiently transfected with GFP-thymosin ß10 and His-thymosin ß4. thymosinß10 or thymosin ß4 was immunoprecipitated with anti-GFP antibody or anti-His antibody, respectively. The presence of Ras in the immunoprecipitates and the endogenous Ras was detected using an anti-Ras antibody. C, HUVECs were transfected with thymosin ß4 for 18 hours followed by treatment with or without VEGF (10 ng/mL) for 24 hours. cpm value of [3H]thymidine was determined with a liquid scintillation counter. D, untransfected HUVECs and indicated vector transfected HUVECs were seeded on Matrigel-coated Transwells, followed by stimulation with or without VEGF (25 ng/mL) for 30 hours. Number of invaded cells was counted under a light microscope and mean values were determined. E, untransfected HUVECs and indicated vector transfected HUVECs were seeded on Transwells followed by stimulation with or without VEGF (25 ng/mL) for 24 hours. Number of migrated cells was counted under a light microscope and mean values were determined. F, untransfected HUVECs and the indicated vector transfected HUVECs were plated on growth factor-reduced Matrigel and then treated with or without VEGF (10 ng/mL) for 24 hours. Tube length was quantified and expressed as the means ± SD. **, P < 0.01 compared with VEGF alone. G, HUVECs were transfected with thymosin ß4 and thymosin ß10, depending on the concentration of each plasmid and their ratio, and the tube formation assay was done. The effect on tube formation is represented as % change of control. H, HUVECs were transfected with thymosin ß4 and thymosin ß10 for 72 hours followed by stimulation with or without VEGF (50 ng/mL) for 15 minutes. Cells were fixed and stained with phalloidin (green) for filamentous actin. Images were captured on a fluorescence microscope.

 
Thymosin ß10 Interferes With Ras Function. To understand the role of thymosin ß10 binding to Ras, we first investigated whether thymosin ß10 is involved in Ras activity. The stimulation of Ras and subsequent activation of its downstream effector molecules is crucial in angiogenesis (6, 32). Based on the high affinity of active Ras (Ras-GTP) for the RBD of Raf, a downstream effector of activated Ras (33), Ras activation was assayed. Stimulation of serum-deprived HUVECs with VEGF resulted in arobust increase of Raf bound Ras-GTP. On the other hand, overexpression of thymosin ß10 in these cells resulted in the absence of the active Ras (Fig. 5A).



View larger version (41K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Thymosin ß10 interferes with VEGF-mediated Ras-ERK signaling in HUVECs and reduces VEGF production in HUVECs and in 2774 ovarian cancer cells. A, active Ras (Ras-GTP) in HUVECs was detected by using a GST-Raf1-RBD pull-down assay. Total Ras was detected by using anti-pan Ras antibody. B, thin layer chromatogram of the nucleotides eluted from immunoprecipitates of Ras from HUVECs. Ratio of GTP to GTP + GDP was determined by densitometry. C, cytosol, membrane, and nuclear extracts were prepared from uninfected 1, VEGF + Ad–infected 2 and VEGF + GFP-AdTß10–infected 3 HUVECs. Localization of GFP-Tß10 and Ras was determined by Western blotting. Purity of the extracts was confirmed by Western blotting for tubulin. D, HUVECs were either uninfected or infected with Ad or GFP-AdTß10 for 48 hours followed by treatment with or without VEGF (50 ng/mL) for 15 minutes. Phosphorylated MEK and ERK and total ERK were detected by Western-blot analysis. E, the total cell lysate of HUVECs in D was used for VEGF detection. F, 2774 ovarian cancer cells were either uninfected or infected with Ad or AdTß10 for 48 hours. VEGF expression was detected by Western blot analysis (top). Secreted VEGF was detected in the concentrated conditioned medium (CCM) of 2774 by immunoprecipitation (bottom).

 
We next characterized the molecular mechanism by which thymosin ß10 inhibits Ras function. To determine whether thymosin ß10 decreases the amount of Ras-GTP or interferes with Raf binding of Ras-GTP, we did a Ras guanidine nucleotide binding assay (Fig. 5B). Very little GTP was detected in untreated cells, but significant amounts of GTP were found in cells treated with VEGF. Contrary to our expectation, thymosin ß10 markedly increased the level of GTP. Therefore, it is possible that thymosin ß10 interferes with Raf binding of Ras-GTP rather than decreasing the amount of Ras-GTP. This may result in the inhibition of the GTPase activity of Ras and the subsequent accumulation of Ras-GTP. The subcellular localization of thymosin ß10 supports this notion (Fig. 5C). GFP-Tß10 was not only detected in the cytosolic fraction, but also in the membrane fraction (top), indicating that thymosin ß10 may bind Ras in the membrane and interfere with Ras signaling. However, thymosin ß10 did not affect Ras localization (middle).

Thymosin ß10 Inhibits ERK Signaling in Endothelial Cells and Reduces VEGF Expression in Both Endothelial and Tumor Cells. Based on the above findings, we investigated whether thymosin ß10 inhibits Ras downstream mitogen-activated protein kinase kinase (MEK) and ERK activation (Fig. 5D). Ras-ERK mediated transcriptional up-regulation of angiogenic factors, such as VEGF, is a well-known mechanism that promotes angiogenesis (29). VEGF-stimulated MEK and ERK phosphorylation were markedly reduced by overexpressed thymosin ß10. However, the total ERK level was unaffected by thymosin ß10. Therefore, it seems that thymosin ß10 inhibits the Ras-ERK signaling pathway in HUVECs. Consistent with these findings, overexpressed thymosin ß10 completely inhibited VEGF expression in HUVECs (Fig. 5E). This suggests that thymosin ß10 inhibits the autocrine effect of VEGF in endothelial cells and thus, has a direct antiangiogenic effect.

Next, we investigated the effect of thymosin ß10 on VEGF production in tumor cells. VEGF is mainly secreted by tumor cells to recruit VEGF receptor–expressing endothelial cells to the tumor (29). Overexpression of thymosin ß10 in 2774 ovarian cancer cells resulted in a marked reduction of VEGF expression and secretion into the medium (Fig. 5F). Thus, thymosin ß10 decreases VEGF production in tumor cells leading to a suppressed paracrine effect of VEGF on angiogenesis.

Thymosinß10 Inhibits Tumor Growth and Associated Angiogenesis. To explore whether thymosin ß10 has direct antitumor activity, we tested the effects of overexpressed thymosin ß10 on tumor cell growth in vitro. We found that thymosin ß10 markedly decreased 2774 ovarian cancer cell growth when compared with controls (Fig. 6A).



View larger version (41K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. Thymosin ß10 inhibits tumor growth and angiogenesis in vivo. A, 2774 ovarian cancer cells were either uninfected or infected with Ad or AdTß10 for 48 hours. Number of cells was counted under the microscope. B, 2774 tumor cells were injected s.c. An intratumoral injection of Ad ({square}) and AdTß10 ({bullet}) was done thrice. Tumor volume is shown as the mean from 4 to 6 mice. *, P < 0.05; **, P < 0.01; ***, P < 0.001 compared with Ad. C, tumor site and excised tumors from Ad- and AdTß10-treated mice on day 27 after virus injection were photographed. Tumor volume is shown as the mean from four mice (n = 8 per group). Frozen sections of the tumors were stained for endothelial cells using an anti-CD31 antibody. Bar, 50 µm. **, P < 0.01 compared with Ad. D, GFP-2774 cells were injected orthotopically into the right ovary. GFP expressing tumors (green) were examined using an UV illuminating system (top). The excised tumors (white arrows) and normal ovaries (white arrowheads) from Ad- and AdTß10-treated mice on day 10 after virus injection were photographed (middle). Tumor volume is shown as the mean from five mice. Frozen sections of the tumors were stained for endothelial cells using anti-CD31 antibody. Bar, 50 µm. *, P < 0.05 and **, P < 0.01 compared with Ad.

 
The antitumor and antiangiogenic activity of thymosin ß10 was then evaluated in vivo. Cells (2774) were implanted s.c. in nude mice. We allowed the tumors to grow until they reached a mean volume of 100 mm3. On day 14, an intratumoral injection of 1x109 pfu/40 µL of thymosin ß10 was done and repeated every 3days for 9 days. Tumor growth was significantly inhibited by thymosin ß10 (Fig. 6B) with no signs of body weight loss or liver toxicity (data not shown). Tumors from thymosin ß10–treated mice were excised on day 27 after the final virus injection. The volume of thymosin ß10–treated tumors was 77% smaller than those from control mice (Fig. 6C). Moreover, immunohistologic staining of endothelial cells in the thymosin ß10–treated mice showed an 89% decrease in the number of blood vessels stained with CD 31.

These antitumor and antiangiogenic effects of thymosin ß10 were confirmed in orthotopically injected tumor cells (Fig. 6D). We injected GFP-2774 tumor cells into the right ovary and did intratumoral injections of thymosin ß10 on day 7 after tumor injection. GFP-expressing tumors were significantly decreased in thymosin ß10–treated mice. The volume of excised tumors on day 10 after virus injection was 54% smaller than those from control mice. Also, the erythema of the tumor due to induction of angiogenesis was dramatically reduced in thymosin ß10–treated mice when compared with control mice. Immunohistologic staining of endothelial cells in thymosin ß10–treated tumors showed a 77%decrease in the number of blood vessels. Together these resultsshow that overexpressed thymosin ß10 potently suppresses angiogenesis and tumor growth in vivo.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This study shows the crucial function of a monomeric actin-sequestering protein, thymosin ß10, as a new potent antiangiogenic and antitumor molecule that targets Ras. Here, we suggest a possible mechanism for the inhibition of angiogenesis and tumor growth by thymosin ß10, which involves direct binding to Ras thereby inhibiting the Ras-activated MEK/ERK signaling pathway. Ras effector pathways not only affect tumor cell proliferation and survival (34) but also lead to the induction of angiogenesis (5, 6). Induction occurs mainly by means of ERK-mediated transcriptional up-regulation of angiogenic factors and increased invasiveness through both ERK-mediated expression of matrix metalloproteinases and Rac-mediated effects on the cytoskeleton (35). Therefore, Ras-targeted thymosin ß10 could play a key role in inhibiting tumor growth and angiogenesis.

In this study, overexpressed thymosin ß10 potently inhibited multiple angiogenic processes, including endothelial cell proliferation, migration, invasion, tube formation, and vessel sprouting Figs. 1 and 2. Cell viability was not affected by empty adenoviruses or by thymosin ß10–expressing adeonovirus in the angiogenesis assays (data not shown). The combined inhibitory effects of thymosin ß10 on critical endothelial functions in angiogenesis may result in a synergistic effect greater than that of blocking any one cellular response alone. This could be explained by the fact that Ras proteins operate as molecular switches in signaling pathways that regulate diverse cell growth and differentiation processes (34, 36). Ras proteins are involved in intracellular signaling from receptor tyrosine kinases which results in the activation of a phosphorylation cascade (37). Growth factors, such as VEGF, fibroblast growth factor, platelet-derived growth factor, nerve growth factor, epidermal growth factor, and insulin activate Ras proteins, but in some cases other factors, such as transforming growth factor-ß (38) and angiotensin-2 (39) activate Ras as well. Multiple downstream effectors have also been identified which may lead to alternate pathways. Indeed, we found that thymosin ß10 also inhibited Rac activation by suppressing the mRNA expression of the guanosine nucleotide exchange factor, vav (40).3 Therefore, when the function of the key regulator, Ras was blocked by thymosin ß10 overexpression, upstream signals from receptors for various factors and downstream pathways were inhibited. These functions eventually lead to the suppression of angiogenesis.

We had expected another possible mechanism by which thymosin ß10 inhibits angiogenesis via disruption of the actin cytoskeleton of HUVECs, because depolymerization of actin stress fiber is well known function of ß-thymosins (8, 9). However, thymosin ß4 and thymosin ß10 showed the same inhibitory effect on actin polymerization, although they had opposite effects on angiogenesis (Fig. 4). In addition, within the ß-thymosin family, the actin binding motif (LKKTETQ) is highly conserved (41), and the seven amino acids motif is essential for their angiogenic activity (42). Thus, angiogenesis inhibition by thymosin ß10 is distinct from the common actin binding property of ß-thymosins. One possible explanation is that thymosin ß4 and thymosin ß10 bind to G-actin ina 1:1 complex forming a large pool of unpolymerized actin that can be easily released when needed for polymerization of actin filaments. However, thymosin ß10 inhibits multiple signaling molecules needed for polymerization of actin filaments, such as Rac and Wave4 by interfering with Ras or directly, which results in disrupting actin dynamics. This may explain why the two homologous proteins have very different effects on angiogenesis.

On the other hand, thymosin ß4 and thymosin ß10 showed distinct patterns of expression in several tissues (10) and played different roles during rodent development (11). Thymosin ß10 mRNA levels were very low in the cardiovascular system of early mouse embryo, in contrast to thymosin ß4 mRNA levels (43). Angiogenesis actively occurs in early development and is commonly controlled by the balance between angiogenic and antiangiogenic factors depending on the demand of the physiologic environment in a development-dependent manner. These literature findings further support the assumption that thymosin ß4 and thymosin ß10 act on vessel development in a complementary way in vivo, and this may also be extended to the angiogenesis process. This hypothesis is also supported by the fact that overexpression ofthymosin â4 and thymosin ß10 induces an increased (14) and decreased (Fig. 5E and F) expression of VEGF, respectively.

Thymosin ß10 has direct effects on tumor cells. It inhibits 2774 ovarian cancer cell growth. In addition, we found that thymosin ß10 inhibited Ras-ERK signaling (data not shown) as well as VEGF secretion (Fig. 5) in these cells. Together, these observations suggest that overexpression of thymosin ß10 in whole tumors could disrupt tumor growth and associated angiogenesis through both tumor cell-mediated effects and effects on endothelial cells. This would be expected to be more potent than targeting either cell type alone. It was also observed that thymosin ß10 increased phospho-p53 in ovarian cancer cells (data not shown) suggesting the possibility thatthymosin ß10 may be related to multiple effector pathways.

Targeting the Ras proteins and their signaling pathways could be very valuable in developing cancer therapies (35). Over 20 cancer therapeutic agents have been developed thus far, but specific inhibitors of upstream activators or downstream mediators showed limited effect on Ras activity. Prenylation, the post-translational modification step, is required for the localization and function of Ras. However, attempting to inhibit prenylation by using farnesyltransferase inhibitors has not been successful in human trials. Although H-Ras is exclusively modified by farnesyltransferase, K-Ras and, to a lesser extent, N-Ras can also be modified by geranylgeranyltransferase. The combined use of farnesyltransferase inhibitors and geranylgeranyltransferase inhibitors (44) has failed because they act on other proteins which are necessary for normal cell growth and show cellular toxicity. We now propose that thymosin ß10 may overcome the deficiencies of these existing therapies that target Ras or its signaling pathways. Because thymosin ß10 directly binds to Ras and interferes with Ras itself, it acts selectively in its specific inhibition of Ras. Therefore, thymosin ß10 could have a greater inhibitory effect on tumor cells and/or tumor vessels containing highly activated Ras compared with normal cells.

In conclusion, thymosin ß10 is not only an actin-sequestering protein. It has also been found to block the cellular signaling cascades involved in angiogenesis and in tumor growth. This newly discovered mechanism may lead to the future development of effective cancer therapies using thymosin ß10.


    Acknowledgments
 
Grant support: Korea Science and Engineering Foundation SRC (J-H. Lee) and National Institute of Toxicological Research (S-H. Lee).

The cost of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Drs. Hyun Seok Song and Seung Hee Hong for critically reviewing the manuscript.


    Footnotes
 
Note: S-H. Lee and M. J. Son contributed equally to this work.

3 Unpublished observations. Back

4 Unpublished observations. Back

Received 5/ 6/04. Revised 8/24/04. Accepted 10/22/04.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Risau W. Mechanism of angiogenesis. Nature 1997;386:671–4.[CrossRef][Medline]
  2. Folkman J, Shing Y. Angiogenesis. J Biol Chem 1992;267:10931–4.[Free Full Text]
  3. Folkman J. Clinical applications of research on angiogeneisis. N Engl J Med 1995;333:1757–63.[Free Full Text]
  4. Ferrara N. VEGF and the quest for tumour angiogenesis factors. Nat Rev Cancer 2002;2:795–803.[CrossRef][Medline]
  5. Rak J, Mitsuhashi Y, Sheehan C, et al. Oncogenes and tumor angiogenesis: differential modes of vascular endothelial growth factor up-regulation in ras-transformed epithelial cells and fibroblasts. Cancer Res 2000;60:490–8.[Abstract/Free Full Text]
  6. Meadows KN, Bryant P, Pumiglia K. Vascular endothelial growth factor induction of the angiogenic phenotype requires Ras activation. J Biol Chem 2001;276:49289–98.[Abstract/Free Full Text]
  7. Lee SH, Zhang W, Choi JJ, et al. Overexpression of the thymosin ß-10 gene in human ovarian cancer cells disrupts F-actin stress fiber and leads to apoptosis. Oncogene 2001;20:6700–6.[CrossRef][Medline]
  8. Yu FX, Lin SC, Morrison-Bogorad M, Atkinson MA, Yin HL. Thymosin ß10 and thymosin ß4 are both actin monomer sequestering proteins. J Biol Chem 1993;268:502–9.[Abstract/Free Full Text]
  9. Nachmias VT. Small actin-binding proteins: the ß-thymosin family. Curr Opin Cell Biol 1993;5:56–62.[CrossRef][Medline]
  10. Lin SC, Morrison-Bogorad M. Developmental expression of mRNAs encoding thymosins ß4 and ß10 in rat brain and other tissues. J Mol Neurosci 1990;2:35–44.[Medline]
  11. Anadon R, Rodriguez, Moldes I, et al. Differential expression of thymosins ß (4) and ß (10) during rat cerebellum postnatal development. Brain Res 2001;894:255–65.[CrossRef][Medline]
  12. Koutrafouri V, Leondiadis L, Avgoustakis K, et al. Effect of thymosin peptides on the chick chorioallantoic membrane angiogenesis model. Biochim Biophys Acta 2001;1568:60–6.[Medline]
  13. Malinda KM, Goldstein AL, Kleinman HK. Thymosin ß 4 stimulates directional migration of human umbilical vein endothelial cells. FASEB J 1997;11:474–81.[Abstract]
  14. Cha HJ, Jeong MJ, Kleinman HK. Role of thymosin ß4 in tumor metastasis and angiogenesis. J Natl Cancer Inst 2003;95:1674–80.
  15. Ridley AJ, Paterson HF, Johnston CL, Diekmann D, Hall A. The small GTP-binding protein rac regulates growth factor-induced membrane ruffling. Cell 1992;70:401–10.[CrossRef][Medline]
  16. Morbidelli L, Donnini S, Ziche M. Role of nitric oxide in the modulation of angiogenesis. Curr Pharm Des 2003;9:521–30.[CrossRef][Medline]
  17. Haskell H, Natarajan M, Hecker TP, et al. Focal adhesion kinase is expressed in the angiogenic blood vessels of malignant astrocytic tumors in vivo and promotes capillary tube formation of brain microvascular endothelial cells. Clin Cancer Res 2003;9:2157–65.[Abstract/Free Full Text]
  18. Stanyon CA, Bernard O. LIM-kinase1. Int J Biochem Cell Biol 1999;31:389–94.[CrossRef][Medline]
  19. Yamazaki D, Suetsugu S, Miki H, et al. WAVE2 is required for directed cell migration and cardiovascular development. Nature 2003;424:452–6.[CrossRef][Medline]
  20. Ryan HE, Lo J, Johnson RS. HIF-1{alpha} is required for solid tumor formation and embryonic vascularization. EMBO J 1998;17:3005–15.[CrossRef][Medline]
  21. Marx M, Perlmutter RA, Madri JA. Modulation of platelet-derived growth factor receptor expression in microvascular endothelial cells during in vitro angiogenesis. J Clin Invest 1994;93:131–9.
  22. Cheng JJ, Wung BS, Chao YJ, Wang DL. Sequential activation of protein kinase C (PKC)-{alpha} and PKC-{varepsilon} contributes to sustained Raf/ERK1/2 activation in endothelial cells under mechanical strain. J Biol Chem 2001;276:31368–75.[Abstract/Free Full Text]
  23. Cherfils J, Chardin P. GEFs: structural basis for their activation of small GTP-binding proteins. Trends Biochem Sci 1999;24:306–11.[CrossRef][Medline]
  24. Lee OH, Kim YM, Lee YM, et al. Sphingosine 1-phosphate induces angiogenesis: its angiogenic action and signaling mechanism in human umbilical vein endothelial cells. Biochem Biophys Res Commun 1999;264:743–50.[CrossRef][Medline]
  25. Jang HS, Kim HJ, Kim JM, et al. A novel ex vivo angiogenesis assay based on electroporation-mediated delivery of naked plasmid DNA to skeletal muscle. Mol Ther 2004;9:464–74.[CrossRef][Medline]
  26. Downward J, Graves JD, Warne PH, Rayter S, Cantrell DA. Stimulation of p21ras upon T-cell activation. Nature 1990;346:719–23.[CrossRef][Medline]
  27. Kim MS, Kwon HJ, Lee YM, et al. Histone deacetylases induce angiogenesis by negative regulation of tumor suppressor genes. Nat Med 2001;7:437–43.[CrossRef][Medline]
  28. Song HS, Son MJ, Lee YM, et al. Oxygen tension regulates the maturation of the blood-brain barrier. Biochem Biophys Res Commun 2002;290:325–31.[CrossRef][Medline]
  29. Plate KH, Breier G, Weich HA, Risau W. Vascular endothelial growth factor is a potential tumour angiogenesis factor in human gliomas in vivo. Nature 1992;29:845–8.
  30. Bosher JM, Labouesse M. RNA interference: genetic wand and genetic watchdog. Nat Cell Biol 2000;2:E31–6.[CrossRef][Medline]
  31. Grant DS, Kinsella JL, Kibbey MC, et al. Matrigel induces thymosin ß4 gene in differentiating endothelial cells. J Cell Sci 1995;108:3685–94.[Abstract]
  32. Eliceiri BP, Klemke R, Stromblad S, Cheresh DA. Integrin {alpha}vß3 requirement for sustained mitogen-activated protein kinase activity during angiogenesis. J Cell Biol 1998;140:1255–63.[Abstract/Free Full Text]
  33. Pumiglia KM, LeVine H, Haske T, Habib T, Jove R, Decker SJ. A direct interaction between G-protein ß {gamma} subunits and the Raf-1 protein kinase. J Biol Chem 1995;270:14251–4.[Abstract/Free Full Text]
  34. Joneson T, Bar-Sagi D. Ras effectors and their role in mitogenesis and oncogenesis. J Mol Med 1997;75:587–93.[CrossRef][Medline]
  35. Downward J. Targeting RAS signalling pathways in cancer therapy. Nat Rev Cancer 2003;3:11–22.[CrossRef][Medline]
  36. Campbell SL, Khosravi-Far R, Rossman KL, Clark GJ, Der CJ. Increasing complexity of Ras signaling. Oncogene 1998;17:1395–413.[CrossRef][Medline]
  37. Spaargaren M, Bischoff JR, McCormick F. Signal transduction by Ras-like GTPases: a potential target for anticancer drugs. Gene Expr 1995;4:345–56.[Medline]
  38. Mulder KM, Morris SL. Activation of p21ras by transforming growth factor ß in epithelial cells. J Biol Chem 1992;267:5029–31.[Abstract/Free Full Text]
  39. Sadoshima J, Izumo S. Signal transduction pathways of angiotensin II–induced c-fos gene expression in cardiac myocytes in vitro. Roles of phospholipid-derived second messengers. Circ Res 1993;73:424–38.[Abstract/Free Full Text]
  40. Bustelo XR. Regulatory and signaling properties of the Vav family. Mol Cell Biol 2000;20:1461–77.[Free Full Text]
  41. Huff T, Muller CS, Otto AM, Netzker R, Hannappel E. ß-Thymosins, small acidic peptides with multiple functions. Int J Biochem Cell Biol 2001;33:205–20.[CrossRef][Medline]
  42. Philp D, Huff T, Gho YS, Hannappel E, Kleinman HK. The actin binding site on thymosin ß4 promotes angiogenesis. FASEB J 2003;17:2103–5.[Abstract/Free Full Text]
  43. Carpintero P, Franco del Amo F, Anadon R, Gomez-Marquez J. Thymosin ß10 mRNA expression during early postimplantation mouse development. FEBS Lett 1996;394:103–6.[CrossRef][Medline]
  44. Leonard DM. Ras farnesyltransferase: a new therapeutic target. J Med Chem 1997;40:2971–90.[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, S.-H.
Right arrow Articles by Lee, J.-H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, S.-H.
Right arrow Articles by Lee, J.-H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online