Cancer Research Meeting Calendar  Genetics and Biology of Brain Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chung, J.-H.
Right arrow Articles by Eng, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chung, J.-H.
Right arrow Articles by Eng, C.
[Cancer Research 65, 4108-4116, May 15, 2005]
© 2005 American Association for Cancer Research


Molecular Biology, Pathobiology, and Genetics

Phosphatase and Tensin Homologue Deleted on Chromosome 10 (PTEN) Has Nuclear Localization Signal–Like Sequences for Nuclear Import Mediated by Major Vault Protein

Ji-Hyun Chung1,2, Margaret E. Ginn-Pease1,2 and Charis Eng1,2,3,4

1 Clinical Cancer Genetics Program, Human Cancer Genetics Program, Comprehensive Cancer Center, 2 Department of Molecular Virology, Immunology and Medical Genetics, and 3 Division of Human Genetics, Department of Internal Medicine, The Ohio State University, Columbus, Ohio and 4 Cancer Research UK Human Cancer Genetics Research Group, University of Cambridge, United Kingdom

Requests for reprints: Charis Eng, Human Cancer Genetics Program, Division of Human Genetics, Department of Internal Medicine, The Ohio State University, 420 West 12th Avenue, Suite 690 TMRF, Columbus, OH 43210. Phone: 614-292-2347; Fax: 614-688-3582; E-mail: eng-1{at}medctr.osu.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Although phosphatase and tensin homologue deleted on chromosome 10 (PTEN) localization in the nucleus and cytoplasm is established, the mechanism is unknown. PTEN is a tumor suppressor phosphatase that causes cell cycle arrest and/or apoptosis. Nuclear-cytoplasmic compartmentalization may be a novel mechanism in regulating these events. PTEN does not contain a traditional nuclear localization sequence (NLS); however, we identified putative NLS-like sequences, which we analyzed by site-directed mutagenesis and localization studies in MCF-7 cells. Two double site mutations exhibited nuclear localization defects. Furthermore, unlike wild-type PTEN, double NLS mutant PTEN did not interact with major vault protein (MVP), a previously hypothesized nuclear-cytoplasmic transport protein. We conclude that these two NLS-like sequences are required for PTEN nuclear import that is mediated by MVP. Further, we show that this MVP-mediated nuclear import is independent of PTEN phosphorylation and of the lipid and protein phosphatase activities of PTEN.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Alterations of the tumor suppressor PTEN/MMAC1/TEP1 are common events in diverse human cancers, including carcinomas of the breast, endometrium, and prostate and glioblastoma. In addition to somatic alterations in common cancers, germ line mutations in phosphatase and tensin homologue deleted on chromosome 10 (PTEN) are associated with the dominantly inherited Cowden and Bannayan-Riley-Ruvalcaba syndromes, which are characterized by the formation of multiple benign tumors and by an increased risk of malignant breast, thyroid, and endometrial tumors. Heterozygous disruption of PTEN in mice leads to neoplasia in multiple tissues reminiscent of human Cowden syndrome (1).

PTEN is composed of a NH2-terminal phosphatase domain within which lies the consensus phosphatase signature motif composed of a C2 domain that binds lipid vesicles and a COOH-terminal "tail" that contains a PDZ binding domain (2, 3). PTEN can dephosphorylate tyrosine-, serine-, and threonine-phosphorylated peptides in vitro and has been shown to dephosphorylate focal adhesion kinase in vivo. PTEN also dephosphorylates phosphatidylinositol (3, 4, 5)-triphosphate with specificity for the phosphate group at the D3 position of the inositol ring. Phosphatidylinositol (3, 4, 5)-triphosphate is a lipid second messenger and a regulator of the phosphatidylinositol 3-kinase/Akt pathway (1, 4). PTEN mediates G1 cell cycle arrest and apoptosis and inhibits cell migration, spreading, and focal adhesion formation (4, 5). PTEN also regulates activation of the mitogen-activated protein kinase pathway (5).

Although many studies have observed PTEN localize to nuclear and cytoplasmic compartments, the function of nuclear PTEN and a mechanism to explain nuclear entry and exit has yet to be identified. Alterations in the localization of proteins within subcellular compartments may be a more important mechanism of activation or inactivation of cellular processes than previously thought (6). Mutations that prevent or promote subcellular localization may have serious effects on DNA repair or cell cycle checkpoints controlled by these proteins (6). Recently, for example, Rodriguez et al. (7) reported that nuclear-cytoplasmic shuttling of BARD1 regulates its proapoptotic activity and is regulated by dimerization with BRCA1. Although nuclear PTEN has been shown by several research groups, including ours, to have effects on the cell cycle (811), further work will be necessary to examine the relation of PTEN nuclear compartmentalization to the function of PTEN.

In a previous study, we directly showed that PTEN localizes to the nucleus and that this localization occurs with the G0-G1 phases of the cell cycle. In addition, we showed increases in cytoplasmic PTEN during S phase (12). Our data are corroborated by incidental observations by other researchers (1316) who have also described differential localization with nonnaturally occurring truncated protein ({Delta}354-403) and serine/threonine mutants (5). In addition, PTEN has also been shown in isolated nuclei from pig muscle (17) and in developing brain cells in the mouse (18).

Despite observations of nuclear PTEN, a traditional nuclear localization sequence (NLS) has not yet been reported. Traditional sequences, such as the classic SV40 T-antigen virus motif KKKRK and alternative sequences of basic amino acids, have been identified in other proteins, such as BRCA1 (19). Bipartite sequences with basic regions (KRX10-12KRRK) separated by 10 to 12 residues have been identified in VHL (6) and p53 (20, 21) and bipartite signals in BRCA2 (22). APC protein has NLS-directed import as well as NLS-independent transport (6). Other signaling proteins have also shown nontraditional sequences, including an extended bipartite sequence in SMAD4, which directs nuclear transport coordinated with the cell cycle (23). A recent review of the known NLS and nuclear export sequences of tumor suppressor proteins described the importance of nuclear-cytoplasmic compartmental isolation to a variety of protein activities, including the ability of these proteins to coordinate the cell cycle (24). For example, mutations in TP53 cause alterations in p53 nuclear-cytoplasmic shuttling (25), whereas the phosphatase CDC25B has nuclear import and export sequences that regulate nuclear-cytoplasmic shuttling during the cell cycle in HeLa cells (26). Because we and others have observed PTEN in the nucleus, and because we have shown nuclear-cytoplasmic transport associated with the cell cycle, we hypothesize that a nontraditional NLS controls PTEN nuclear transport.

Recently, the C2 domain in PTEN has been shown to interact with major vault protein (MVP) in HeLa cells (27), and MVP was hypothesized as a general carrier molecule for nuclear-cytoplasmic transport (28). Although the cellular function of vaults is still unknown, their subcellular localization and distinct morphology point to a role for vaults in intracellular, particularly nuclear-cytoplasmic, transport (28) and suggests that it may be an important component in PTEN localization.

In an attempt to identify the mechanism of nuclear-cytoplasmic transport of PTEN, we identified putative NLS that are required for nuclear import and show that nuclear import is mediated by MVP. Our findings provide insights into the molecular mechanism by which PTEN is localized and identify the target of MVP nuclear-cytoplasmic translocation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell lines and culture conditions. MCF-7 breast cancer cells expressing wild-type (WT), protein and lipid phosphatase–dead mutant PTEN:C124S (PTEN:CS), and lipid phosphatase–dead mutant PTEN:G129E (PTEN:GE) were generated as described previously (10). The MCF-7 Tet-Off cell line (BD Clontech, Inc., Palo Alto, CA), a breast cancer cell line containing a tetracycline-controlled cassette, was grown in DMEM-high glucose supplemented with 10% fetal bovine serum, 1% penicillin-streptomycin, and 100 µg/mL G418 (Invitrogen, Inc., Carlsbad, CA) at 37°C under an atmosphere containing 5% CO2. Stable clones and transient clones incorporating the experimental pTre2Hyg and pTre2Hyg-HA constructs were selected with 400 µg/mL hygromycin B (Invitrogen). Vector expression was controlled with 2 µg/mL tetracycline. All cell lines for preparation of total cell-free extracts were collected by scraping after synchronization with 3 mmol/L hydroxyurea for 16 to 24 hours following 48-hour absence of tetracycline. The MCF-7 cell lines were used for transient transfection for plasmids encoding PTEN dephosphorylation-mimicking mutants.

Plasmid construction and transfection. Four sequences in PTEN were selected as NLS-like sequences by similarity to known nontraditional NLS and are described as NLS1 (amino acids 10-14, RNKRR -> RNGNR), NLS2 (amino acids 160-164, RTRDKK -> RTNDGK), NLS3 (amino acids 233-237, RREDK -> RNEDK), and NLS4 (amino acids 265-269, KKDK -> KNDN). To create mutations in the NLS-like sequence, WT PTEN cDNA was cloned from a previously reported vector into the BSSK+ vector (Stratagene, Inc., La Jolla, CA). Site-directed mutagenesis (QuickChange Mutagenesis, Stratagene) was done using the following primers:

NLS1M-F: GAGATCGTTAGCAGAAACACAGGGACATATCAAGAGGATGGG
NLS1M-R: RCCATCCTCTTGATATGTCCTGTGTTTCTGCTAACGATCTC
NLS2M-F: GGGAAGTAAGGAACCATAGACATACAGGGAGTAACTATTCCCA
NLS2M-R: CTGGGAATAGTTACTCCCTGTATGTCTATGGTCCTACTTCCCC
NLS3M-F: CAGGACCCACACTACTGGAAGACATGTTCATGTACTTTGAGTTC
NLS3M-R: AACTCAAAGTACATGAACATGTCTTCCAGTAGTGTGGGTCCTGA
NLS4M-F: CAGAACAAGGATGCTAACACAGGACACAATGTTTCACTTTTGG
NLS4M-R: FCCCAAAAGTGAAACATTGTGTCCTGTGTTAGCATCTTGTTCTG

The mutant cDNA was then subcloned and inserted into the pTre2Hyg and pTre2Hyg-HA vectors (BD Clontech). The constructs were confirmed by restriction mapping and sequencing. The pTre2Hyg PTEN-NLSM1, pTre2Hyg-NLSM2, pTre2Hyg-NLSM3, pTre2Hyg-NLSM4, pTre2Hyg PTEN-NLSM1M2, pTre2Hyg-NLSM1M3, pTre2Hyg-NLSM1M4, pTre2Hyg-NLSM2M3, pTre2Hyg PTEN-NLSM2M4, pTre2Hyg-NLSM3M4, pTre2Hyg-HA-PTEN, pTre2Hyg-HA-PTEN-NLSM2M3, and pTre2Hyg HA-PTEN-NLSM2M4 constructs were stably transfected into the MCF-7 Tet-Off cell line as recommended by the manufacturer's instructions. The MCF-7 and Tet-Off system were used previously in our investigation of WT PTEN in the nucleus (12) and have been part of our ongoing investigations of cell cycle components following transfection of WT PTEN and naturally occurring PTEN mutants associated with neoplasia.

SDS-PAGE, Western blot, and antibodies. Following the removal of medium, transfected MCF-7 cells were washed once and then scraped into ice-cold PBS. The cells were used for whole cell–free extracts and nuclear/cytoplasmic protein separation or stored at –80°C for future use. Nuclear and cytoplasmic proteins were isolated with a buffer extraction system and centrifugation according to the manufacturer's recommendations (NE-Per, Pierce Biotechnology, Inc., Rockford, IL). The following inhibitors were added: 0.75 mmol/L phenylmethylsulfonyl fluoride, 0.5 mg/mL benzamidine hydrochloride, 2 µg/mL each of leupeptin, aprotinin, and pepstatin, 10 mmol/L ß-glycerophosphate, 0.2 mmol/L sodium orthovanadate, and 25 mmol/L NaF (Sigma Biochemical Co., St. Louis, MO). Whole cell–free protein extracts used for protein analysis were prepared according to the manufacturer's recommendation, except the inclusion of protease inhibitors (M-Per, Pierce Biotechnology). Protein concentrations were determined using BCA reagents (Pierce Biotechnology) with bovine serum albumin as a standard.

SDS-PAGE and Western blot were done according to procedures recommended by the Bio-Rad Protein III System (Bio-Rad, Inc., Hercules, CA). The monoclonal antibody 6H2.1 raised against the last 100 COOH-terminal amino acids of PTEN can recognize the WT PTEN, PTEN:C124S, and PTEN:G129E proteins (10). Antibodies against HA, P-PTEN, 3P-PTEN, Akt, P-Akt, and actin were purchased from Cell Signaling Co. (Beverly, MA) and MVP monoclonal antibody was obtained from Transduction Laboratories (Lexington, KY). Antibodies against importin complex subunits were purchased from Santa Cruz Co. (Santa Cruz, CA). For Western blot, protein (20-40 µg) was fractionated by 8% to 12% SDS-polyacrylamide gels and transferred by Trans-Blot Cell system (Bio-Rad). Nitrocellulose membranes (S&S, Inc., Keene, NH) were washed four times after the first and second antibody reactions with 0.1% TBS containing 0.1% Triton X-100. Secondary antibody was anti-mouse IgG and anti-rabbit IgG conjugated to horseradish peroxidase (Promega, Inc., Madison, WI). Membranes were incubated for 1 minute facedown in enhanced chemiluminescence substrate (Amersham Biosciences, Inc., Chicago, IL) and fluorescent signals were collected by Hyperfilm XR (Amersham Biosciences, Inc.) and quantified by using ImageQuant software version 5.1. Equal loading of wells was evaluated by staining membrane with Ponceau S reagent (Sigma Biochemical) and actin Western blotting.

Immunoprecipitation. Whole cell–free protein extracts used for immunoprecipitation analysis were prepared according to procedures recommended by Cell Signaling. After pretreatment of the sample with protein A-Sepharose beads (Sigma Biochemical), solutions (400 µL) of 5% bovine serum albumin/PBS containing antibody solution (5 µL) were added and the sample was incubated overnight at 4°C with mixing. Protein A-Sepharose [40 µL of a 40% (v/v) suspension] was added to each sample and incubated for 2 hours on ice with mixing. Immunoprecipitates were collected by centrifugation at 5,000 rpm for 5 minutes in a microcentrifuge. Pellets were washed four times in buffer [1% Triton X-100, 1% deoxycholic acid, 50 mmol/L Tris-HCl (pH 7.5), 150 mmol/L NaCl] and precipitated proteins were eluted from the beads by incubation for 10 minutes at 95°C in 100 µL of 4x SDS loading buffer [50 mmol/L Tris (pH 6.8), 8% glycerol, 1.6% SDS, 4% ß-mercaptoethanol, 0.04% bromphenol blue]. Half of each precipitate was subjected to SDS-PAGE.

Immunofluorescent microscopy. Cells were prepared for indirect immunofluorescent microscopy by using a published procedure (12). The secondary antibody was goat anti-mouse IgG labeled with fluorescein, and Prolong reagents were used for storage of the signals (Molecular Probes, Inc., Eugene, OR). Fluorescent images were obtained with a Nikon Eclipse E800 fluorescence microscope equipped with a Nikon 100x/1.3 plan fluor oil immersion objective and a Diagnostic Instruments Spot camera controlled by Adobe Photoshop software. Adobe PhotoShop software was used to process images.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The lipid and protein phosphatase activities of PTEN are not required for its nuclear-cytoplasmic transport. As a first step toward identifying the mechanism involved in nuclear-cytoplasmic transport of PTEN, we examined the role of the protein and lipid phosphatase activities of PTEN in nuclear-cytoplasmic transport. PTEN has been implicated not only in suppressing cancer growth but also in regulating development, cell cycle, cell adhesion, apoptosis, and stem cell growth and differentiation (1). In all cases, it would seem that the phosphatase activity of PTEN is essential. Mutations at C124, a key residue in the phosphatase core motif, results from a single nucleotide missense mutation seen in a subset of Cowden syndrome/Bannayan-Riley-Ruvalcaba syndrome patients and primary sporadic tumors (29). Further, the PTEN:C124S (sometimes called PTEN:CS) point mutation results in a phosphatase-dead protein, with neither lipid nor protein phosphatase activity (10). It has been well documented previously that PTEN containing another missense mutation, Gly129 -> Glu129 (PTEN:G129E or PTEN:GE), which retains protein phosphatase activity but lacks lipid phosphatase activity, can inhibit the migration of some tumor cells (30). In addition, it has been shown that the phosphatase domain is essential for the electrostatic membrane binding of PTEN and plays a role in membrane targeting as supported by experiments using the dominant-negative Cys124 -> Ser124 (PTEN:C124S; ref. 30). These observations may therefore suggest that nuclear entry of PTEN may be related to phosphatase activity via its membrane electrostatic effects. To examine this possibility, we used MCF-7 Tet-Off breast cancer cell lines stably transfected with each of the phosphatase-mutant PTEN constructs (pcDNA3 PTEN:C124S and pcDNA3 PTEN:G129E) and compared these to cells transfected with WT PTEN and to empty vector control cells (12).

If there is a phosphatase-mediated nuclear localization defect, then nuclear PTEN levels in the PTEN:C124S and PTEN:G129E phosphatase-dead cell lines would be expected to be similar to vector control cells (MCF-7 Tet-Off cells also have endogenous WT PTEN in the nucleus) but less than that in the WT PTEN-expressing cell lines in the context that our monoclonal antibody 6H2.1 recognizes WT PTEN and both phosphatase-dead PTEN mutants. Indeed, when we did these experiments, all PTEN-expressing cells lines, irrespective of whether they had WT PTEN or each of the phosphatase mutants (PTEN:C124S or PTEN:G129E), expressed similar levels of PTEN in the nucleus and the cytoplasm (with a relative nuclear/cytoplasmic ratio of ~1:4; Fig. 1A and B). These observations, therefore, suggest that the lipid and protein phosphatase activities of PTEN in the context of electrostatic membrane binding and membrane targeting of PTEN are not related to PTEN nuclear-cytoplasmic transport.



View larger version (31K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Phosphatase activity is not required for nuclear-cytoplasmic transport of PTEN. A, MCF-7 Tet-Off cells were stably transfected with plasmids encoding PTEN:WT, PCDNA3.1, PTEN:C124S, and PTEN:G129E. After 48 hours of induction in the absence (–) or presence (+) of tetracycline, nuclear (N) and cytoplasmic (C) fractions were prepared and examined by immunoblotting (IB) for the presence of nuclear and cytoplasmic PTEN. B, data in (A) were quantified by phosphoimage analysis and normalized to nuclear fraction in each cell line in +Tet medium. Columns, mean (n = 3); bars, SD.

 
Phosphorylation of PTEN may not be required for its nuclear import. Phosphorylation of PTEN causes a conformation change that can result in the masking of the PDZ domain-binding site, thereby suppressing the recruitment of PTEN into the PTEN-associated complex in the plasma membrane (31). Recently, it has been shown that the COOH-terminal tail regulates PTEN activity and the mutation of three residues (S380, T382, and T383) in the COOH-terminal tail dramatically lowers the membrane association rate of PTEN (32). Thus, we were interested in examining the relation of phosphorylation to nuclear-cytoplasmic transport. To determine if phosphorylation has a direct effect on nuclear-cytoplasmic transport of PTEN and phospho-PTEN, we used MCF-7 Tet-Off breast cancer cell lines stably transfected with WT PTEN constructs (pTre2Hyg PTEN:WT) and examined nuclear and cytoplasmic distributions of PTEN and phospho-PTEN in WT PTEN-overexpressing and vector control cells.

PTEN and phospho-PTEN levels were measured in nuclear and cytoplasmic fractions, in the presence and absence of tetracycline, by Western blot analysis using a monoclonal antibody against PTEN (6H2.1) and polyclonal antibodies against phospho-PTEN (S370 and S380/S382/S384). If a nuclear localization defect was present, we would expect nuclear PTEN and phospho-PTEN expression to be at similar levels (i.e., not increased) to that of empty vector controls cells given that MCF-7 Tet-Off cells have endogenous PTEN and phospho-PTEN in the nucleus. We observed very similar results in PTEN-overexpressing and control cells (Fig. 2A). PTEN and phospho-PTEN expression in the nuclear fractions was ~25% of that in the cytoplasmic fractions and these ratios were maintained in the absence of tetracycline in WT PTEN and vector control cells (Fig. 2A and B).



View larger version (32K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Phosphorylation of PTEN is not required for nuclear-cytoplasmic transport of PTEN. A, steady-state protein levels of PTEN and phospho-PTEN. MCF-7 Tet-Off cells were stably transfected with plasmids encoding pTre2Hyg PTEN:WT and pTre2Hyg. After 48 hours of induction in the absence or presence of tetracycline, nuclear and cytoplasmic fractions were prepared and examined by immunoblotting. Note that relative nuclear to cytoplasmic distributions of PTEN are similar whether it is phosphorylated or not. B, data in (A) were quantified by phosphoimage analysis and normalized to nuclear fraction in PTEN:WT ({blacksquare}) and Vector ({square}) cell lines in +Tet medium. Columns, mean (n = 3); bars, SD. C, localization of phospho-PTEN. MCF-7 cells were transiently transfected with HA-PTEN-plasmids, which are WT (PTEN:WT) or containing S380A (PTEN:S380A), S380A/T382A/T385A (PTEN:A3), S380A/T382A/T383A/S385A (PTEN:A4), or S370A/S380A/T382A/T383A/S385A (PTEN:A5). Forty-eight hours after transfection, cells were fixed and stained by anti-HA primary antibody followed by goat anti-mouse IgG labeled with fluorescein. DAPI-stained cells are also shown for identification of nuclei.

 
PTEN has five putative phosphorylation sites, but by using antibodies specific for PTEN phosphorylation, we were limited to examining three phosphorylation sites. To fully examine the effects of phosphorylation on nuclear translocation, HA-tagged dephosphorylation-mimicking mutants (S370A, 3A: S380A/T382A/T385A, 4A: S380A/T382A/T383A/S385A, and 5A: S370A/S380A/T382A/T383A/S385A) were transiently transfected into the MCF-7 breast cancer cell line. Subcellular localization was examined by using indirect immunofluorescence microscopy with anti-HA antibody and anti-mouse IgG fluorescein conjugates (Fig. 2C). 4',6-Diamidino-2-phenylindole (DAPI) staining was also done to unequivocally visualize the nucleus. In PTEN:WT cells, HA-PTEN localized to the cytoplasm and nucleus and some portions of the plasma membrane. Yet, no nuclear localization defects were detected in the cells containing the phosphorylation mutants, an observation that was further confirmed by Western blot analysis (data not shown). These results verify those shown in Fig. 2A. Thus, based on the combined data, we conclude that phosphorylation of PTEN does not affect PTEN nuclear localization.

Putative single site nuclear localization sequence mutations in PTEN do not affect its nuclear-cytoplasmic transport. To determine if the sequences identified as NLS-like can act as part of the targeting signal for the movement of PTEN across the nuclear membrane, four putative NLS sequences within PTEN were selected based on sequence similarity to other nontraditional NLS. Mutant constructs were generated using PCR-directed mutagenesis to incorporate mutations in the regions encompassing the putative NLS sequence as follows: NLSM1, amino acids 11 to 15 RNKRR -> RNGNR; NLSM2, amino acids 159 to 164 RTRDKK -> RTNDGK; NLSM3, amino acids 233 to 237 RREDK -> RNEDK; and NLSM4, amino acids 266 to 269 KKDK -> KNDN (mutated amino acids are indicated in bold). WT PTEN constructs and empty vector controls described above were always used for comparison as positive and negative controls, respectively (12). Each of the clones was tested for the presence of PTEN in cell-free extracts, nuclear and cytoplasmic fractions, and in the presence (+Tet) and absence (–Tet) of tetracycline, by Western blot analysis. Nuclear and cytoplasmic proteins were examined in clones of each of the four different NLS mutant cell lines.

In initial experiments, the expression of PTEN and phospho-PTEN was different in each of the clones. We found that each of the mutant NLS PTEN constructs were active because phosphorylation of Akt decreased, whereas Akt expression remained steady following the increase of PTEN expression (ref. 10; Fig. 3C). If a nuclear localization defect resulted from each NLS mutation, it would be expected that nuclear PTEN and phospho-PTEN levels would be decreased compared with WT PTEN-expressing cells but would be similar to that in empty vector control cells given that MCF-7 Tet-Off cells have endogenous PTEN and phospho-PTEN in the nucleus as well. Instead, similar levels of nuclear and cytoplasmic PTEN were observed in cell lines expressing WT PTEN and each of the NLS mutant proteins (Fig. 3A and B). These observations suggest that single site NLS-like sequences do not mediate PTEN import into the nucleus.



View larger version (54K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Single mutations of NLS-like sequences do not affect PTEN nuclear localization. Four NLS-like sequences in PTEN were selected; site-directed mutagenesis was done, and mutant constructs were stably transfected into the MCF-7 Tet-Off cell line. After 48 hours of induction in the absence or presence of tetracycline, nuclear and cytoplasmic fractions were prepared and examined by immunoblotting. A, immunoblot analysis for PTEN in cell lines containing vector only, PTEN:WT (WT), PTEN:NLSM1 (M1), PTEN:NLSM2 (M2), PTEN:NLSM3 (M3), or PTEN:NLSM4 (M4). The relative nuclear to cytoplasmic levels of PTEN were similar for all control and single-mutant constructs. B, immunoblot analysis for phospho-PTEN. The nuclear to cytoplasmic distributions of phospho-PTEN were similar for PTEN:WT and single-mutant constructs. C, cell-free extracts were examined by immunoblotting for the presence of PTEN, P-PTEN, Akt, P-Akt, and actin proteins. Note that withdrawal of tetracycline always resulted in overexpression of PTEN over the endogenous levels of PTEN except in the negative control with empty vector only.

 
NLS4 (amino acids 265-269 KKDK), together with NLS2 (amino acids 160-164 RTRDKK) or NLS3 (amino acids 233-237 RREDK), is required for nuclear import of PTEN. Because many tumor suppressor proteins have bipartite NLS, consisting of two basic amino acid groups separated by one spacer of 12 amino residues, we wanted to examine the effects of combining the NLS mutations. Each of the single PTEN NLS mutant constructs was used for double NLS mutant constructions.

We confirmed that these double NLS mutants maintained phosphatidylinositol 3-kinase–dependent PTEN activity by examining the P-Akt levels. We found that all the double mutants resulted in a decrease in P-Akt levels when expressed (Fig. 4). The PTEN proteins in each of these double NLS mutants, like those of the NLS single mutants, were active. Yet, the expression level of exogenous PTEN differed with each clone. However, double NLS mutants NLSM2-NLSM4 (NLSM2M4) and NLSM3-NLSM4 (NLSM3M4) exhibited defective PTEN nuclear import (Fig. 4B) as evidenced by the level of nuclear PTEN being the same in the presence or absence of tetracycline and PTEN levels in cytoplasmic fractions were increased ~4-fold in the absence of tetracycline. This indicates that the NLSM4 (amino acids 265-269 KKDK) is necessary but not sufficient for nuclear localization of PTEN. NLSM4 requires either NLSM2 (amino acids 160-164 RTRDKK) or NLSM3 (amino acids 233-237 RREDK) to mediate PTEN nuclear import.



View larger version (32K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. NLS4 together with NLS2 or NLS3 are required for nuclear import of PTEN and phospho-PTEN. The combination mutants in PTEN were selected; site-directed mutagenesis was done and mutant constructs were stably transfected into the MCF-7 Tet-Off cell line. After 48 hours of induction in the absence or presence of tetracycline, nuclear and cytoplasmic fractions were prepared and examined by immunoblotting. A, cell-free extracts were prepared as described in the Materials and Methods and examined by immunoblotting for PTEN, P-PTEN, Akt, P-Akt, and actin protein levels to examine the PTEN protein expression and downstream readout (phosphorylation of Akt) in absence of tetracycline. B, immunoblot analysis for PTEN and P-PTEN(S380) in cell lines containing vector only, PTEN:WT (WT), PTEN:NLSM2M4 (M2M4), or PTEN:NLSM3M4 (M3M4). C, immunoblot analysis for HA, PTEN, and P-PTEN(S380) in cell lines containing vector only, HA-PTEN:WT (HA-PTEN:WT), HA-PTEN:NLSM2M4 (HA-PTEN:M2M4), or HA-PTEN:NLSM3M4 (HA-PTEN:M3M4). Although HA-tagged PTEN and P-PTEN were in the nucleus and cytoplasm in HA-PTEN cells, these proteins did not localize in the nucleus in the double mutant-expressing lines. D, nuclear and cytoplasmic localization of PTEN determined by indirect immunofluorescence staining with anti-HA primary antibody followed by fluorescein conjugated goat anti-mouse IgG antibodies. DAPI-stained cells are also shown for identification of nuclei. Note that unlike WT PTEN, which localizes to the nucleus, double mutants are excluded from the nucleus (HA-PTEN:M2M4 and HA-PTEN:M3M4).

 
To confirm this notion further, each of the double NLS mutants was transferred to pTre2Hyg-HA and stably transfected into MCF-7 Tet-Off breast cancer cell lines. Nuclear-cytoplasmic localization was examined using Western blot analysis and indirect immunofluorescence microscopy with anti-HA antibody and anti-mouse IgG fluorescein conjugates. The mutated and HA-tagged PTEN proteins in each of the double NLS mutants were active because phosphorylation of Akt decreased, whereas Akt expression remained steady following the increase of PTEN expression (Fig. 4A). As shown in Fig. 4C, HA-tagged PTEN was in the nucleus and cytoplasm in WT PTEN cells but did not localize to the nucleus in NLSM2M4 and NLSM3M4 double mutants. According to the indirect immunofluorescence microscopic study, anti-HA antibodies localized to the cytoplasm and nucleus with additional focus to portions of the plasma membrane in WT PTEN cells. HA-PTEN:NLSM2M4 and HA-PTEN:NLSM3M4 exhibited nuclear localization defects, which were confirmed by Western blot analysis (Fig. 4D). These data confirm that NLS4 (amino acids 265-269 KKDK) together with either NLS2 (amino acids 160-164 RTRDKK) or NLS3 (amino acids 233-237 RREDK) provide NLS for PTEN.

Importin complex may not be required in the nuclear-cytoplasmic transport of PTEN. Because proteins of the importin family organize the transport of NLS-containing proteins into the nucleus, we were interested in investigating the possible influence of the importin-{alpha}/ß complex on the nuclear import of PTEN and phospho-PTEN. To assess the influence of PTEN NLS mutations on importin-{alpha}/ß binding, the interaction between importin-{alpha} and importin-ß was analyzed using immunoprecipitation. To determine the mechanism underlying the nuclear import of PTEN, PTEN NLS double mutants were examined. In initial experiments, we examined each of the importin complex proteins in cell-free extracts and found that each of the cell lines had similar levels of each subunit (Fig. 5A). Surprisingly, there were small variations in the intensity of bands from experiment to experiment, but overall our results indicated that PTEN and phospho-PTEN equally interact with importin-{alpha} and importin-ß in each of the four cell lines regardless of mutation status, indicating that the NLS does not directly interact with importin. It may stand to reason that importin proteins interact with basal levels of PTEN and phospho-PTEN or that importin proteins mediate another function of PTEN (Fig. 5B and C).



View larger version (34K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Importin complex can interact with PTEN and phospho-PTEN. The interaction with the importin complex was examined by immunoprecipitation (IP) using importin-{alpha} and importin-ß. A, cell-free extracts were prepared as described in Materials and Methods and examined by immunoblotting to examine the expression levels of the importin complex subunit in the absence of tetracycline. Each cell line had similar levels of each importin complex subunit. B, PTEN and phospho-PTEN were precipitated by anti-importin-{alpha} and anti-importin-ß antibodies in cell lines containing vector only, PTEN:WT, PTWN:NLSM2M4, or PTEN:NLSM3M4. PTEN and phospho-PTEN were examined by immunoblotting. The interaction strength and quantity in all of these cells was found to be very similar. C, data in Fig. 3B were quantified by phosphoimage analysis and normalized to PTEN:WT in PTEN ({blacksquare}) and P-PTEN ({square}) immunoprecipitation. Columns, mean (n = 3); bars, SD.

 
Major vault protein mediates the nuclear import of PTEN. Several groups have reported the association of vaults with the nucleus and particularly the nucleoli, the nuclear membrane, and/or the nuclear pore complex (33). Recently, it has been reported that PTEN associates with MVP (27) and MVPs have been hypothesized as carrier molecules for nuclear-cytoplasmic transport (28). We examined if MVPs interact with PTEN and mediate PTEN nuclear-cytoplasmic transport. In initial experiments, MVP expression was examined by Western blotting using anti-MVP monoclonal antibody. Interaction with PTEN using immunoprecipitation was examined in total cell-free extracts in the absence of tetracycline.

To determine the mechanism underlying the nuclear import of PTEN, we first analyzed the ability of PTEN NLS single-site mutants to interact with MVP. MVP expression in each cell line was similar to vector control cells and the interaction of overexpressed WT and each single site NLS mutant PTEN with MVP was similar (Fig. 6A and B). These observations indicate that each single site mutation retains the ability to interact with MVP. Next, similar experiments were done but with each double NLS mutant. In these experiments, when PTEN was overexpressed, MVP expression in WT PTEN-expressing cells was similar to that of the vector control but at a higher level than in the nuclear localization defect cell lines expressing NLSM2M3 or NLSM2M4 (Fig. 6A and C). As shown in Fig. 6D, PTEN and phospho-PTEN in the WT PTEN-overexpressing cell lines, and to a lesser extent in vector control cells (which have endogenous PTEN), interact with MVP. In contrast, however, PTEN containing either NLSM2M4 or NLSM3M4 mutations did not interact with MVP. MVP-PTEN interactions were similar in each NLS double mutant cell lines as in the vector control cells, reflecting only the endogenous levels of WT PTEN present (Fig. 6D). To confirm these results, we did similar experiments in HA-tagged NLS double mutant cells. Again, WT PTEN was found to interact with MVP but NLS double mutants did not (Fig. 6C and D). On further analysis, MVP was found to localize densely in the nucleus as is the case with PTEN (Fig. 6E). Taken all together, our observations confirm that MVP mediates PTEN and phospho-PTEN nuclear import.



View larger version (35K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. MVP interacts with and mediates PTEN and phospho-PTEN nuclear import. The interaction of MVP and PTEN and phospho-PTEN was examined by immunoprecipitation. A, cell-free extracts were examined by immunoblotting for the presence of MVP (top) and MVP was precipitated by anti-PTEN antibodies in each cell line containing vector only, PTEN:WT, PTEN:NLSM1, PTEN:NLSM2, PTEN:NLSM3, or PTEN:NLSM4 (bottom). MVP was examined by immunoblotting. The interaction strength and levels in all of these cell lines were found to be very similar. B, data in Fig. 3A were quantified by phosphoimage analysis and normalized to WT PTEN. Columns, mean (n = 2); bars, SD. C, cell-free extracts were prepared as described in Materials and Methods and immunoblotting was done to examine the MVP expression levels in the absence of tetracycline. MVP expression was similar irrespective of the presence or absence of mutations in PTEN. D, MVP coimmunoprecipitation with either PTEN or phospho-PTEN (top) or HA (bottom). Note that PTEN and P-PTEN in WT PTEN-expressing cells interact with MVP but neither could interact with MVP in NLS double mutant-expressing cells. E, indirect immunofluorescence staining with anti-MVP primary antibody followed by fluorescein-labeled secondary antibody revealed that MVP localizes densely in the nucleus as is the case with PTEN. DAPI-stained cells are also shown for identification of nuclei.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
According to previous observations, PTEN is known to exist in the nucleus and peaks there with G0-G1 and nadirs during S phase in MCF-7 cells (12). Based on these observations, we investigated signals and partners for PTEN nuclear transport. We examined if the phosphatase activities of PTEN and/or phosphorylation of PTEN are key regulators of PTEN nuclear localization. PTEN membrane localization is highly dependent on two phosphatase functions of PTEN, and other tumor suppressor proteins, such as p53, can be regulated by phosphorylation (20). If nuclear localization defects exist, nuclear PTEN and phospho-PTEN protein are expected to be similar to (i.e., no higher than in) non-PTEN-overexpressing cells because MCF-7 Tet-Off cells have endogenous PTEN and phospho-PTEN in the nucleus. Our data suggest that the phosphatase activity of PTEN was not related to PTEN nuclear-cytoplasmic transport (Fig. 1) and that the degree of PTEN phosphorylation was not related to the nuclear localization of PTEN (Figs. 2, 3B, and 4B and C). This may be partially explained by PTEN localizing densely in membrane compartments (Fig. 4D, WT PTEN) and that membrane targeting of PTEN may use a different mechanism than nuclear-cytoplasmic shuttling.

In identifying the mechanism for PTEN nuclear-cytoplasmic transport, we looked for four amino acid sequences that could be involved in a nontraditional NLS because PTEN does not have a traditional NLS. The nuclear localization mechanisms of other tumor suppressor proteins often involve the recognition of NLS, binding of importer proteins (karyopherins) and the use of karyopherins to traverse the nuclear pore complex. The traditional NLS is a repeat of positive amino acids with flaking proline, but proteins may have a less traditionally structured region (24). Nontraditional nuclear import sequences have been identified in SMAD2, SMAD3, SMAD4, and Erk2 proteins. The import of these proteins is mediated by lysine-rich sequences, which interact with importin-{alpha} in traditional and nontraditional nuclear import. Mutations in the lysine-rich regions have been reported to decrease nuclear import of these proteins (24).

Four NLS-like sequences within PTEN were selected for mutation according to sequence similarity to other nontraditional NLS. NLSM1 (amino acids 10-14 RNKRR) incorporates a change in an arginine that has been reported previously to be important for function (34). NLSM2 (amino acids 265-269 RTRDKK) has a sequence homology surrounding the putative NLS, which is similar to the residues surrounding the CDC25B phosphatase NLS (26) and is a common structural feature of other phosphatases that coordinate water hydrolysis of phosphates at the active site (34). NLSM3 (amino acids 233-237 RREDK) lies within the C2 domain and is in a lysine-rich region, which are key interaction domains in nontraditional transport systems (24). NLSM4 (amino acids 265-269 KKDK) lies within the C2 domain, which may position the active site near the membrane (28) and has been shown to interact with the MVP in HeLa cells (27). Interestingly, however, unlike many proteins with nontraditional NLS, mutations in each of the four NLS-like regions of PTEN do not alter entry into the nucleus (Fig. 3). When individual NLS mutations were combined, we found that PTEN nuclear localization was affected, thereby indicating that nuclear import requires two NLS-like sequences acting in concert (Figs. 4 and 6). In particular, we have shown that the combination of NLS2 and NLS4 or NLS3 and NLS4 is required for nuclear localization.

In attempts to find the partners that mediate PTEN nuclear localization, WT PTEN and NLS single mutants was observed to interact with MVP (Fig. 6A and B) and transported to the nucleus, whereas nuclear localization defect mutants did not (Figs. 4B-D and 6D and E). These results indicate that MVP mediates both PTEN and phospho-PTEN nuclear import. The association of other proteins with vault proteins has shown that this binding can convey the protein near the nuclear membrane for transport. The idea of vaults taking part in a nuclear-cytoplasmic transport route is based on observations in rat fibroblasts. In these cells, vaults were detected in close proximity to the nuclear pore complex (28). Corresponding studies in developing sea urchin embryos, where MVP was copurified with ribosomes, suggested that vaults are involved in the transport of ribosomes (28). In more recent studies, the coiled coil of MVP was found necessary for vault tube formation in the 7 ± 2 µm penetrating nuclear membrane (33), which suggested that vaults could operate as cytoplasmic and/or nuclear membrane-associated transport (28). However, until now, no other studies corroborated this hypothesis and no targets for nuclear-cytoplasmic transport were known. Our studies do support this hypothesis and furthermore identify PTEN as a target for MVP-mediated nuclear-cytoplasmic transportation (Fig. 6).

Interaction via the C2 domain of PTEN and EF hands in MVP is not a usual phenomenon. However, some proteins do contain the C2 domain and EF hands, such as the phospholipase C family proteins. Crystal structures have revealed that the second lobe of the EF hands of phospholipase C-{delta}1 interact with its C2 domain, but the strength of this interaction is very weak (27). The C2 domain of PTEN has structural similarity to that of phospholipase C-{delta}1, with a root mean square deviation of 1.9 Å for 75 {alpha}C atoms (35). Therefore, a more stable interaction with the M2 and M3 regions might be necessary for MVP-PTEN interactions (Fig. 6D).

PTEN in WT and control cells, as well as in both PTEN nuclear localization defect cells (NLSM2M4 and NLSM3M4), was found to interact with importin-{alpha} and importin-ß (Fig. 5B) and all have similar steady-state levels of the importin complex subunit (Fig. 5A). The interaction strength and quantity in all of these cells was found to be very similar. This observation may lead us to postulate that PTEN could induce a damage signal and nuclear transport of this signal may be mediated by the importin interaction with PTEN. Importin, once thought to be exclusively a nuclear transport receptor, is emerging as a global regulator of diverse cellular functions. Importin-ß acts positively in multiple interphase roles: in nuclear import, as a chaperone for highly charged nuclear proteins, and as a potential motor adaptor for movement along microtubules (36). Importin-ß plays a negative regulatory role in mitotic spindle assembly, centrosome dynamics, nuclear membrane formation, and nuclear pore assembly. More recent work has shown that importin-ß plays a role in transducing damage signals from the axons of injured neurons back to the cell body (36). However, further work will be necessary to eliminate the possibility that importin is responsible for PTEN nuclear import (Fig. 5).

Despite the observations provided by the nuclear PTEN localization defective mutants, no nuclear export defects were revealed in our mutation studies. Our nuclear localization study carried out on nontraditional NLS does however provide evidence for MVP molecules as carrier proteins. PTEN does not have a traditional nuclear export sequence, so further work will be necessary to examine the mechanism responsible for PTEN nuclear export. According to our previous observations, PTEN is known to exist in the nucleus and peaks there with G0-G1 and nadirs during S phase in MCF-7 cells and that it is related with cell cycling (12). More recently, it was shown that PTEN induces cell cycle arrest by decreasing the level and nuclear localization of cyclin D1 (37). However, further work will be necessary to identify the mechanism of regulation of cyclin D1 by nuclear PTEN.

The results presented here are the first to indicate a mechanism for PTEN nuclear import and the identification of a substrate for MVP. Our observations suggest that NLS4 (amino acids 65-269 KKDK) necessarily pairs with NLS2 (amino acids 60-164 RTRDKK) or NLS3 (amino acids 233-237 RREDK) to direct the import of PTEN to the nucleus mediated by MVP. Further, we provide definitive evidence that MVP is the nuclear-cytoplasmic transport protein that mediates PTEN nuclear import.


    Acknowledgments
 
Grant support: Susan G. Komen Breast Cancer Research Foundation grant BCTR 2000 462, American Cancer Society grant RSG-02-151-01-CCE (C. Eng), National Cancer Institute grant P30CA16058 (Comprehensive Cancer Center), and Doris Duke Distinguished Clinical Scientist Award (C. Eng).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Dr. William R. Sellers for kindly providing the pGL5L PTEN dephosphorylation-mimicking mutant plasmids, Michelle Sinden and Dr. Kristin Waite for helpful discussions, and Dr. Waite for critical review of multiple drafts of the article.


    Footnotes
 
Note: M.E. Ginn-Pease is currently at the Department of Biochemistry, Capital University, Bexley, Ohio.

Received 1/14/05. Revised 2/28/05. Accepted 3/ 8/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Waite KA, Eng C. Protean PTEN: form and function. Am J Hum Genet 2002;70:829–44.[CrossRef][Medline]
  2. Li DM, Sun H. tEP1, encoded by a candidate tumor suppressor locus, is a novel protein tyrosine phosphatase regulated by transforming growth factor ß. Cancer Res 1997;57:2124–9.[Abstract/Free Full Text]
  3. Steck PA, Pershouse MA, Jasser SA, Yung WK, Lin H, et al. Identification of a candidate tumor suppressor gene, MMAC1, at chromosome 10q23.3 that is mutated in multiple advanced cancers. Nat Genet 1997;15:356–62.[CrossRef][Medline]
  4. Wu H, Goel V, Haluska FG. PTEN signaling pathways in melanoma. Oncogene 2003;22:3113–22.[CrossRef][Medline]
  5. Nakamura N, Ramaswamy S, Vazquez F, Signoretti S, Loda M, Sellers WR. Forkhead transcription factors are critical effectors of cell death and cell cycle arrest downstream of PTEN. Mol Cell Biol 2000;20:8969–82.[Abstract/Free Full Text]
  6. Fabbro M, Henderson BR. Regulation of tumor suppressors by nuclear-cytoplasmic shuttling. Exp Cell Res 2003;282:59–69.[CrossRef][Medline]
  7. Rodriguez JA, Schuchner S, Au WWY, Fabbro M, Henderson BR. Nuclear-cytoplasmic shuttling of BARD1 continues to its proapoptotic activity and is regulated by dimerization with BRCA1. Oncogene 2004;23:1809–20.[CrossRef][Medline]
  8. Hlobilkova A, Guldberg P, Thullberg M, Zeuthen J, Lukas J, Bartek J. Cell cycle arrest by the PTEN tumor suppressor is target cell specific and may require protein phosphatase. Exp Cell Res 2000;256:571–7.[CrossRef][Medline]
  9. Perren A, Komminoth P, Saremaslani P, et al. Immunohistochemical evidence of loss of PTEN expression in primary ductal adenocarcinoms of the breast. Am J Pathol 1999;155:1253–60.[Abstract/Free Full Text]
  10. Weng LP, Smith WM, Dahia PL, et al. PTEN suppresses breast cancer cell growth by phosphatase activity-dependent G1 arrest followed by cell death. Cancer Res 1999;59:5808–14.[Abstract/Free Full Text]
  11. Kwon CH, Zhu X, Zhang J, et al. PTEN regulates neuronal soma size: a mouse model of Lhermitte-Duclos disease. Nat Genet 2001;29:404–11.[CrossRef][Medline]
  12. Ginn-Pease ME, Eng C. Increased nuclear phosphatase and tensin homologue deleted on chromosome 10 is associated with G0-G1 in MCF7 cells. Cancer Res 2003;63:282–6.[Abstract/Free Full Text]
  13. Dahia PM, Gimm O, Chi H, Marsh DJ, Reynolds PR, Eng C. Absence of germline mutations in MINPP1, a phosphatase encoding gene centromeric of PTEN, in patients with Cowden and Bannayan-Riley-Ruvalcaba syndrome without germline PTEN mutations. J Med Genet 2000;37:715–7.[Free Full Text]
  14. Gimm O, Perren A, Weng LP, et al. Differential nuclear and cytoplasmic expression of PTEN in normal thyroid tissue, and benign and malignant epithelial thyroid tumors. Am J Pathol 2000;156:1693–700.[Abstract/Free Full Text]
  15. Whiteman DC, Zhou XP, Cummings MC, Pavey S, Hayward NK, Eng C. Nuclear PTEN expression and clinicopathological features in a population-based series of primary cutaneous melanoma. Int J Cancer 2003;99:63–7.
  16. Tachibana M, Shibakita M, Ohno S, et al. Expression and prognostic significance of PTEN product protein in patients with esophageal squamous cell carcinoma. Cancer 2002;94:1955–60.[CrossRef][Medline]
  17. Deleris P, Bacqueville D, Gayral S, et al. SHIP-2 and PTEN are expressed and active in vascular smooth muscle cell nuclei, but only SHIP-2 is associated with nuclear speckles. J Biol Chem 2003;278:38884–91.[Abstract/Free Full Text]
  18. Lachyankar MB, Sultana N, Schonhoff CM, et al. A role for nuclear PTEN in neuronal differentiation. J Neurosci 2000;20:1404–13.[Abstract/Free Full Text]
  19. Chen CF, Li S, Chen Y, Chen PL, Sharp ZD, Lee WH. The nuclear localization sequences of BRCA1 protein interact with the importin-{alpha} subunit of the nuclear transport signal receptor. J Biol Chem 1996;271:32863–8.[Abstract/Free Full Text]
  20. Liang SH, Clarke MF. A bipartite nuclear localization signal is required for p53 nuclear import regulated by carboxyl-terminal domain. J Biol Chem 1999;274:32699–703.[Abstract/Free Full Text]
  21. Liang SH, Clarke MF. The nuclear import of p53 is determined by the presence of a basic domain and its relative position to the nuclear localization signal. Oncogene 1999;18:2163–6.[CrossRef][Medline]
  22. Yano K, Morotomi K, Saito H, Kato M, Matsuo F, Miki Y. Nuclear localization signals of the BRCA2 protein. Biochem Biophys Res Commun 2000;270:171–5.[CrossRef][Medline]
  23. Xiao Z, Latek R, Lodish HF. An extended bipartite nuclear localization signal in Smad4 is required for its nuclear import and transcriptional activity. Oncogene 2003;22:1057–69.[CrossRef][Medline]
  24. Kau TR, Way JC, Silver PA. Nuclear transport and cancer: from mechanism to intervention. Nat Rev Cancer 2004;4:106–17.[Medline]
  25. Crook T, Parker GA, Rozycka M, Crossland S, Allday MJ. A transforming p53 mutants, which binds DNA, transactivates and induce apoptosis reveals a nuclear: cytoplasmic shuttling defect. Oncogene 1998;16:1429–41.[CrossRef][Medline]
  26. Davezac N, Baldin V, Gabrielli B, et al. Regulation of CDC25B phosphatases subcelluar localization. Oncogene 2000;19:2179–85.[CrossRef][Medline]
  27. Yu Z, Fotouhi-Ardakani N, Wu L, et al. PTEN associates with the vault particles in HeLa cells. J Biol Chem 2002;277:40247–52.[Abstract/Free Full Text]
  28. Mossink MH, van Zon A, Scheper RJ, Sonneveld P, Wiemer EA. Vaults: a ribonucleoprotein particle involved in drug resistance? Oncogene 2003;22:7458–67.[CrossRef][Medline]
  29. Eng C. PTEN: one gene, many syndromes. Hum Mutat 2003;22:183–8.[CrossRef][Medline]
  30. Lee JO, Yang H, Georgescu MM, et al. Crystal structure of the PTEN tumor suppressor: implications for its phosphoinositide phosphatase activity and membrane association. Cell 1999;99:323–34.[CrossRef][Medline]
  31. Das S, Dixon JE, Cho WH. Membrane-binding and activation mechanism of PTEN. Proc Natl Acad Sci U S A 2003;100:7491–6.[Abstract/Free Full Text]
  32. Georgescu MM, Kirsch KH, Kaloudis P, Yang H, Pavletich NP, Hanafusa H. Stabilization and productive positing roles of C2 domain of PTEN tumor suppressor. Cancer Res 2000;60:7033–8.[Abstract/Free Full Text]
  33. van Zon A, Mossink MH, Schoester M, et al. The formation of vault-tubes: a dynamic interaction between vaults and vault PARP. J Cell Sci 2003;116:4391–400.[Abstract/Free Full Text]
  34. Myers MP, Tanks NK. PTEN: sometimes taking it off can be better than putting it on. Am J Hum Genet 1997;61:1234–8.[CrossRef][Medline]
  35. Georgescu MM, Kirsch KH, Akagi T, Shishido T, Hanafusa H. The tumor-suppressor activity of PTEN is regulated by its carboxyl-terminal region. Proc Natl Acad Sci U S A 1999;96:10182–7.[Abstract/Free Full Text]
  36. Harel A, Forbes DJ. Importin ß; conducing a much larger cellular symphony. Mol Cell 2004;16:319–30.[Medline]
  37. Radu A, Neubauer V, Akagi T, Hanafusa H, Georgescu MM. PTEN induces cell cycle arrest by decreasing the level and nuclear localization of cyclin D1. Mol Cell Biol 2003;23:6139–49.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Hum Mol GenetHome page
G. P. Lobo, K. A. Waite, S. M. Planchon, T. Romigh, N. T. Nassif, and C. Eng
Germline and somatic cancer-associated mutations in the ATP-binding motifs of PTEN influence its subcellular localization and tumor suppressive function
Hum. Mol. Genet., August 1, 2009; 18(15): 2851 - 2862.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
G. P. Lobo, K. A. Waite, S. M. Planchon, T. Romigh, J. A. Houghton, and C. Eng
ATP modulates PTEN subcellular localization in multiple cancer cell lines
Hum. Mol. Genet., September 15, 2008; 17(18): 2877 - 2885.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C.-J. Chang, D. J. Mulholland, B. Valamehr, S. Mosessian, W. R. Sellers, and H. Wu
PTEN Nuclear Localization Is Regulated by Oxidative Stress and Mediates p53-Dependent Tumor Suppression
Mol. Cell. Biol., May 15, 2008; 28(10): 3281 - 3289.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
S. M. Planchon, K. A. Waite, and C. Eng
The nuclear affairs of PTEN
J. Cell Sci., February 1, 2008; 121(3): 249 - 253.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
T. Tamguney and D. Stokoe
New insights into PTEN
J. Cell Sci., December 1, 2007; 120(23): 4071 - 4079.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J.-L. Liu, Z. Mao, T. A. LaFortune, M. M. Alonso, G. E. Gallick, J. Fueyo, and W.K. A. Yung
Cell Cycle Dependent Nuclear Export of Phosphatase and Tensin Homologue Tumor Suppressor Is Regulated by the Phosphoinositide-3-Kinase Signaling Cascade
Cancer Res., November 15, 2007; 67(22): 11054 - 11063.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
M. P. Kowalski, A. Dubouix-Bourandy, M. Bajmoczi, D. E. Golan, T. Zaidi, Y. S. Coutinho-Sledge, M. P. Gygi, S. P. Gygi, E. A. C. Wiemer, and G. B. Pier
Host Resistance to Lung Infection Mediated by Major Vault Protein in Epithelial Cells
Science, July 6, 2007; 317(5834): 130 - 132.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
M. Herlevsen, G. Oxford, C. R. Owens, M. Conaway, and D. Theodorescu
Depletion of major vault protein increases doxorubicin sensitivity and nuclear accumulation and disrupts its sequestration in lysosomes
Mol. Cancer Ther., June 1, 2007; 6(6): 1804 - 1813.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
Y. Lindsay, D. McCoull, L. Davidson, N. R. Leslie, A. Fairservice, A. Gray, J. Lucocq, and C. P. Downes
Localization of agonist-sensitive PtdIns(3,4,5)P3 reveals a nuclear pool that is insensitive to PTEN expression
J. Cell Sci., December 15, 2006; 119(24): 5160 - 5168.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Minaguchi, K. A. Waite, and C. Eng
Nuclear Localization of PTEN Is Regulated by Ca2+ through a Tyrosil Phosphorylation-Independent Conformational Modification in Major Vault Protein
Cancer Res., December 15, 2006; 66(24): 11677 - 11682.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Okumura, M. Mendoza, R. M. Bachoo, R. A. DePinho, W. K. Cavenee, and F. B. Furnari
PCAF Modulates PTEN Activity
J. Biol. Chem., September 8, 2006; 281(36): 26562 - 26568.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J.-H. Chung, M. C. Ostrowski, T. Romigh, T. Minaguchi, K. A. Waite, and C. Eng
The ERK1/2 pathway modulates nuclear PTEN-mediated cell cycle arrest by cyclin D1 transcriptional regulation
Hum. Mol. Genet., September 1, 2006; 15(17): 2553 - 2559.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
A. Gil, A. Andres-Pons, E. Fernandez, M. Valiente, J. Torres, J. Cervera, and R. Pulido
Nuclear Localization of PTEN by a Ran-dependent Mechanism Enhances Apoptosis: Involvement of an N-Terminal Nuclear Localization Domain and Multiple Nuclear Exclusion Motifs
Mol. Biol. Cell, September 1, 2006; 17(9): 4002 - 4013.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
S. Agrawal and C. Eng
Differential expression of novel naturally occurring splice variants of PTEN and their functional consequences in Cowden syndrome and sporadic breast cancer
Hum. Mol. Genet., March 1, 2006; 15(5): 777 - 787.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J.-H. Chung and C. Eng
Nuclear-Cytoplasmic Partitioning of Phosphatase and Tensin Homologue Deleted on Chromosome 10 (PTEN) Differentially Regulates the Cell Cycle and Apoptosis
Cancer Res., September 15, 2005; 65(18): 8096 - 8100.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
S. Agrawal, R. Pilarski, and C. Eng
Different splicing defects lead to differential effects downstream of the lipid and protein phosphatase activities of PTEN
Hum. Mol. Genet., August 15, 2005; 14(16): 2459 - 2468.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chung, J.-H.
Right arrow Articles by Eng, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chung, J.-H.
Right arrow Articles by Eng, C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online