Cancer Research Annual Meeting 2010  Genetics and Biology of Brain Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kirschner, L. S.
Right arrow Articles by Stratakis, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kirschner, L. S.
Right arrow Articles by Stratakis, C. A.
[Cancer Research 65, 4506-4514, June 1, 2005]
© 2005 American Association for Cancer Research


Priority Reports

A Mouse Model for the Carney Complex Tumor Syndrome Develops Neoplasia in Cyclic AMP–Responsive Tissues

Lawrence S. Kirschner1,2, Donna F. Kusewitt3, Ludmila Matyakhina4, William H. Towns, II2, J. Aidan Carney6, Heiner Westphal5 and Constantine A. Stratakis4

1 Human Cancer Genetics Program, 2 Division of Endocrinology, Department of Internal Medicine, and 3 Veterinary Biosciences Program, The Ohio State University, Columbus, Ohio; 4 Section on Genetics and Endocrinology and 5 Laboratory of Mammalian Genes and Development, National Institute of Child Health and Human Development, NIH, Bethesda, Maryland; and 6 Department of Laboratory Medicine and Pathology, Mayo Clinic, Rochester, Minnesota

Requests for reprints: Lawrence S. Kirschner, Human Cancer Genetics Program, The Ohio State University, TMRF 544, W 12th Ave., Columbus, OH 43210. Phone: 614-292-1190; Fax: 614-688-4006; E-mail: Kirschner-1{at}medctr.osu.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Summary
 References
 
Carney complex is an autosomal dominant neoplasia syndrome characterized by spotty skin pigmentation, myxomatosis, endocrine tumors, and schwannomas. This condition may be caused by inactivating mutations in PRKAR1A, the gene encoding the type 1A regulatory subunit of protein kinase A. To better understand the mechanism by which PRKAR1A mutations cause disease, we have developed conventional and conditional null alleles for Prkar1a in the mouse. Prkar1a+/– mice developed nonpigmented schwannomas and fibro-osseous bone lesions beginning at ~6 months of age. Although genotype-specific cardiac and adrenal lesions were not seen, benign and malignant thyroid neoplasias were observed in older mice. This spectrum of tumors overlaps that seen in Carney complex patients, confirming the validity of this mouse model. Genetic analysis indicated that allelic loss occurred in a subset of tumor cells, suggesting that complete loss of Prkar1a plays a key role in tumorigenesis. Similarly, tissue-specific ablation of Prkar1a from a subset of facial neural crest cells caused the formation of schwannomas with divergent differentiation. These observations confirm the identity of PRKAR1A as a tumor suppressor gene with specific importance to cyclic AMP–responsive tissues and suggest that these mice may be valuable tools not only for understanding endocrine tumorigenesis but also for understanding inherited predispositions for schwannoma formation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Summary
 References
 
Carney complex (Online Mendelian Inheritance in Man 160987) is a multiple endocrine neoplasia syndrome characterized by spotty skin pigmentation, cardiac and extracardiac myxomatosis, schwannomas, and endocrine tumors (1). Specific examples of the latter include multiple hypersecretory adrenal nodules (described pathologically as primary pigmented nodular adrenocortical disease), growth hormone–secreting pituitary tumors, gonadal tumors, and thyroid neoplasias. The disease is inherited as an autosomal dominant trait (2), and there are two apparent loci that cause the same clinical syndrome (reviewed in ref. 1). We and others have shown previously that Carney complex may be caused by loss of function mutations in PRKAR1A, which encodes the type 1A regulatory subunit of protein kinase A [PKA; cyclic AMP (cAMP)–dependent protein kinase; refs. 35]. Mutations in this gene are found in ~50% of affected kindreds, and sequence changes include nonsense mutations, frameshifts, and splice site alterations. Nearly all mutations described to date generate premature termination codons, and we have shown that these mutant mRNAs are degraded by the mechanism of nonsense-mediated mRNA decay (3). Functionally, loss of PRKAR1A is associated with excess PKA signaling in tumors from patients (4), although the exact mechanism by which this aberrant signaling causes tissue-specific tumorigenesis is unknown. This question is particularly intriguing because activation of PKA has been shown to promote differentiation and block proliferation in many tissue culture systems (69), and PKA agonists have recently been proposed as useful agents for chemotherapy in leukemias (10). Because of the potential for unexpected effects of such a therapy, a thorough understanding of the consequences of PKA dysregulation is therefore critical.

From a genetic viewpoint, there have been conflicting reports on the role that loss of the normal allele of PRKAR1A plays in Carney complex–associated tumorigenesis. Our work (4) has suggested that loss of heterozygosity (LOH) may be observed in a significant proportion of neoplasms, whereas other studies have not replicated this finding, particularly when studying cardiac or other myxomas (5, 11). LOH analysis and the finding of somatic mutations in sporadic thyroid and adrenal tumors support a role for complete loss of PRKAR1A in tissue-specific tumorigenesis (12, 13).

To better understand the mechanism by which PRKAR1A mutations cause disease, we have developed conventional and conditional null alleles for Prkar1a in the mouse. In this article, we report that mice heterozygous for a conventional null allele of Prkar1a (Prkar1a{Delta}2/+ mice) develop tumors in a spectrum that overlaps with those observed in Carney complex patients. We also present data aimed at determining the mechanism of tumorigenesis and show that tumor formation is recapitulated in mice with a tissue-specific knockout of the gene. These observations confirm the role of PRKAR1A as a tumor suppressor gene with specific importance to cAMP-responsive tissues, such as Schwann cells, osteoblasts, and thyrocytes, and indicate that these mice will be valuable tools for modeling human tumor predispositions that affect these tissues.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Summary
 References
 
Generation of a conditional allele for Prkar1a. To generate the Prkar1a targeting construct, a BAC clone containing the 5' end of the mouse gene was isolated from a commercially available library prepared from 129/SvJ mice (Genome Systems, St. Louis, MO). The clones were isolated using primers from exon 2 (forward primer GAACCATGGCGTCTGGCAGT and reverse primer AAGGAATGCCATGGGCCTCT). Restriction mapping and subcloning of the BAC led to the isolation of 7.3-kb HindIII fragment and an overlapping 3.7-kb XbaI fragment containing the 5' end of the gene, including the promoter, the five alternatively spliced first exons (14), and the second exon. After sequencing and restriction mapping, a 3.4-kb BamHI fragment corresponding to the promoter and the two potential first exons (exons 1a and 1b) of Prkar1a was cloned upstream of a loxP site, behind which was cloned the 3' adjacent 3.6-kb BamHI fragment, containing other potential exons 1c, 1d, 1e, and 2. The resulting fragment was joined with a second clone carrying a loxP-NEO-loxP cassette, a 2.3-kb HindIII fragment of Prkar1a intron 2, and a HSV-TK cassette. The plasmid was linearized and electroporated into the R1 line of ES cells (15). Cells were double selected with G418 (350 µg/mL) and gancyclovir (2 mmol/L), and surviving clones were characterized at the 3' end by Southern blotting with a probe outside the flanking homologous sequences (Fig. 1A). Clones that exhibited the proper-sized fragment at the 3' end were further characterized by probing with a 5' end probe to verify proper homologous gene targeting (data not shown).



View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Generation of a null allele for Prkar1a. A, scheme for the generation of an allele of Prkar1a lacking exon 2 ({Delta}2). Green arrows, exons; hatched triangles, loxP sites; NEO, PGK-NEO cassette for positive selection; TK, thymidine kinase cassette included for negative selection; striped bar labeled P, probe used for Southern blotting. Selected restriction enzyme sites are also shown (B, BamHI; V, EcoRV; H, HindIII). B, genotyping of mice by Southern blot using the probe indicated in (A; left) and genotyping of deletion mice by PCR (right). FN, flox-NEO allele; del or –, {Delta}2 allele; top, mouse genotypes. C, verification that the {Delta}2 allele is a null allele by Western blotting of Prkar1aloxP/loxP (L/L) and Prkar1a{Delta}2/{Delta}2 (–/–) mouse embryonic fibroblasts with antibodies for Prkar1a (R1A) and Prkar2a (R2A). D, confirmation of early lethality of Prkar1a null embryos before E9.5. Genotypes of the embryos are shown. Note that heterozygote embryos are phenotypically normal.

 
ES cells from two properly targeted colonies were injected into blastocysts, and six chimeras were identified, two of which transmitted the targeted flox-NEO allele (Prkar1aFN) as judged by Southern and PCR analysis of tail DNA (Fig. 1B). For subsequent genotyping, tail DNA from mice was collected and analyzed by PCR. Primers and conditions for the PCR reactions are available upon request. The Prkar1a{Delta}2 and Prkar1aloxP alleles were generated from the Prkar1aFN allele by crosses with the mosaic deletor strain EIIA-cre (16) as described in the text. For the generation of congenic mice, inbred mouse strains were obtained from Harlan (Indianapolis, IN) or The Jackson Laboratory (Bar Harbor, ME). All animal work in this study was carried out in accordance with Institutional Laboratory Animal Care and Use Committee guidelines under animal protocols 01-003 (at the NIH, Bethesda, MD) and 02-A-0097 (at The Ohio State University, Columbus, OH).

Southern and Western blotting. Genomic DNA (10 µg) was digested with EcoRV and separated on a 1% agarose gel. After transfer to nylon membranes (Genescreen Plus, Dupont-NEN, Boston, MA), samples were probed with a 32P-labeled 1.2-kb PstI fragment from the 3' end of the targeting construct. For Western blotting, proteins from cells were separated in 10% SDS-PAGE gels, transferred to nitrocellulose, and probed with monoclonal antibodies to Prkar1a or Prkar2a at dilutions recommended by the manufacturer (BD Biosciences, San Jose, CA). Western blots were developed using the Western Lightning Chemiluminescence Reagent as directed by the manufacturer (Perkin-Elmer Life Sciences, Inc., Boston, MA).

Analysis of tumors. Tissues were removed from mice, fixed in formalin, and stained with H&E. For immunohistochemical analysis, the following antibodies were used: S-100 (DAKO, Carpinteria, CA), keratin-14 (DAKO), neuron-specific enolase (NSE; DAKO), glial fibrillary acidic protein (GFAP; DAKO), and osteocalcin (Biomedical Technologies, Stoughton, MA). For S-100 and osteocalcin staining, samples were subject to antigen retrieval by steaming 20 minutes in Target Retrieval Solution (DAKO), whereas staining for the other antigens was done without antigen retrieval. All slides were developed with Vector Elite ABC reagents (Vector Laboratories, Burlingame, CA). For fluorescence in situ hybridization (FISH) analysis, tumors were snap frozen in isopentane/liquid nitrogen, and touch preps were prepared on thawed samples. FISH was done as described (17) using a mouse BAC containing the entire Prkar1a gene.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Summary
 References
 
Generation of conventional and conditional null alleles for Prkar1a. To characterize the basis for PRKAR1A-associated tumorigenesis in an animal model, we generated mice carrying a floxed copy of exon 2 of the murine Prkar1a gene. This exon, which contains the initiator ATG codon, was selected because Carney complex patients frequently show mutations affecting exon 2 (3, 4). The targeting vector (Fig. 1A) contained a total of 9.3 kb of genomic DNA isolated from a mouse BAC carrying the entire Prkar1a gene (data not shown). The mouse Prkar1a gene has been shown to use five alternative noncoding first exons, designated as exons 1a to 1e (14), all of which were in the cloned DNA fragment. The targeting construct was genetically engineered to contain a 5' loxP site between exons 1b and 1c as well as a floxed neomycin resistance cassette that was located in intron 2 after homologous recombination. Mice carrying the targeted allele (Prkar1aflox-NEO) were phenotypically normal and homozygotes exhibited no abnormalities up to 1 year of age (data not shown). However, owing to previously reported problems caused by the presence of the neomycin resistance cassette within genes (18), mice were crossed with the EIIA-cre line (16) to obtain mice carrying all possible alleles resulting from cre-mediated recombination (data not shown; ref. 19). This led to the isolation of both the deletion allele Prkar1a{Delta}2 and the cognate conditional allele Prkar1aloxP (Fig. 1B). To verify that the Prkar1a{Delta}2 was in fact a null allele, Prkar1aloxP/loxP mouse embryonic fibroblasts were prepared and treated in vitro with cre recombinase.7 After verification of the resulting Prkar1a{Delta}2/{Delta}2 genotype, proteins were Western blotted to show the complete absence of Prkar1a protein (Fig. 1C). In addition, Prkar1a{Delta}2/+ mice were intercrossed, and genotyping of the litters revealed no Prkar1a{Delta}2/{Delta}2 pups. Embryos were prepared at E9.5, and analysis of the litters showed that all Prkar1a{Delta}2/{Delta}2 embryos exhibited advanced stages of tissue breakdown (Fig. 1D), confirming that the Prkar1a{Delta}2 allele was embryonic lethal in the homozygous state. This embryonic lethality has been characterized previously in detail for a different null allele of Prkar1a (20). This observation, coupled with the in vitro data described above, indicates that the Prkar1a{Delta}2 allele is a null allele. Because of the close similarity between our homozygous null embryos and the previous report, we elected not to characterize the embryonic phenotype further but rather to focus the remainder of our efforts on analysis of the tumorigenic phenotype of the heterozygous mice.

Tumorigenesis observed in Prkar1a{Delta}2/+ mice. To determine if mice carrying Prkar1a{Delta}2 exhibited tumorigenesis in a pattern similar to human patients, mice were maintained in a pathogen-free environment without intervention. We observed the mice for up to 2 years, and information from 44 Prkar1a{Delta}2/+ mice and 22 age-matched controls is included in this report. Visible solid tumors were commonly observed in Prkar1a{Delta}2/+ mice of 8 to 12 months of age, although they were seen as early as 5 months and as late as 21.5 months (Table 1). In rare cases, the tumors had a s.c. cystic component adherent to the mass (data not shown). The most common location for these lesions was on the proximal hind limb (Fig. 2A), although they were also seen elsewhere, including the forelimb, head, and paw (Figs. 2B and 5D). For the majority of these tumors, histopathologic examination revealed that they were moderately cellular and composed of interlacing bundles of parallel spindle cells (Fig. 2C). Tumor cells exhibited modest pleiomorphism, although mitotic figures and nuclear palisading were rare. Scattered throughout the tumors were large cells containing variably sized highly eosinophilic cytoplasmic granules with an appearance consistent with hypertrophic Schwann cells (Fig. 2C). Immunohistochemical analysis (Fig. 2D-F) showed diffuse S-100 staining and patchy staining for NSE and GFAP. Based on these characteristics, these tumors were classified as schwannomas according to the recent criteria for the diagnosis of these tumors in genetically modified mice (21). Unlike patients with Carney complex, these typical schwannomas observed in the Prkar1a{Delta}2/+ mice did not exhibit melanotic pigmentation. In mice that developed tumors on the paws, the lesions had a somewhat different histopathologic appearance, but still met diagnostic criteria for schwannomas, albeit with divergent differentiation (21). This issue is discussed further below. Overall, schwannomas were observed in 33% of mice (14 of 44), making them the most frequent tumor necessitating euthanasia of the animals.


View this table:
[in this window]
[in a new window]

 
Table 1. Tumors observed in Prkar1a{Delta}2/+ mice

 


View larger version (64K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Schwannomas in Prkar1a{Delta}2/+ mice. The tumors were observed most frequently on the hind limb (A) but were also seen in other areas, including intracranially (B). C-F, microscopic and immunohistochemical findings from the tumors that are characteristic of schwannomas. C, H&E staining. Note the presence of granular cells with eosinophilic cytoplasmic granules (arrowhead) in a spindle cell background. D, diffuse strong staining of spindle cells for S-100. E, patchy staining of spindle cells for NSE. F, patchy staining of spindle cells for GFAP. G, FISH analysis showing allelic loss of the Prkar1a locus in approximately one third of cells. Red, Prkar1a BAC probe; blue, 4',6-diamidino-2-phenylindole–stained nuclei. Note the presence of multiple cells with only one signal, indicating allelic loss at this locus.

 


View larger version (124K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Comparison of schwannomas with divergent differentiation from TEC3;Prkar1aloxP/loxP and Prkar1a{Delta}2/+ mice. A-C, H&E-stained tumor from a TEC3;Prkar1aloxP/loxP mouse, showing spindle-shaped cells (A), islands of squamous epithelium embedded in the spindled cells (B), and neoplastic tubular epithelium (T) continuous with the spindle cell mass (S; C). D-F, S-100 staining of sections with similar histologic features. G and H, keratin-14 staining of spindle cells and epithelial islands (G) and neoplastic tubular cells (H). I, H&E staining of a schwannoma on the paw of a Prkar1a{Delta}2/+ mouse, showing islands of neoplastic epithelial tissue transitioning into spindle-shaped stromal cells. Staining of the same tumor for S-100 (J) and keratin-14 (K).

 
A striking feature of the Prkar1a{Delta}2/+ mice was the development of multiple tail tumors as shown in Fig. 3. These lesions first appeared at ~5 to 6 months of age. About 50% of Prkar1a{Delta}2/+ mice exhibited the lesions by 8 months, and the incidence rose to 80% at 1 year (Table 1). Radiographs of the tails (Fig. 3C) revealed radiolucent lesions, suggesting loss of normal bone. This process seemed to affect individual vertebrae and was not a field defect. Intriguingly, these lesions were observed only in the tail vertebrae of the mice and were not observed either grossly or radiographically in vertebrae proximal to the pelvis or in the long bones. Histologically (Fig. 3D), the lesions showed effacement of normal bone architecture with extensive remodeling, sometimes including expansion of the cortex. Disordered spindled cells, polygonal cells, stellate cells, and inflammatory cells embedded in abundant matrix replaced the normal bone trabeculae and filled the marrow cavity. Many of the abnormal polygonal cells associated with islands of bone stained positively for osteocalcin, identifying their osteoblastic lineage (Fig. 3D). These lesions in the Prkar1a{Delta}2/+ mice exhibit histologic similarity to osteochondromyxomas, a bony lesion that has been associated with Carney complex (22). Although lesions in patients usually occur in the nasal sinuses (in contrast to the tail tumors seen in mice), both lesions share a similar mixed pathology, including myxomatous, cartilaginous, and bony differentiation.



View larger version (76K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Bone and thyroid lesions from Prkar1a{Delta}2/+ mice. A-D, tail lesions in Prkar1a{Delta}2/+ mice showing advanced lesions (A) and tails at an earlier stage or tumor development (B). C, X-ray of the mouse shown in (B) showing destruction of normal calcified bone. D, longitudinal section of an affected mouse tail showing a normal vertebra (N) adjacent to an involved bone. Note the proliferation of abnormal cells in the setting of a myxomatous stroma (*). Inset, immunohistochemical staining of the lesion for osteocalcin showing that the abnormal cells are of osteoblast lineage. Normal osteoblasts seen bordering apparently unaffected bone were also stained (arrowheads). E-G, thyroid lesions in Prkar1a{Delta}2/+ mice. E, gross pathology of a thyroid carcinoma (arrow). F, H&E-stained sections of thyroid carcinomas with a predominantly solid growth pattern. Top right, residual thyroid follicles (arrowheads). G, higher magnification view showing a grouping of thyroid cancer cells within a blood vessel (*).

 
In addition to these externally obvious tumors, thyroid neoplasms were found in ~11% of Prkar1a{Delta}2/+ mice (5 of 44), although all were seen in mice older than 13.5 months (Fig. 3E-G; Table 1). One mouse exhibited multifocal tumors, as a follicular adenoma was found in one lobe and a solid-pattern thyroid carcinoma in the contralateral lobe. The cancers in these mice exhibited a solid pattern of growth (Fig. 3F), although some also had papillary elements. The diagnosis of carcinomas was based on the presence of capsular or vascular invasion as shown in Fig. 3G. As far as we are aware, these mice represent the first tumor suppressor gene knockout mouse model that spontaneously develops epithelial thyroid cancer.

Other tumors observed only in Prkar1a{Delta}2/+ mice included pituitary chromophobe adenoma, pancreatic adenocarcinoma, thymoma, and bronchioloalveolar carcinoma (data not shown). The numbers of these tumor types were too small to determine if this was a genotype specific effect. No genotype-specific lesions were observed in the adrenal glands, the gonads, or the heart, and no pigmentary abnormalities were noted, although the Prkar1a{Delta}2 allele was carried into strains of various coloration. Cardiomyopathy, lymphoproliferative disease, and subcapsular nodular adrenocortical hyperplasia was observed in older knockout mice, but similar pathology was also seen in littermate controls, making these findings appear to be age-related but not genotype-related. The incidence of these findings was similar to what has been reported in phenotypic analysis of a variety of mouse strains used for cancer research (23).

To enhance the tumorigenic phenotype, we attempted to generate congenic mice in two different tumor prone strains, C3H and A/J (24). After three to four generations of inbreeding, animals (both males and females) of either congenic line were sterile, rendering further characterization impossible. Similar observations have been reported for efforts to breed Prkar1a+/– mice in a C57BL/6 congenic background, although in that case sterility was only observed in male mice (25). Grossly, mice with significant genetic contribution from the C3H line exhibited an increased tendency to form bony lesions, with lesions involving the majority of the bones of the tail (data not shown). However, due to the limited breeding, no further observations could be made regarding genetic modifier loci in our study.

Allelic loss and tumorigenesis in Prkar1a+/– mice. To address the question of the role of Prkar1a allelic loss in tumor formation in the mice, schwannoma samples were snap frozen and subsequently analyzed at the single-cell level by FISH. This analysis showed allelic loss at the Prkar1a locus at a rate of 30% to 50% (Fig. 2G). A similar analysis of the bone tumors showed allelic loss at a rate of 15% to 20% (data not shown). However, these numbers may underestimate the true rate of Prkar1a gene loss, as it was not possible to obtain a pure population of tumor cells in these experiments.

Tumorigenesis caused by tissue-specific loss of Prkar1a. To assess directly the contribution of complete loss of Prkar1a to tumorigenesis, mice carrying the Prkar1aloxP allele were bred to mice of the TEC3 line, which express the cre recombinase in a subset of facial neural crest cells (26). Mice of the TEC3;Prkar1aloxP/loxP genotype were born at the expected frequency and were fertile. Beginning ~3 to 4 months, mice developed unilateral or bilateral tumors on the lateral aspects of the face (Fig. 4). These tumors were not observed in TEC3;Prkar1aloxP/+ mice up to 18 months, providing strong genetic evidence that tumorigenesis is the result of complete loss of Prkar1a from targeted cells, although crude lysates of the TEC3;Prkar1aloxP/loxP tumors showed immunoreactive Prkar1a protein (data not shown). Anatomically, the tumors arose in s.c. tissue lateral to the orbit and did not appear to involve overlying skin. Grossly, the tumors were fleshy and multilobulated, with an appearance similar to that of the schwannomas with divergent differentiation observed on the paws of Prkar1a{Delta}2/+ mice (Fig. 4).



View larger version (77K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. Tissue-specific ablation of Prkar1a leads to tumorigenesis. Mice of the TEC3;Prkar1aloxP/loxP genotype developed unilateral (A) or bilateral (B) facial tumors at ~3 to 6 months of age. C, mouse in (B) following removal of skin, showing the heterogeneous lobulated nature of the bilateral tumors. D, a schwannoma with divergent differentiation arising on the paw of a Prkar1a{Delta}2/+ mouse. Histology of the tumors is shown in Fig. 5.

 
The tumors were composed primarily of spindle cells (Fig. 5A), with regions of neoplastic tubules and islands of neoplastic epithelial cells scattered throughout the tumors (Fig. 5B and C). Spindle cells were largely S-100 positive (Fig. 5D-F), whereas epithelial cells and tubules were keratin-14 positive (Fig. 5G and H). Cells transitional between these two cell types were also evident. Small numbers of GFAP-positive cells were scattered irregularly through the masses; NSE-positive cells were not identified (data not shown). These tumors, like the histologically similar paw tumor seen in a Prkar1a{Delta}2/+ mouse (Figs. 4D and 5I-K), are therefore also classified as schwannomas, although these cellular elements indicate that they exhibit aspects of divergent differentiation, as has been seen in other mouse models involving schwannomas (21).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Summary
 References
 
We present here a detailed characterization of a mouse model for the human syndrome Carney complex by describing the phenotype of Prkar1a{Delta}2/+ mice. Although the spectrum of tumors observed in the mice is somewhat different from those observed in human patients, there is substantial overlap, as we have observed schwannomas, bone tumors, and thyroid neoplasms, all of which are observed in Carney complex patients (1). Our results differ significantly from a previously reported knockout mouse model whose most prominent features were hemangiosarcomas and other sarcomas (25, 27). A comparison of the constructs shows that the previous model targeted exons 3 to 5 (20), whereas ours targets exon 2. However, the differences in the observed phenotype are likely not due to functional differences in the resultant proteins (e.g., hypomorphic or dominant-negative alleles), as both alleles are associated with a complete lack of protein production (Fig. 1C; ref. 20). In fact, on detailed review, it is possible that some of the tumors classified as "myxoid fibrosarcomas" or "soft-tissue sarcomas" in the other model would meet our diagnostic criteria for schwannomas, although immunohistochemical characterization of those tumors was not undertaken. The criteria used in the present article reflect recent advances in the understanding of schwannomas in genetically modified mice, which may have slightly different characteristics than tumors that arise spontaneously (21).

Even with this consideration, however, certain differences remain in the type and distribution of tumors observed. The reason for this discrepancy is unclear but may be due to strain differences. The prior model was generated in the C57BL/6 background, whereas our mice are of mixed background composed of 129/SvJ, C57BL/6, and FVB strains although with a >50% contribution from FVB. A small number (<10%) of the mice in this report also have contribution from the C3H strain, although this subgroup behaved similarly to the others with the exception of more aggressive bone lesions. From our limited ability to generate congenic strains, it already seems clear that genetic modifier loci are important in the phenotype of Prkar1a heterozygous mice, just as they are in humans. It is also possible that the smaller number of mice (n = 17) and the shorter timeframe (19 months) of the previous report caused the authors to miss lower frequency lesions that occur in older mice, such as thyroid cancer.

In addition to the knockout approach, we have also recently described an alternate means to Prkar1a down-regulation by generating mice carrying a tetracycline-regulated antisense transgene for Prkar1a. Down-regulation of Prkar1a was shown in vitro and in vivo at both mRNA and protein levels (28), and the mice were observed to develop thyroid hyperplasia similar to that observed in human patients (29). These mice were also prone to the development of lymphomas and sarcomas, although these tumors are not frequent in Carney complex patients, and their significance is unknown. Although this mouse model mice will be a valuable tool for certain studies, its complexity makes it difficult to compare to the data from the study described here.

Comparison of Prkar1a{Delta}2/+ mice to other models of schwannoma formation. The occurrence of schwannomas in our mice is intriguing, as Schwann cell proliferation is stimulated by cAMP (30). In fact, most protocols to grow Schwann cells in vitro require the addition of PKA-activating agents in the culture medium (31). To determine if there is strong evidence linking human schwannomas to loss of PRKAR1A, we analyzed LOH in a sample of sporadic human schwannomas (n = 8). In this small sample set, we did not observe evidence for allelic loss at the PRKAR1A locus.8 Like in patients with Carney complex, Schwann cell tumors are known to develop in patients with neurofibromatosis, either type I or II (32). In contrast to the observations reported in this article, conventional knockout mouse models for Nf1 or Nf2 do not develop schwannomas (33), although these tumors can be induced under certain conditions (see below). At the biochemical level, there are good data indicating that PKA has a close functional relationship with the protein products of both Nf1 and Nf2 genes, known as neurofibromin and merlin (or schwannomin), respectively. Functionally, mutation in Nf1 leads to increased intracellular cAMP (34), and presumably to increased PKA activity, which would mimic the increased PKA activity seen by loss of Prkar1a (4). PKA has also been shown to phosphorylate neurofibromin, although the functional consequences are currently unknown (35). Other studies have shown that PKA is able to phosphorylate merlin, and this post-translational modification blocks the growth-suppressive effects of merlin (36). In light of this close connection between control of PKA activity and NF gene function, the finding of frequent schwannomas in our mice is not unexpected. These observations suggest that the genetic interaction of Prkar1a with Nf1 and Nf2 bears further investigation, with the consideration that manipulation of the PKA system may provide a means to modify the phenotype of patients with neurofibromatosis.

Comparison of Prkar1a{Delta}2/+ bone lesions to those observed in patients with Carney complex or McCune-Albright syndrome. Although fibro-osseous lesions have been described as arising spontaneously in the bones of B6C3F1 mice (37, 38), the lesions observed in Prkar1a{Delta}2/+ mice exhibited distinct characteristics. First, these lesions were only observed in Prkar1a{Delta}2/+ mice, indicating that these abnormal growths were genotype specific. In B6C3F1 mice, lesions were typically observed in the sternum and femur and were not reported in the tail. In addition, those lesions exhibited a strong female predilection, which was not observed in the bone lesions of our mice (Table 1).

Dysplastic bone lesions are known to occur in Carney complex (22) and in another genetic condition, the McCune-Albright syndrome (MAS), in which case the lesions are described as fibrous dysplasia (32). This latter disease is due to activating mutations in the stimulatory G protein {alpha}-subunit (encoded by GNAS1) and also causes enhanced cAMP/PKA signaling (39). Like in the Prkar1a{Delta}2/+ mice, the dysplastic bone seen in MAS is thought to result from a defect in osteoblast differentiation and/or proliferation (40), suggesting that the osteoblastic lineage is the target for genetic dysregulation of PKA signals in both of these conditions. Similar to Schwann cells, osteoblasts are known to have important physiologic responses to cAMP (41, 42), confirming the biological importance of this signaling pathway in this cell type. Given the fact that GNAS1 lies upstream within the same pathway as PKA, it is not surprising that these two genetic defects may both produce bone abnormalities. However, although the lesions are similar, they can be distinguished based on their histopathologic appearance (43). In the bone lesions observed in Prkar1a{Delta}2/+ mice, the lesions were loose and relatively hypocellular compared with a greater cellularity in fibrous dysplasia. In addition, the former were composed largely of polygonal cells, whereas the latter exhibit spindled cell morphology. Finally, the bony trabeculae in our mice were rimmed by normal-appearing osteoblasts (Fig. 3D), a finding that is not observed in fibrous dysplasia. Thus, although the bone lesions of Carney complex and MAS appear similar, the abnormalities observed in our mice appear to correspond quite closely to the osteochondromyxomas seen in Carney complex, although they are clearly related, albeit at a greater distance, to the fibrous dysplasia observed in MAS.

Role of complete loss of Prkar1a in tumorigenesis. Finally, the question of the role of complete loss of Prkar1a in Carney complex tumors is not resolved by these studies, but our data suggest that this occurrence may be a key event in tumorigenesis. We base this conclusion on (a) the presence of allelic loss at the single-cell level in tumors (Fig. 2G), (b) the development of tumors in the tissue specific knockout mice, and (c) the obvious similarity between tumors from tissue specific null and heterozygous mice. The fact that tumors do not seem to exhibit uniform allelic loss may suggest that loss of Prkar1a in a subset of cells is sufficient to cause tumorigenesis.

Intriguingly, similar observations have been made regarding the generation of Schwann cell tumors in neurofibromatosis. First, careful study of NF1 patient tumors has shown that neurofibromas are composed of a mixture of Schwann cells that retain a functional NF1 gene and those that have complete loss (44). As noted above, despite having nearly identical genetic defects, neurofibromas have not been observed in conventional Nf1+/– mice (33). When Nf1 was deleted from Schwann cells using a Krox-cre transgene with a conditional knockout allele (i.e., Krox-cre;Nf1loxP/loxP), the mice also failed to develop significant tumors. However, when Schwann cells were made null for Nf1 in the setting of Nf1 heterozygosity (i.e., Krox-cre;Nf1loxP/–), the mice developed schwannomas with 100% penetrance (45). The mechanism of this non–cell autonomous effect in NF1-mediated tumorigenesis has not yet been elucidated, but we hypothesize that a similar mechanism may be operating in both of these intersecting signaling pathways. This theory provides a good explanation for our current data and may also help explain some of the apparent discrepancies found in prior analyses of human tumors (4, 5, 11). Intriguingly, elegant studies on osteoblasts from fibrous dysplasia lesions have shown that transplantation of mutant osteoblasts did not recapitulate abnormal bone formation unless a coculture of normal and mutant osteoblasts was used (46). Although fibrous dysplasia is caused by a dominant-activating mutation, the requirement for a mixture of genetically normal and abnormal cells shows that a similar non–cell autonomous phenomenon may be applicable.


    Summary
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Summary
 References
 
Ultimately, the value of a mouse model for studying its associated human condition rests significantly in how well the mice develop tumors similar to those observed in human patients. Prkar1a{Delta}2/+ mice were generated to model the human syndrome Carney complex and are tumor prone. In contrast to a previous report, we find that these mice are a good model for Carney complex, developing tumors in highly relevant tissue, such as Schwann cells, osteoblasts, and thyrocytes. The availability of the Prkar1aloxP/loxP mice should provide additional insights for studies of tissue-specific tumorigenesis and also to develop further data regarding the nature of the non–cell autonomous effects of Prkar1a loss.


    Acknowledgments
 
Grant support: National Institute of Child Health and Human Development grant HD01323 (L.S. Kirschner) and National Cancer Institute grant CA16058 (The Ohio State University Comprehensive Cancer Center).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Sara Lenherr for excellent technical assistance, Dr. Alex Grinberg for assistance with stem cell manipulation, Dr. Kurt Griffin for insightful discussion, and Drs. Ian Tonks and Graham Kay for providing the TEC3 mice.


    Footnotes
 
7 K.S. Nadella and L.S. Kirschner, in preparation. Back

8 L.S. Kirschner, unpublished data. Back

Received 2/18/05. Accepted 3/16/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Summary
 References
 

  1. Stratakis CA, Kirschner LS, Carney JA. Clinical and molecular features of the Carney complex: diagnostic criteria and recommendations for patient evaluation. J Clin Endocrinol Metab 2001;86:4041–6.[Abstract/Free Full Text]
  2. Carney JA, Hruska LS, Beauchamp GD, Gordon H. Dominant inheritance of the complex of myxomas, spotty pigmentation, and endocrine overactivity. Mayo Clin Proc 1986;61:165–72.[Medline]
  3. Kirschner LS, Sandrini F, Monbo J, Lin JP, Carney JA, Stratakis CA. Genetic heterogeneity and spectrum of mutations of the PRKAR1A gene in patients with the Carney complex. Hum Mol Genet 2000;9:3037–46.[Abstract/Free Full Text]
  4. Kirschner LS, Carney JA, Pack SD, et al. Mutations of the gene encoding the protein kinase A type I-{alpha} regulatory subunit in patients with the Carney complex. Nat Genet 2000;26:89–92.[CrossRef][Medline]
  5. Casey M, Vaughan CJ, He J, et al. Mutations in the protein kinase A R1{alpha} regulatory subunit cause familial cardiac myxomas and Carney complex. J Clin Invest 2000;106:R31–8.
  6. Cho YJ, Kim JY, Jeong SW, Lee SB, Kim ON. Cyclic AMP induces activation of extracellular signal-regulated kinases in HL-60 cells: role in cAMP-induced differentiation. Leuk Res 2003;27:51–6.[CrossRef][Medline]
  7. Deeble PD, Murphy DJ, Parsons SJ, Cox ME. Interleukin-6- and cyclic AMP-mediated signaling potentiates neuroendocrine differentiation of LNCaP prostate tumor cells. Mol Cell Biol 2001;21:8471–82.[Abstract/Free Full Text]
  8. Han SY, Park DY, Lee GH, Park SD, Hong SH. Involvement of type I protein kinase A in the differentiation of L6 myoblast in conjunction with phosphatidylinositol 3-kinase. Mol Cells 2002;14:68–74.[Medline]
  9. Kim G, Choe Y, Park J, Cho S, Kim K. Activation of protein kinase A induces neuronal differentiation of HiB5 hippocampal progenitor cells. Brain Res Mol Brain Res 2002;109:134–45.[Medline]
  10. Weissinger EM, Oettrich K, Evans C, et al. Activation of protein kinase A (PKA) by 8-Cl-cAMP as a novel approach for antileukaemic therapy. Br J Cancer 2004;91:186–92.[CrossRef][Medline]
  11. Tsilou ET, Chan CC, Sandrini F, et al. Eyelid myxoma in Carney complex without PRKAR1A allelic loss. Am J Med Genet 2004;130A:395–7.[CrossRef]
  12. Bertherat J, Groussin L, Sandrini F, et al. Molecular and functional analysis of PRKAR1A and its locus (17q22-24) in sporadic adrenocortical tumors: 17q losses, somatic mutations, and protein kinase A expression and activity. Cancer Res 2003;63:5308–19.[Abstract/Free Full Text]
  13. Sandrini F, Matyakhina L, Sarlis NJ, et al. Regulatory subunit type I-{alpha} of protein kinase A (PRKAR1A): a tumor-suppressor gene for sporadic thyroid cancer. Genes Chromosomes Cancer 2002;35:182–92.[CrossRef][Medline]
  14. Barradeau S, Imaizumi-Scherrer T, Weiss MC, Faust DM. Alternative 5'-exons of the mouse cAMP-dependent protein kinase subunit RI{alpha} gene are conserved and expressed in both a ubiquitous and tissue-restricted fashion. FEBS Lett 2000;476:272–6.[CrossRef][Medline]
  15. Nagy A, Rossant J, Nagy R, Abramow-Newerly W, Roder JC. Derivation of completely cell culture-derived mice from early-passage embryonic stem cells. Proc Natl Acad Sci U S A 1993;90:8424–8.[Abstract/Free Full Text]
  16. Williams-Simons L, Westphal H. EIIaCre—utility of a general deleter strain. Transgenic Res 1999;8:53–4.[Medline]
  17. Matyakhina L, Pack S, Kirschner LS, et al. Chromosome 2 (2p16) abnormalities in Carney complex tumours. J Med Genet 2003;40:268–77.[Abstract/Free Full Text]
  18. Scacheri PC, Crabtree JS, Novotny EA, et al. Bidirectional transcriptional activity of PGK-neomycin and unexpected embryonic lethality in heterozygote chimeric knockout mice. Genesis 2001;30:259–63.[CrossRef][Medline]
  19. Xu X, Li C, Garrett-Beal L, Larson D, Wynshaw-Boris A, Deng CX. Direct removal in the mouse of a floxed neo gene from a three-loxP conditional knockout allele by two novel approaches. Genesis 2001;30:1–6.[CrossRef][Medline]
  20. Amieux PS, Howe DG, Knickerbocker H, et al. Increased basal cAMP-dependent protein kinase activity inhibits the formation of mesoderm-derived structures in the developing mouse embryo. J Biol Chem 2002;277:27294–304.[Abstract/Free Full Text]
  21. Stemmer-Rachamimov AO, Louis DN, Nielsen GP, et al. Comparative pathology of nerve sheath tumors in mouse models and humans. Cancer Res 2004;64:3718–24.[Abstract/Free Full Text]
  22. Carney JA, Boccon-Gibod L, Jarka DE, et al. Osteochondromyxoma of bone: a congenital tumor associated with lentigines and other unusual disorders. Am J Surg Pathol 2001;25:164–76.[CrossRef][Medline]
  23. Long P, Leininger J. Bone, joints and synovia. In: Maronpot R. Pathology of the mouse. Vienna (IL): Cache River Press; 1999. p.645–78.
  24. Naf D, Krupke DM, Sundberg JP, Eppig JT, Bult CJ. The mouse tumor biology database: a public resource for cancer genetics and pathology of the mouse. Cancer Res 2002;62:1235–40.[Abstract/Free Full Text]
  25. Amieux PS, McKnight GS. The essential role of RI{alpha} in the maintenance of regulated PKA activity. Ann N Y Acad Sci 2002;968:75–95.[Medline]
  26. Tonks ID, Nurcombe V, Paterson C, et al. Tyrosinase-Cre mice for tissue-specific gene ablation in neural crest and neuroepithelial-derived tissues. Genesis 2003;37:131–8.[CrossRef][Medline]
  27. Veugelers M, Wilkes D, Burton K, et al. Comparative PRKAR1A genotype-phenotype analyses in humans with Carney complex and prkar1a haploinsufficient mice. Proc Natl Acad Sci U S A 2004;101:14222–7.[Abstract/Free Full Text]
  28. Griffin KJ, Kirschner LS, Matyakhina L, et al. Down-regulation of regulatory subunit type 1A of protein kinase A leads to endocrine and other tumors. Cancer Res 2004;64:8811–5.[Abstract/Free Full Text]
  29. Griffin KJ, Kirschner LS, Matyakhina L, et al. A transgenic mouse bearing an antisense construct of regulatory subunit type 1A of protein kinase A develops endocrine and other tumours: comparison with Carney complex and other PRKAR1A induced lesions. J Med Genet 2004;41:923–31.[Abstract/Free Full Text]
  30. Kim HA, DeClue JE, Ratner N. cAMP-dependent protein kinase A is required for Schwann cell growth: interactions between the cAMP and neuregulin/tyrosine kinase pathways. J Neurosci Res 1997;49:236–47.[CrossRef][Medline]
  31. Raff MC, Hornby-Smith A, Brockes JP. Cyclic AMP as a mitogenic signal for cultured rat Schwann cells. Nature 1978;273:672–3.[CrossRef][Medline]
  32. Online Mendelian Inheritance in Man [database on the Internet]. Baltimore: McLusick-Nathans Institute for Genetic Medicine, Johns Hopkins University and Bethesda: National Center for Biotechnology Information, National Library of Medicine; 2003. Available from: http://www.ncbi.nlm.nih.gov/omim./.
  33. McClatchey AI, Cichowski K. Mouse models of neurofibromatosis. Biochim Biophys Acta 2001;1471:M73–80.[Medline]
  34. Kim HA, Ratner N, Roberts TM, Stiles CD. Schwann cell proliferative responses to cAMP and Nf1 are mediated by cyclin D1. J Neurosci 2001;21:1110–6.[Abstract/Free Full Text]
  35. Izawa I, Tamaki N, Saya H. Phosphorylation of neurofibromatosis type 1 gene product (neurofibromin) by cAMP-dependent protein kinase. FEBS Lett 1996;382:53–9.[CrossRef][Medline]
  36. Alfthan K, Heiska L, Gronholm M, Renkema GH, Carpen O. Cyclic AMP-dependent protein kinase phosphorylates merlin at serine 518 independently of p21-activated kinase and promotes merlin-ezrin heterodimerization. J Biol Chem 2004;279:18559–66.[Abstract/Free Full Text]
  37. Albassam MA, Wojcinski ZW, Barsoum NJ, Smith GS. Spontaneous fibro-osseous proliferative lesions in the sternums and femurs of B6C3F1 mice. Vet Pathol 1991;28:381–8.[Abstract]
  38. Sass B, Montali RJ. Spontaneous fibro-osseous lesions in aging female mice. Lab Anim Sci 1980;30:907–9.[Medline]
  39. Weinstein LS, Shenker A, Gejman PV, Merino MJ, Friedman E, Spiegel AM. Activating mutations of the stimulatory G protein in the McCune-Albright syndrome. N Engl J Med 1991;325:1688–95.[Abstract]
  40. Riminucci M, Fisher LW, Shenker A, Spiegel AM, Bianco P, Gehron Robey P. Fibrous dysplasia of bone in the McCune-Albright syndrome: abnormalities in bone formation. Am J Pathol 1997;151:1587–600.[Abstract]
  41. Romanello M, Moro L, Pirulli D, Crovella S, D'Andrea P. Effects of cAMP on intercellular coupling and osteoblast differentiation. Biochem Biophys Res Commun 2001;282:1138–44.[CrossRef][Medline]
  42. Swarthout JT, Tyson DR, Jefcoat SC Jr, Partridge NC, Efcoat SC Jr. Induction of transcriptional activity of the cyclic adenosine monophosphate response element binding protein by parathyroid hormone and epidermal growth factor in osteoblastic cells. J Bone Miner Res 2002;17:1401–7.[CrossRef][Medline]
  43. Riminucci M, Liu B, Corsi A, et al. The histopathology of fibrous dysplasia of bone in patients with activating mutations of the Gs{alpha} gene: site-specific patterns and recurrent histological hallmarks. J Pathol 1999;187:249–58.[CrossRef][Medline]
  44. Serra E, Rosenbaum T, Winner U, et al. Schwann cells harbor the somatic NF1 mutation in neurofibromas: evidence of two different Schwann cell subpopulations. Hum Mol Genet 2000;9:3055–64.[Abstract/Free Full Text]
  45. Zhu Y, Ghosh P, Charnay P, Burns DK, Parada LF. Neurofibromas in NF1: Schwann cell origin and role of tumor environment. Science 2002;296:920–2.[Abstract/Free Full Text]
  46. Bianco P, Kuznetsov SA, Riminucci M, Fisher LW, Spiegel AM, Robey PG. Reproduction of human fibrous dysplasia of bone in immunocompromised mice by transplanted mosaics of normal and Gs{alpha}-mutated skeletal progenitor cells. J Clin Invest 1998;101:1737–44.[Medline]



This article has been cited by other articles:


Home page
J. Clin. Endocrinol. Metab.Home page
A. J. Robinson-White, I. Bossis, H.-P. Hsiao, M. Nesterova, W. W. Leitner, and C. A. Stratakis
8-Cl-Adenosine Inhibits Proliferation and Causes Apoptosis in B-Lymphocytes via Protein Kinase A-Dependent and Independent Effects: Implications for Treatment of Carney Complex-Associated Tumors
J. Clin. Endocrinol. Metab., October 1, 2009; 94(10): 4061 - 4069.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
B. Ragazzon, L. Cazabat, M. Rizk-Rabin, G. Assie, L. Groussin, H. Fierrard, K. Perlemoine, A. Martinez, and J. Bertherat
Inactivation of the Carney Complex Gene 1 (Protein Kinase A Regulatory Subunit 1A) Inhibits SMAD3 Expression and TGF{beta}-Stimulated Apoptosis in Adrenocortical Cells
Cancer Res., September 15, 2009; 69(18): 7278 - 7284.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
L. S Kirschner, Z. Yin, G. N Jones, and E. Mahoney
Mouse models of altered protein kinase A signaling
Endocr. Relat. Cancer, September 1, 2009; 16(3): 773 - 793.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. Bertherat, A. Horvath, L. Groussin, S. Grabar, S. Boikos, L. Cazabat, R. Libe, F. Rene-Corail, S. Stergiopoulos, I. Bourdeau, et al.
Mutations in Regulatory Subunit Type 1A of Cyclic Adenosine 5'-Monophosphate-Dependent Protein Kinase (PRKAR1A): Phenotype Analysis in 353 Patients and 80 Different Genotypes
J. Clin. Endocrinol. Metab., June 1, 2009; 94(6): 2085 - 2091.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. Meoli, I. Bossis, L. Cazabat, M. Mavrakis, A. Horvath, S. Stergiopoulos, M. L. Shiferaw, G. Fumey, K. Perlemoine, M. Muchow, et al.
Protein Kinase A Effects of an Expressed PRKAR1A Mutation Associated with Aggressive Tumors
Cancer Res., May 1, 2008; 68(9): 3133 - 3141.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. S. Nadella, G. N. Jones, A. Trimboli, C. A. Stratakis, G. Leone, and L. S. Kirschner
Targeted Deletion of Prkar1a Reveals a Role for Protein Kinase A in Mesenchymal-to-Epithelial Transition
Cancer Res., April 15, 2008; 68(8): 2671 - 2677.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
Z. Yin, G. N. Jones, W. H. Towns II, X. Zhang, E. D. Abel, P. F. Binkley, D. Jarjoura, and L. S. Kirschner
Heart-Specific Ablation of Prkar1a Causes Failure of Heart Development and Myxomagenesis
Circulation, March 18, 2008; 117(11): 1414 - 1422.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
E. Pavel, K. Nadella, W. H. Towns II, and L. S. Kirschner
Mutation of Prkar1a Causes Osteoblast Neoplasia Driven by Dysregulation of Protein Kinase A
Mol. Endocrinol., February 1, 2008; 22(2): 430 - 440.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
Z. Yin, L. Williams-Simons, A. F. Parlow, S. Asa, and L. S. Kirschner
Pituitary-Specific Knockout of the Carney Complex Gene Prkar1a Leads to Pituitary Tumorigenesis
Mol. Endocrinol., February 1, 2008; 22(2): 380 - 387.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Nesterova, I. Bossis, F. Wen, A. Horvath, L. Matyakhina, and C. A. Stratakis
An Immortalized Human Cell Line Bearing a PRKAR1A-Inactivating Mutation: Effects of Overexpression of the Wild-Type Allele and Other Protein Kinase A Subunits
J. Clin. Endocrinol. Metab., February 1, 2008; 93(2): 565 - 571.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Raskovalova, A. Lokshin, X. Huang, Y. Su, M. Mandic, H. M. Zarour, E. K. Jackson, and E. Gorelik
Inhibition of Cytokine Production and Cytotoxic Activity of Human Antimelanoma Specific CD8+ and CD4+ T Lymphocytes by Adenosine-Protein Kinase A Type I Signaling
Cancer Res., June 15, 2007; 67(12): 5949 - 5956.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
S. A. Boikos and C. A. Stratakis
Molecular genetics of the cAMP-dependent protein kinase pathway and of sporadic pituitary tumorigenesis
Hum. Mol. Genet., April 15, 2007; 16(R1): R80 - R87.
[Abstract] [Full Text] [PDF]


Home page
Vet PatholHome page
K. A. B. Knostman, S. M. Jhiang, and C. C. Capen
Genetic Alterations in Thyroid Cancer: The Role of Mouse Models
Vet. Pathol., January 1, 2007; 44(1): 1 - 14.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. J. Robinson-White, W. W. Leitner, E. Aleem, P. Kaldis, I. Bossis, and C. A. Stratakis
PRKAR1A Inactivation Leads to Increased Proliferation and Decreased Apoptosis in Human B Lymphocytes
Cancer Res., November 1, 2006; 66(21): 10603 - 10612.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
I. Bourdeau, L. Matyakhina, S. G. Stergiopoulos, F. Sandrini, S. Boikos, and C. A. Stratakis
17q22-24 Chromosomal Losses and Alterations of Protein Kinase A Subunit Expression and Activity in Adrenocorticotropin-Independent Macronodular Adrenal Hyperplasia
J. Clin. Endocrinol. Metab., September 1, 2006; 91(9): 3626 - 3632.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Lokshin, T. Raskovalova, X. Huang, L. C. Zacharia, E. K. Jackson, and E. Gorelik
Adenosine-mediated inhibition of the cytotoxic activity and cytokine production by activated natural killer cells.
Cancer Res., August 1, 2006; 66(15): 7758 - 7765.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Robinson-White, E. Meoli, S. Stergiopoulos, A. Horvath, S. Boikos, I. Bossis, and C. A. Stratakis
PRKAR1AMutations and Protein Kinase A Interactions with Other Signaling Pathways in the Adrenal Cortex
J. Clin. Endocrinol. Metab., June 1, 2006; 91(6): 2380 - 2388.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Horvath, L. Mathyakina, Q. Vong, V. Baxendale, A. L. Y. Pang, W.-Y. Chan, and C. A. Stratakis
Serial Analysis of Gene Expression in Adrenocortical Hyperplasia Caused by a Germline PRKAR1A Mutation
J. Clin. Endocrinol. Metab., February 1, 2006; 91(2): 584 - 596.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. S. Nadella and L. S. Kirschner
Disruption of Protein Kinase A Regulation Causes Immortalization and Dysregulation of D-Type Cyclins
Cancer Res., November 15, 2005; 65(22): 10307 - 10315.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kirschner, L. S.
Right arrow Articles by Stratakis, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kirschner, L. S.
Right arrow Articles by Stratakis, C. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online