Cancer Research Prevention Award  Metabolism
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pós, Z.
Right arrow Articles by Hegyesi, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pós, Z.
Right arrow Articles by Hegyesi, H.
[Cancer Research 65, 4458-4466, May 15, 2005]
© 2005 American Association for Cancer Research


Immunology

Phenotypic Profiling of Engineered Mouse Melanomas with Manipulated Histamine Production Identifies Histamine H2 Receptor and Rho-C as Histamine-Regulated Melanoma Progression Markers

Zoltán Pós1, Géza Sáfrány2, Kerstin Müller4, Sára Tóth3, András Falus1,3 and Hargita Hegyesi3

1 Hungarian Academy of Sciences, Semmelweis University Molecular Immunology Research Group, 2 National Research Institute for Radiobiology and Radiohygiene, 3 Department of Genetics, Cell, and Immunobiology, Semmelweis University, Budapest, Hungary; and 4 German Armed Forces, Institute of Radiobiology, Munich, Germany

Requests for reprints: András Falus, Department of Genetics, Cell, and Immunobiology, Semmelweis University, Nagyvárad tér 4, H-1089 Budapest, Hungary. Phone: 36-1-210-2929; Fax: 36-1-303-6968; E-mail: faland{at}dgci.sote.hu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the present study, the impact of acquired neoplastic L-histidine decarboxylase (HDC) expression, and its direct consequence, the release of histamine in the tumor environment, was assessed on melanoma tumor progression. B16-F10 mouse melanoma cells were manipulated via stable transfection, and nine novel transgenic variants were generated in triplicates, constitutively expressing the full-length sense mouse HDC mRNA, a mock control, and an antisense HDC RNA segment, respectively. Establishing both primary skin tumors and lung metastases in C57BL/6 mice, the nine variants with different histamine-releasing capacities were subjected to a comprehensive comparative progression profiling in vivo. Our analyses showed trends of markedly accelerated tumor growth (P < 0.001), and moderately increased metastatic colony-forming potential (P = 0.010) along with rising levels of local histamine production. Using RNase protection assay for screening of the melanoma progression profile, and Western blotting for subsequent result validation, we looked for molecular progression markers affected by melanoma histamine secretion. Investigation of 21 functionally clustered markers associated with tumor proliferation, angiogenesis, invasivity, metastasis formation, local or systemic immunomodulation, and histamine signaling revealed positive correlations between histamine production, tumor histamine H2 receptor and rho-C expression (P < 0.001, P = 0.002, respectively). These observations confirm the involvement of histamine in the molecular machinery of melanoma progression.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Malignant melanoma is a life-threatening skin neoplasm characterized by rapid progression, poor prognosis, and continuously growing incidence in the world. Given the severity of the public health problem represented by melanoma, and the fact that an efficient therapeutic approach against advanced-stage melanomas is still lacking, during the last decades, a huge amount of research has been done on the molecular mechanisms underlying melanoma progression. This study focuses on the functional consequences of the endogenous histamine production of melanoma tumors (1).

There is a large body of experimental evidence indicating the existence of massive up-regulation of L-histidine decarboxylase (HDC) activity along with the increase of several tumors such as colon (2) and pancreatic carcinomas (3), gastric (4) and breast cancers (5), and melanoma (6, 7). HDC is the only enzyme responsible for the biosynthesis of the allergic mediator, histamine (8). Interestingly, histamine is not only produced by melanoma cells, but secreted into their environment as well (7). Furthermore, there is a broad spectrum of histamine receptors present on melanoma cells (histamine H1, H2, H3 receptors; refs. 911); however, the actual impact of histamine-controlled signaling loops on melanoma progression is not yet fully understood. Although histamine-mediated signals have been shown to be implicated in tumor growth (1217), local (1820), and systemic immunomodulation (21), a detailed unifying concept explaining the actual importance of this phenomenon is still unavailable. Finally, it should be noted that enhanced histidine catabolism in tumors is not a unique phenomenon, in as much as similar perturbations in the metabolism of several amino acids, such as massive degradation of tryptophan by the indoleamine 2,3-dioxygenase (22), or enhanced hydrolysis of arginine by arginase (23), have already been associated with the process of tumor progression.

In this study, using an in vivo approach, an attempt was made to identify the aspects of melanoma progression influenced by histamine. Mammalian expression vector systems coding for either the full-length HDC sense mRNA sequence, a mock sequence, or an antisense HDC mRNA segment, were introduced in the mouse melanoma cell line B16-F10, thus generating three types of melanoma cells with up-regulated, unmodified, and down-regulated histamine production, respectively. In order to avoid potential bias caused by random genomic insertion, all transfection procedures were done in triplicates, and nine B16-F10 variants were introduced in the experimental phase of the study. The nine variants were grafted in syngeneic C57BL/6 mice, and the progression profile of the arising tumors was compared both by traditional methods examining primary tumor growth rate or simulated metastatic lung colonization, and by techniques allowing the description of the molecular background of emerging phenotypical differences. To search the mRNA level progression profile in order to find melanoma progression markers affected by the manipulation of histamine secretion, three novel RNase protection assay (RPA) template sets were constructed measuring the expression levels of 21 well-known, or recently proposed markers coupled with different areas of tumor progression. Finally, initial conclusions drawn from mRNA level progression profiling were validated at the protein level via Western blotting.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals. Eight- to 12-week-old specific pathogen-free female C57BL/6 mice were purchased from the National Institutes of Oncology (Budapest, Hungary), and kept in our animal health care facility with food and water available ad libitum.

Cell culture. B16-F10 cells (American Type Culture Collection, Manassas, VA) were cultured in high-glucose DMEM, in the presence of 2% glutamine, 10% FCS, and 160 µg/mL gentamicin in a humidified 5% CO2 atmosphere at 37°C.

Generation of B16-F10 variants with different capacities of histamine secretion. Templates for forced expression of the full-length sense murine HDC open reading frame (1,989 bp), and a partial antisense HDC segment (1,004 bp) were generated by high-fidelity PCR amplification of a plasmid construct encoding the full-length mouse HDC cDNA (kind gift from Takehiko Watanabe, Sendai, Tokyo, Japan), using appropriate linker primers (sense HDC template forward primer, GTTCGAGGTCTCACATGATGGAGCCCTGTGAATACC; reverse primer, ATATTTGGCGCGCCCTCTACACCATGGCCTCCAG; antisense HDC template forward primer, GGAGCTGGTCTCACATGTCAGCTTTTTGAAGGCACCT; reverse primer, ATTAGGCGCGCCCATCGAGTACGCTGACTCCT). Amplicons were double-digested with BsaI and AscI (New England Biolabs, Beverly, MA), and incorporated in pTriEx 1.1 Hygro expression vectors (Novagen, San Diego, CA). JM109 E. coli cells (Promega, Madison, WI) were transformed with the constructs, and PCR-screened clones were subjected to LPS-free plasmid isolation using an UltraMobius 1000 Plasmid kit (Novagen). B16-F10 mouse melanoma cells were transfected using the GeneJuice transfection reagent (Novagen) according to the manufacturer's instructions. Designated B16-F10 HDC-A1, -A2, -A3, B10-F10 HDC-M1, -M2, -M3, and B10-F10 HDC-S1, -S2, -S3: nine different novel B16-F10 variants, expressing the partial antisense HDC segment, the unmodified vector sequence (mock), or the full-length HDC sense open reading frame, respectively, were generated by 4 weeks of hygromycin B (Calbiochem, La Jolla, CA) selection (1 week at 200 µg/mL, and 3 weeks at 400 µg/mL).

Primary skin tumor model. Stably transfected B16-F10 cells (2 x 105) were cultured for 1 week in the absence of hygromycin B, collected in a volume of 50 µL PBS per animal, and injected s.c. in the shaved backs of C57BL/6 mice using Hamilton LT 710 syringes (Hamilton, Bonaduz, Switzerland). At 6, 8, 11 (in one experiment, 10), 13, and 15 days after graft implantation, the longest and shortest radius (a and b, respectively) of the tumors was determined with a microcaliper, and tumor size was calculated assuming ellipsoidal tumor growth (4/3 ab2 {Pi}-formula). Three independent experiments were carried out comparing one HDC antisense-, mock-, and HDC sense-transfected B16-F10 variant in each, using animals in groups of 8 to 10. At 15 days after grafting, all mice were sacrificed, tumors and selected peripheral lymph nodes (inguinal, axillary, and brachial) were excised and frozen at –80°C for subsequent RPA studies (in two grafting experiments), or at –20°C for Western blotting (in one experiment).

Metastatic lung colonization model. C57BL/6 mice were inoculated with 2 x 105 transfected B16-F10 cells per mouse, as described above, in the tail vein of the animals. At 14 days after inoculation, mice were sacrificed, necropsied, and the lungs were analyzed counting the metastatic colonies under a dissection microscope. Three independent experiments were carried out comparing one HDC antisense-, mock-, and HDC sense-transfected B16-F10 variant in each, investigating mice in groups of 8 to 10.

Construction of RNase protection assay template sets. RPA template sets were generated as described elsewhere (24). Briefly, templates for in vitro transcription of RPA-probes were generated from 1 µg of total RNA, derived from appropriate tissue samples, via RT-PCR-based extension of template-specific primers (Supplemental Materials). Amplified templates were ligated in pGEM T vectors (Promega), and the constructs were transformed into JM 109 E. coli cells (Promega). Clones harboring inserts in antisense template orientation were identified by PCR, and the chosen constructs were re-isolated with a Qiagen Plasmid Midi Kit (Qiagen, Chatsworth, CA).

RNA isolation. Total RNA isolation was carried out using the guanidinium thiocyanate-phenol-chloroform extraction method, as described (25). RNA yield was determined by spectrophotometry.

L-Histidine decarboxylase semiquantitative reverse transcription PCR. One microgram of total RNA isolated from stably transfected B16-F10 cells was reverse-transcribed using random 6-mer primers (Promega) and the Reverse Transcription system (Promega). cDNA aliquots were then amplified by Taq DNA polymerase (Promega) and mouse HDC- or glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-specific primers (HDC forward primer, CAGTACCTGAGCACTGTGCG; HDC reverse primer, CCAGCATGTCTCCTAGCAGG; GAPDH forward primer, ACCACAGTCCATGCCATCAC; GAPDH reverse primer, TCCACCACCCTGTTGCTGTA), using the following thermal program: 95°C 5 minutes, 95°C 30 seconds, 55°C 30 seconds, 72°C 1 minute-cycling, 72°C 5 minutes, for 35 and 25 PCR cycles, respectively. PCR products were visualized on agarose gels by ethidium bromide staining.

L-Histidine decarboxylase real-time PCR. cDNA templates for HDC real-time PCR were prepared and introduced in PCR reactions as described above. A mouse HDC-specific TaqMan probe set, designed to amplify mouse HDC cDNA, but not the expressed antisense HDC segments, was constructed with the help of Primer Express 2.0 software (Applied Biosystems, Foster City, CA). HDC forward primer, TCTGTGCAACGTTAGGGACTACTG; HDC reverse primer, AAAGGCCGTGCCTGCATA; 5' 6FAM-labeled MGB TaqMan probe CCATCTGTGCCAGTGAG; amplification protocol, 95°C 10 minutes, 95°C 15 seconds, 60°C 1 minute-cycling, 40 cycles. A mouse GAPDH-specific TaqMan probe set was obtained from Applied Biosystems via the "Assays on Demand" service. Real-time primer extension was done on an AbiPrism 7000 thermal cycler (Applied Biosystems). Normalized HDC signal levels were calculated using the comparative Ct ({Delta}{Delta}CT) method, and expressed in percentages of the respective GAPDH housekeeping level.

RNase protection assay. RPAs were carried out on isolated RNA samples as described earlier (24). Briefly, RPA template sets were linearized with SalI (Promega), and used to synthesize 33P-labeled RPA probes by the RiboQuant In vitro transcription kit (BD PharMingen, San Diego, CA) in the presence of 300 mCi [{alpha}-33P]UTP (Institute of Isotopes, Budapest, Hungary). RPA was carried out on 10 µg of total RNA per tissue sample using RiboQuant RPA kits (BD PharMingen). Specific signals were detected by BAS-MS 2340 Imaging plates (Fuji, Nakanuma, Japan) and a FLA-3000 phosphoimager (Fuji). Signal evaluation was done by the Aida software (Raytest, Straubenhardt, Germany), mRNA expression levels were calculated as the relative percentage values of the L32 housekeeping gene expression.

Protein isolation. For protein isolation, tissue samples were lysed in a buffer containing 10 mmol/L Tris-HCl (pH 8.0), 10 mg/mL leupeptin, 0.5 mmol/L EGTA, 2% NaF, 1% Triton X-100, 25 mmol/L PMSF and 2% Na-orthovanadate. Cellular debris was removed by centrifugation, supernatants were collected, and the yield was determined by spectrophotometry.

Western blotting. For Western blotting, 10 µg heat-denatured, ß-mercaptoethanol-treated protein samples were loaded on denaturing SDS-PAGE gels. After blotting to a polyvinylidene difluoride membrane (Bio-Rad, Richmond, CA), blots were probed with primary rabbit anti-rat histamine H2 receptor (1:2,000, Alpha Diagnostic International, San Antonio, TX), rabbit anti-human rho-A-B-C (1:400, Sigma-Aldrich, St. Louis, MO), goat anti-mouse matrix metalloproteinase-2 (MMP-2; 1:200, R&D Systems, Minneapolis, MN), or rat anti-yeast {alpha}-tubulin (1:4,000, Serotec, Kidlington, United Kingdom) antibodies, as stated. Then, secondary goat anti-rabbit IgG-horseradish peroxidase (1:2,500, Promega), rabbit anti-goat IgG-HRP (1:40,000, Sigma-Aldrich), or rabbit-anti rat IgG{kappa} and {lambda} chain-HRP (1:10,000, Sigma-Aldrich) antibodies were applied, as appropriate. Relative protein expression levels were calculated based on X-ray film densitometry data (ChemiImager 5500 software, Alpha Innotech), after normalization with the respective housekeeping {alpha}-tubulin signals, and expressed in percentages of the mean of the control group.

Histamine ELISA. Hygromycin B-selected, stably transfected B16-F10 cells (5 x 105), were seeded on 25 cm2 tissue culture flasks and cultured for 72 hours (~80-90% confluency). Thereafter, 2 x 106 cells, and 1 mL cell-free culture supernatant were harvested. Cells were washed in PBS, treated with 200 µL 5% trichloroacetic acid solution, centrifuged, and the debris-free cell lysates were neutralized with an equivalent volume of 0.3 mol/L NaOH solution. Finally, both cell lysates and culture supernatants were subjected to a histamine ELISA (Immunotech, Westbrook, ME) following the manufacturer's instructions.

Statistics. Statistical analyses were done using the SigmaStat software package (SPSS, Inc., Chicago, IL). One-way ANOVA, Kruskal-Wallis one-way ANOVA on ranks, two-way ANOVA, and two-way repeated measures ANOVA were used as stated, together with Tukey's all pairwise multiple comparison as post hoc test. Unless otherwise stated, all materials were purchased from Sigma-Aldrich.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Altered levels of L-histidine decarboxylase gene expression and histamine production in stably transfected B16-F10 variants. Like other melanoma cell lines, mock-transfected B16-F10 was found to express HDC and to secrete histamine per se under in vitro conditions. Sense HDC-transfected B16-F10 variants (HDC-S1, -S2, and -S3) exhibited markedly elevated levels of HDC mRNA in comparison with their mock-transfected counterparts (B16-F10 HDC-M1, -M2, and -M3) in both semiquantitative reverse transcription PCR and real-time PCR experiments (Fig. 1A and B). On the other hand, forced expression of an antisense HDC-RNA segment in the B16-F10 HDC-A1, -A2, and -A3 variants resulted in slightly diminished HDC mRNA levels (Fig. 1A and B). Results consistent with these observations were provided by histamine ELISA, showing that levels of both intracellular histamine production and histamine secretion were successfully altered in the engineered B16-F10 cells (Fig. 1C and D).



View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Functional validation of transgenic mouse B16-F10 melanoma variants with manipulated HDC expression. Validation of nine stably transfected B16-F10 variants, constitutively expressing either a mouse antisense HDC RNA sequence (designated B16-F10 HDC-A1, -A2, and -A3), a mock vector (B16-F10 HDC-M1, -M2, and -M3), or the full-length mouse HDC mRNA (B16-F10 HDC-S1, -S2, and -S3). A, GAPDH-normalized HDC mRNA levels of stably transfected B16-F10 variants, measured by HDC semiquantitative reverse transcription PCR. B, GAPDH-normalized HDC mRNA levels measured by HDC real-time PCR. C and D, intracellular histamine content (C) and amounts of secreted histamine (D) produced by each B16-F10 variant, measured by histamine ELISA.

 
Markedly enhanced in vivo tumor growth rate and moderately elevated metastatic lung colonization potential of B16-F10 variants with higher levels of tumor histamine secretion. Primary skin tumor growth rate was analyzed by grafting the developed nine B16-F10 variants into the skin of syngeneic C57BL/6 mice. Significant and reproducible correlation was found between levels of neoplastic histamine secretion and tumor growth in three independent experiments (P < 0.001, P < 0.001, and P < 0.001; two-way repeated measures ANOVA). In comparison with mock-transfected cells, sense HDC-transfected B16-F10 variants with up-regulated histamine secretion exhibited increased tumor growth rate in all experiments (P = 0.002, P = 0.011, and P < 0.001; Tukey's test). In contrast, no significant difference was found between melanoma variants harboring antisense HDC expression vector constructs and mock vectors (Fig. 2A-C).



View larger version (26K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Comparison of the tumor growth rate, and the metastatic lung colonization potential of transgenic B16-F10 variants with manipulated histamine secretion. A, B, and C, growth rates of transfected B16-F10 melanoma syngrafts in the skin of C57BL/6 mice, in three independent experiments. (Shaded asterisks) time points at which significant difference was found between B16-F10 S and B16-F10 M variants, (open asterisks) the same between B16-F10 S and B16-F10 A variants (Tukey's test done after two-way ANOVA). No significant difference was found between B16-F10 A and B16-F10 M variants in any experiments, and time points investigated (*, P < 0.05; **, P < 0.01; ***, P < 0.001). D, summarized results of three independent experiments comparing the metastasic lung colonization potential of the above B16-F10 variants. Asterisks, significant differences between the investigated groups, as above (two-way ANOVA, and Tukey's test: *, P < 0.05).

 
Moreover, neoplastic histamine secretion was found to have some limited impact on the experimental metastatic lung colonization as well. Although antisense HDC-transfected B16-F10 cells exhibited diminished metastatic colony formation in all individual experiments, no reproducible trends emerged between the mock- and sense HDC-transfected groups. Furthermore, because of the broad overlaps between all three groups, statistical analysis of the three individual experiments did not reveal consistently significant differences between them (P = 0.045, P = 0.400, and P = 0.112; Kruskal-Wallis one-way ANOVA on ranks, data not shown). However, a metaanalysis of all three independent studies identified a moderate histamine-mediated effect (P = 0.010; two-way ANOVA, Fig. 2D). According to this, melanoma grafts with antisense RNA-suppressed histamine secretion exhibit moderately diminished metastatic lung colony formation potential in comparison with mock-transfected cells (P = 0.037; Tukey's test, Fig. 2D). However, there was no significant difference between mock-transfected B16-F10 melanomas and their sense HDC-transfected counterparts.

RNA level tumor progression profiling of engineered B16-F10 melanoma grafts with different levels of histamine production. Three novel RPA template sets were constructed in order to identify melanoma progression markers related to changes in the local histamine levels, and thus possibly being affected by histamine-mediated signals. Two sets, designated ME-1 and -2, covering the progression marker profile of established primary melanoma tumors in the skin, were applied to analyze skin samples derived from tumor-grafted C57BL/6 mice. Markers associated with malignant proliferation [proliferating cell nuclear antigen (PCNA), Ki-67], angiogenesis [vascular endothelial growth factor-A (VEGF-A), basic fibroblast growth factor (bFGF), CD31, and VEGF-C], invasive matrix remodeling [MMP-2, cathepsin-B, urokinase-type plasminogen activator (uPA)], motility (rho-C), metastatic potential (MMP-2, rho-C), antigen-presenting cell (APC) maturation (B7-2), cytotoxic T cell infiltration (CD8ß), and immune activation [interleukin (IL)-2 and IL-2R{alpha}] were investigated, besides markers for histamine signaling [HDC, histamine H1 receptor (H1R), H2 receptor (H2R)] in the local tumor environment (see Supplemental Material for details). The third RPA template set, ME-3, was used in a simultaneous screen of lymph node samples isolated from the same animals in order to find evidence for a possible peripheral immunomodulation caused by melanoma histamine secretion. Markers known, or recently proposed to be coupled with mature APC immigration (B7-2), efficient antigen presentation (CD40L), clonal expansion of successfully activated T cells (IL-2 and IL-2R{alpha}), support for Th1-type helper T cell commitment (LIGHT), support for effector T cell maturation and emigration (OX40L), APC licensing for Th-independent cytotoxic T cell activation (CD40L and 4-1BBL), and cytotoxic T cell expansion (CD8ß) were investigated in the peripheral lymph nodes of the tumor-bearing animals (see Online Supplemental Material). In both approaches, respective samples, isolated from untreated healthy animals, served as controls. After cloning of the three RPA-template sets (Fig. 3A), a series of pilot RPA experiments was carried out, which showed the ability of the chosen approach to efficiently scan and semiquantitatively evaluate the expression patterns of up to 10 mRNA markers simultaneously in about 20 different samples (Fig. 3B). Subsequently, a comprehensive RPA-based progression marker-profiling was conducted on the collected skin and lymph node samples. The RPA system could detect and measure 17 out of the 21 chosen melanoma progression markers (Table 1). Judged by two-way ANOVA, the detected markers were assigned to different functional groups according to their expression patterns observed in two independent grafting experiments (Table 1; Fig. 4).



View larger version (31K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Functional verification of a novel RPA template set. A, 10 freshly cloned, marker-specific RPA-templates composing the ME-3 RPA template set. B, the ME-3 template set is shown in a representative RPA experiment, by screening and evaluating the mRNA level gene expression patterns of the 10 targeted markers in 20 tissue samples, simultaneously. Markers in parentheses are typical examples for data, which were excluded from the result evaluation process because of their borderline expression level.

 

View this table:
[in this window]
[in a new window]

 
Table 1. Summarized results of the RPA-based molecular tumor progression profiling of stably transfected B16-F10 melanomas with manipulated histamine production

 


View larger version (39K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. RPA-based molecular tumor progression profiling of stably transfected B16-F10 experimental mouse melanomas with different levels of histamine secretion. A, B, and C, RNA level gene expression patterns of three selected melanoma progression markers, which were found to be affected by tumor progression only: MMP-2, VEGF-A, and LIGHT, respectively. D, E, and F, the RNA patterns of three markers, which were found to be affected by the transgenic manipulation of tumor HDC levels: HDC, H2R, and rho-C, respectively. Asterisks, the groups between which significant difference was found (two-way ANOVA and Tukey's test: *, P < 0.05; **, P < 0.01; ***, P < 0.001).

 
Besides HDC itself, the target of the transgenic manipulation (P < 0.001; two-way ANOVA), only two markers were reproducibly and dose-dependently affected by the transgenic modulation of the tumor HDC gene expression. Both of them showed positive correlation with melanoma histamine production, and both exhibited highly significant differences between the investigated experimental groups: histamine H2 receptor and rho-C (P = 0.006 and P < 0.001, respectively; two-way ANOVA).

Histamine H2 receptor mRNA was detected at the highest levels in sense HDC-transfected B16-F10 tumors with up-regulated histamine production, followed by moderate H2 receptor gene activity in mock-transfected melanomas, and significantly diminished H2R-signals in antisense HDC-transfected melanomas (P = 0.016; Tukey's test, Fig. 4E). Second, B16-F10 tumors with suppressed histamine production exhibited a significantly decreased rho-C gene activity as opposed to tumors with unmodified or up-regulated histamine secretion (P = 0.013 and P = 0.020, respectively; Tukey's test, Fig. 4F). Although the mean rho-C level was somewhat higher in tumors with high-level histamine production, this latter difference was not significant.

Protein level validation of histamine-affected B16-F10 melanoma progression markers. Histamine H2 receptor protein was detected at 60 kDa, and was found to be expressed in practically all investigated samples, including the control skin (Fig. 5A). In accordance with the results of RPA studies, significant differences were found between the groups investigated (P < 0.001, one-way ANOVA). There were only low H2R levels present both in healthy control skin samples and antisense HDC-transfected tumors, whereas a significant up-regulation was detected in mock-transfected tumors (P < 0.001, Tukey's test), followed by a further increase of the H2R protein amounts in the sense HDC-transfected B16-F10 melanomas (P = 0.022, Tukey's test; Fig. 5B). After all, there was a clear positive correlation between melanoma histamine production and histamine H2 receptor expression.



View larger version (51K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Protein level validation of histamine-affected melanoma progression markers. Protein level validation of two suspected histamine-affected melanoma progression markers (histamine H2 receptor and rho), and a third marker serving as an additional methodical control (MMP-2) is shown. A, protein banding patterns detected in Western blotting experiments. B, the {alpha}-tubulin-normalized expression levels of the H2R and rho proteins, which were found to be significantly affected by melanoma histamine secretion (statistics by one-way ANOVA, and Tukey's test). Asterisks, the groups between which significant difference was found. (*, P < 0.05; **, P < 0.01; ***, P < 0.001).

 
With respect to the rho protein levels, rho-A, -B, -C-specific antibodies identified the three closely related rho-isoforms as double bands at 27 and 24 kDa (Fig. 5A). Rho was found to remain almost undetectable in the healthy skin, but was strongly expressed in all analyzed tumor samples (P < 0.001, one-way ANOVA). In agreement with the RPA data, marked differences were observed between the different tumor groups, as both mock- and sense HDC-transfected tumors exhibited significantly higher levels of rho than antisense HDC RNA-treated B16-F10 melanomas did (P = 0.016 and P = 0.002, respectively, Tukey's test; Fig. 5B). Although in a similar trend, sense HDC-transfected tumors expressed slightly higher rho levels than their mock-transfected counterparts, this latter difference was found to be completely insignificant.

Finally, a third additional marker (MMP-2), was included in the protein level validation phase, as well. MMP-2 served as a methodologic control assessing the limits of our screening strategy, which actually extrapolated the RNA level results to the protein level. In fact, MMP-2 protein levels could not match the respective mRNA levels. Although both the inactive 74 kDa proenzyme form and the processed active 65 kDa MMP-2 could be detected by Western blotting, there was an apparent discrepancy between RNA (Fig. 4A) and protein level MMP-2 results (Fig. 5A). MMP-2 proteins were almost evenly expressed in the different samples, and no significant difference emerged between any of the investigated groups regardless of whether total, or only the newly synthesized proenzyme MMP-2 protein expression patterns, were matched against each other (P = 0.360 and P = 0.312, respectively, one-way ANOVA; (Fig. 5), detailed results not shown).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This study was inspired by the recent recognition of the complicated interplay, and the numerous regulatory circuits shared between sustained inflammatory processes, and several steps of tumor progression (26). As melanoma tumors are known to overexpress HDC, thereby releasing large amounts of histamine, an inflammatory mediator in their microenvironment, the clarification of the consequences of this phenomenon is of imperative importance. Although in previous in vitro studies, we and others have repeatedly suggested a possible involvement of neoplastic histamine secretion in melanoma tumor progression (15, 2729), there were only sparse in vivo data available, providing rather indirect evidence for this concept (30).

Using a murine in vivo tumor model system, we were able to show that the neoplastic acquisition of autonomously regulated histamine production might be a significant benefit for progressing melanomas. We were able to show that histamine-mediated signals confer accelerated growth and moderately enhanced metastatic colonization capacity to experimental murine melanoma tumors. In order to identify the molecular events behind these complex phenotypic changes, the melanoma progression profile complex was dissected, and the individual aspects of melanoma progression, such as proliferation, invasivity, angiogenesis, etc., were replaced with molecular progression marker clusters. Two progression factors, histamine H2 receptor, and rho(-C) were found to be significantly, reproducibly, and dose-dependently affected by neoplastic histamine production both at the mRNA and the protein level.

H2R represents a histamine receptor frequently expressed by melanoma cells, which has been repeatedly suggested to support the autonomous growth of several malignancies (1315, 17). Our data show that melanoma histamine secretion enhances the availability of H2Rs in the tumor mass, thus, theoretically further fostering its own growth-supporting effect. This in accordance with the correlation between the effects of melanoma histamine secretion exerted on tumor growth, and on H2 receptor expression. These observations give further support for the long-believed existence of histamine-controlled, H2R-mediated autocrine signaling circuits favoring the process of melanoma progression (7, 31). However, the conclusion that enhanced accessibility of H2Rs on melanoma cells can be the sole explanation for the enhanced melanoma growth, might be oversimplified and misleading. This is because there is a remarkable synergism between the suggested consequences of the up-regulation of H2Rs displayed by melanoma cells, and the effects of the up-regulation of H2Rs present on activated leukocytes, which typically infiltrate developing melanoma tumors. It is well accepted that both H2R-activation on several leukocytes (20, 32), and massive histamine releases in dermal environments (33), could cause heavy shifts in immune signaling networks. According to these data, such histamine-mediated signals are able to easily corrupt, or even abrogate an ongoing antitumoral immune response by causing either Th2-type immunomodulation, or a systemic immunosuppression. Obviously, massive H2R activation in this specific environment is able to suppress the Th1-cell mobilizing, inflammatory danger-signal effects of histamine, which might be associated rather with H1R-activation (32). Hence, histamine-mediated signals most likely support melanoma growth both via an autocrine manner, and by suppressing the immigrating leukocytes, contributing to the widely known poor immunogenicity of melanoma tumors as well.

The second histamine-affected melanoma progression marker, rho-C, represents a member of a wider family of monomeric G proteins. The rho family consists of three closely related members with exceptionally high levels of sequence conservation, and with highly similar functions (rho-A, -B, -C). Rho proteins are able to induce the remodeling of the actin cytoskeleton, which is a basic requirement of cellular motility (34), and elevated levels of rho-C activity are strongly associated with melanoma metastasis formation (35). We found a positive correlation between melanoma histamine production and rho-C mRNA or rho protein expression levels. Actually, the trends of rho(-C) expression clearly followed the trends of the metastatic colony formation potential of the same cells, measured by the experimental lung colonization assay. This is not only in complete accordance with the abovementioned literature data, but a strong proof for the reliability of the gene expression profiling results as well. Our data show that melanoma histamine secretion is possibly required for efficient lung colonization, as targeted suppression of the histamine biosynthesis in circulating melanoma cells seems to interfere with this process. However, histamine signals originating from metastatic melanoma cells in the circulation could also affect rho protein expression in another relevant context. One of the key steps of metastatic colonization is the extravasation of tumor cells from the circulation, which requires enhanced permeability of the capillary walls, and so the tumor-induced mobilization of the capillary endothelial cells. Rho proteins are deeply involved in the induction and control of endothelial motility, and interestingly, literature data suggest that histamine affects endothelial motility by activating rho-dependent signaling pathways (36).

In summary, our results suggest that histamine represents an important component of the molecular machinery inducing and directing melanoma progression, and that distinct molecular pathways can be coupled to the complex phenotypic changes induced by histamine signaling on developing melanoma tumors. However, further studies are obviously still required to narrow down the large sphere of potentially relevant targets of histamine action during the progression of malignant melanoma.


    Acknowledgments
 
Grant support: Hungarian Medical Research Council grant ETT no. 241/2001 (to Z. Pós, A. Falus, and H. Hegyesi).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Takehiko Watanabe for his kind help and plasmid construct encoding the full-length mouse HDC cDNA; Krisztina Kovács and Anna Földes (Institute of Experimental Medicine, Budapest, Hungary) for making an FLA-3000 Phosphoimager available for this project; and finally, Zoltán Wiener (Semmelweis University, Budapest, Hungary) for his useful comments made on the design of appropriate transfection controls.


    Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

Received 1/ 4/05. Revised 2/17/05. Accepted 3/ 9/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Falus A, Hegyesi H, Lazar-Molnar E, Pos Z, Laszlo V, Darvas Z. Paracrine and autocrine interactions in melanoma: histamine is a relevant player in local regulation. Trends Immunol 2001;22:648–52.[Medline]
  2. Garcia-Caballero M, Neugebauer E, Campos R, Nunez dC I, Vara-Thorbeck C. Increased histidine decarboxylase (HDC) activity in human colorectal cancer: results of a study on ten patients. Agents Actions 1988;23:357–60.[CrossRef][Medline]
  3. Tanimoto A, Matsuki Y, Tomita T, Sasaguri T, Shimajiri S, Sasaguri Y. Histidine decarboxylase expression in pancreatic endocrine cells and related tumors. Pathol Int 2004;54:408–12.[CrossRef][Medline]
  4. Kolby L, Wangberg B, Ahlman H, et al. Histidine decarboxylase expression and histamine metabolism in gastric oxyntic mucosa during hypergastrinemia and carcinoid tumor formation. Endocrinology 1996;137:4435–42.[Abstract]
  5. Garcia-Caballero M, Neugebauer E, Rodriguez F, Nunez dC I, Vara-Thorbeck C. Histamine synthesis and content in benign and malignant breast tumours. Its effects on other host tissues. Surg Oncol 1994;3:167–73.[CrossRef][Medline]
  6. Haak-Frendscho M, Darvas Z, Hegyesi H, et al. Histidine decarboxylase expression in human melanoma. J Invest Dermatol 2000;115:345–52.[CrossRef][Medline]
  7. Darvas Z, Sakurai E, Schwelberger HG, et al. Autonomous histamine metabolism in human melanoma cells. Melanoma Res 2003;13:239–46.[Medline]
  8. Ohtsu H, Tanaka S, Terui T, et al. Mice lacking histidine decarboxylase exhibit abnormal mast cells. FEBS Lett 2001;502:53–6.[CrossRef][Medline]
  9. Le Gros G, Zhang XM, Parsons PG. Alteration of tyrosinase activity in human melanocytes and melanoma cells by histamine H2 and H3 ligands. Melanoma Res 1994;4:359–64.[Medline]
  10. McEwan MT, Parsons PG. Regulation of tyrosinase expression and activity in human melanoma cells via histamine receptors. J Invest Dermatol 1991;97:868–73.[Medline]
  11. Whitehead RJ, Taylor DJ, Evanson JM, Hart IR, Woolley DE. Demonstration of histamine H2 receptors on human melanoma cells. Biochem Biophys Res Commun 1988;151:518–23.[Medline]
  12. Bartholeyns J, Bouclier M. Involvement of histamine in growth of mouse and rat tumors: antitumoral properties of monofluoromethylhistidine, an enzyme-activated irreversible inhibitor of histidine decarboxylase. Cancer Res 1984;44:639–45.[Abstract/Free Full Text]
  13. Cricco GP, Davio CA, Martin G, et al. Histamine as an autocrine growth factor in experimental mammary carcinomas. Agents Actions 1994;43:17–20.[CrossRef][Medline]
  14. Hahm KB, Park IS, Kim HC, et al. Comparison of antiproliferative effects of 1-histamine-2 receptor antagonists, cimetidine, ranitidine, and famotidine, in gastric cancer cells. Int J Immunopharmacol 1996;18:393–9.[Medline]
  15. Reynolds JL, Akhter J, Morris DL. In vitro effect of histamine and histamine H1 and H2 receptor antagonists on cellular proliferation of human malignant melanoma cell lines. Melanoma Res 1996;6:95–9.[Medline]
  16. Ucar K. The effects of histamine H2 receptor antagonists on melanogenesis and cellular proliferation in melanoma cells in culture. Biochem Biophys Res Commun 1991;177:545–50.[CrossRef][Medline]
  17. Watson SA, Wilkinson LJ, Robertson JF, Hardcastle JD. Effect of histamine on the growth of human gastrointestinal tumours: reversal by cimetidine. Gut 1993;34:1091–6.[Abstract/Free Full Text]
  18. Adams WJ, Morris DL. Pilot study-cimetidine enhances lymphocyte infiltration of human colorectal carcinoma: results of a small randomized control trial. Cancer 1997;80:15–21.[Medline]
  19. Caron G, Delneste Y, Roelandts E, et al. Histamine induces CD86 expression and chemokine production by human immature dendritic cells. J Immunol 2001;166:6000–6.[Abstract/Free Full Text]
  20. Caron G, Delneste Y, Roelandts E, et al. Histamine polarizes human dendritic cells into Th2 cell-promoting effector dendritic cells. J Immunol 2001;167:3682–6.[Abstract/Free Full Text]
  21. Hart PH, Grimbaldeston MA, Swift GJ, Jaksic A, Noonan FP, Finlay-Jones JJ. Dermal mast cells determine susceptibility to ultraviolet B-induced systemic suppression of contact hypersensitivity responses in mice. J Exp Med 1998;187:2045–53.[Abstract/Free Full Text]
  22. Uyttenhove C, Pilotte L, Theate I, et al. Evidence for a tumoral immune resistance mechanism based on tryptophan degradation by indoleamine 2,3-dioxygenase. Nat Med 2003;9:1269–74.[CrossRef][Medline]
  23. Rodriguez PC, Quiceno DG, Zabaleta J, et al. Arginase I production in the tumor microenvironment by mature myeloid cells inhibits T-cell receptor expression and antigen-specific T-cell responses. Cancer Res 2004;64:5839–49.[Abstract/Free Full Text]
  24. Muller K, Ehlers S, Solbach W, Laskay T. Novel multi-probe RNase protection assay (RPA) sets for the detection of murine chemokine gene expression. J Immunol Methods 2001;249:155–65.[CrossRef][Medline]
  25. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162:156–9.[Medline]
  26. Romagnani P, Lasagni L, Annunziato F, Serio M, Romagnani S. CXC chemokines: the regulatory link between inflammation and angiogenesis. Trends Immunol 2004;25:201–9.[CrossRef][Medline]
  27. Hegyesi H, Somlai B, Varga VL, et al. Suppression of melanoma cell proliferation by histidine decarboxylase specific antisense oligonucleotides. J Invest Dermatol 2001;117:151–3.[CrossRef][Medline]
  28. Lazar-Molnar E, Hegyesi H, Pallinger E, et al. Inhibition of human primary melanoma cell proliferation by histamine is enhanced by interleukin-6. Eur J Clin Invest 2002;32:743–9.[CrossRef][Medline]
  29. Molnar EL, Hegyesi H, Toth S, et al. Biosynthesis of interleukin-6, an autocrine growth factor for melanoma, is regulated by melanoma-derived histamine. Semin Cancer Biol 2000;10:25–8.[Medline]
  30. Takahashi K, Tanaka S, Ichikawa A. Effect of cimetidine on intratumoral cytokine expression in an experimental tumor. Biochem Biophys Res Commun 2001;281:1113–9.[CrossRef][Medline]
  31. Molnar EL, Cricco G, Martin G, et al. Histamine as a potential autocrine regulator of melanoma. Inflamm Res 2001;50 Suppl 2:S102–3.
  32. Jutel M, Klunker S, Akdis M, et al. Histamine upregulates Th1 and downregulates Th2 responses due to different patterns of surface histamine 1 and 2 receptor expression. Int Arch Allergy Immunol 2001;124:190–2.[CrossRef][Medline]
  33. Hart PH, Grimbaldeston MA, Finlay-Jones JJ. Sunlight, immunosuppression and skin cancer: role of histamine and mast cells. Clin Exp Pharmacol Physiol 2001;28:1–8.[CrossRef][Medline]
  34. Raftopoulou M, Hall A. Cell migration: Rho GTPases lead the way. Dev Biol 2004;265:23–32.[CrossRef][Medline]
  35. Clark EA, Golub TR, Lander ES, Hynes RO. Genomic analysis of metastasis reveals an essential role for RhoC. Nature 2000;406:532–5.[CrossRef][Medline]
  36. Wojciak-Stothard B, Potempa S, Eichholtz T, Ridley AJ. Rho and Rac but not Cdc42 regulate endothelial cell permeability. J Cell Sci 2001;114:1343–55.[Abstract]



This article has been cited by other articles:


Home page
Molecular Cancer TherapeuticsHome page
S. B. Wallach-Dayan, A. M. Rubinstein, C. Hand, R. Breuer, and D. Naor
DNA vaccination with CD44 variant isoform reduces mammary tumor local growth and lung metastasis
Mol. Cancer Ther., June 1, 2008; 7(6): 1615 - 1623.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. A. Moya-Garcia, J. Ruiz-Pernia, S. Marti, F. Sanchez-Jimenez, and I. Tunon
Analysis of the Decarboxylation Step in Mammalian Histidine Decarboxylase: A COMPUTATIONAL STUDY
J. Biol. Chem., May 2, 2008; 283(18): 12393 - 12401.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Z. Pos, Z. Wiener, P. Pocza, M. Racz, S. Toth, Z. Darvas, V. Molnar, H. Hegyesi, and A. Falus
Histamine Suppresses Fibulin-5 and Insulin-like Growth Factor-II Receptor Expression in Melanoma
Cancer Res., March 15, 2008; 68(6): 1997 - 2005.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
S.-M. Jangi, M.B. Ruiz-Larrea, F. Nicolau-Galmes, N. Andollo, Y. Arroyo-Berdugo, I. Ortega-Martinez, J. L. Diaz-Perez, and M. D. Boyano
Terfenadine-induced apoptosis in human melanoma cells is mediated through Ca2+ homeostasis modulation and tyrosine kinase activity, independently of H1 histamine receptors
Carcinogenesis, March 1, 2008; 29(3): 500 - 509.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Koncz, M. Pasztoi, M. Mazan, F. Fazakas, E. Buzas, A. Falus, and G. Nagy
Nitric Oxide Mediates T Cell Cytokine Production and Signal Transduction in Histidine Decarboxylase Knockout Mice
J. Immunol., November 15, 2007; 179(10): 6613 - 6619.
[Abstract] [Full Text] [PDF]


Home page
J Biomol ScreenHome page
E. M. August, L. Patnaude, J. Hopkins, J. Studts, E. Gautschi, A. Shrutkowski, A. Kronkaitis, M. Brown, A. Kabcenell, and D. Rajotte
Development of a High-Throughput Assay to Measure Histidine Decarboxylase Activity
J Biomol Screen, October 1, 2006; 11(7): 816 - 821.
[Abstract] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pós, Z.
Right arrow Articles by Hegyesi, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pós, Z.
Right arrow Articles by Hegyesi, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online