| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell and Tumor Biology |
and Vascular Endothelial Growth Factor Expression Induced by Insulin-Like Growth Factor-I in Neuroblastoma Cells
1 Pediatric Oncology Branch and 2 Urologic Oncology Branch, Center for Cancer Research, National Cancer Institute, NIH, Bethesda, Maryland and 3 Science Applications International Corp.-Frederick, Inc., National Cancer Institute, Frederick, Maryland
Requests for reprints: Carol J. Thiele, Cell and Molecular Biology Section, Pediatric Oncology Branch, Center for Cancer Research, National Cancer Institute, NIH, 1-3940 MSC-1105, Bethesda, MD 20892. Phone: 301-496-1543; Fax: 301-451-7052; E-mail: ct47a{at}nih.gov.
| Abstract |
|---|
|
|
|---|
). HIF-1
protein levels are regulated by the von Hippel Lindau tumor suppressor gene, VHL, which targets HIF-1
degradation. To determine whether the levels of VEGF in neuroblastomas are due to mutations in VHL, we evaluated genomic DNA from 15 neuroblastoma cell lines using PCR. We found no mutations in exons 1, 2, or 3 of the VHL gene. VEGF mRNA levels in neuroblastoma cells cultured in serum-free medium increased after 8 to 16 hours in serum, insulin-like growth factorI (IGFI), epidermal growth factor, or platelet-derived growth factor. Serum/IGFI induced increases in HIF-1
protein that temporally paralleled increases in VEGF mRNA, whereas HIF-1ß levels were unaffected. VEGF and HIF-1
levels were blocked by inhibitors of phosphatidylinositol 3-kinase and mammalian target of rapamycin. Furthermore, we confirmed that HIF-1
mediates
40% of the growth factor activity stimulating VEGF protein expression. Topotecan blocked the IGF-I-stimulated increase in HIF-1
but not HIF-1ß, and this resulted in a decrease in VEGF in four neuroblastoma cell lines tested. These data indicate that growth factors in an autocrine or paracrine manner play a major role in regulating VEGF levels in neuroblastoma cells and that targeted therapies to phosphatidylinositol 3-kinase, mammalian target of rapamycin, and/or HIF-1
have the potential to inhibit VEGF expression and limit neuroblastoma tumor growth. | Introduction |
|---|
|
|
|---|
. The importance of this factor in the regulation of VEGF levels was revealed with the finding that the von Hippel Lindau gene (VHL) tumor suppressor gene in kidney cancer encoded a protein that targets HIF-1
protein to the proteosome for degradation (2). Mutations in VHL lead to increased levels of HIF-1
and, in turn, constitutively high VEGF levels. Although hypoxia via HIF-1
is a major regulator of VEGF levels, recent in vitro studies reveal that insulin-like growth factor-I (IGF-I) induces VEGF expression in colon and prostate cancer through a phosphatidylinositol 3-kinase (PI3K)dependent mechanism either directly and/or indirectly mediated by HIF-1
(3, 4). Neuroblastoma is the most common extracranial solid tumor in childhood (5). The extent of angiogenesis or VEGF expression in neuroblastoma tumor tissue is correlated with metastatic disease, N-myc amplification, and poor clinical outcome (6, 7). Together with frequent expression of VEGF in neuroblastoma cell lines and tumors (8), VEGF targeted therapy may be effective against neuroblastoma. In fact, blockade of VEGF function inhibits neuroblastoma tumor growth (9). In neuroblastoma cells exposed to hypoxic conditions, there is evidence of coexpression of IGFs and VEGF in vitro (10) and in vivo (11). Moreover, IGFs play a role in neuroblastoma tumor progression by stimulating N-myc expression (12), cell survival/proliferation (13), and motility (14); enhancing cell survival (15); affecting chemosensitivity (16); and mediating resistance to retinoids (17). Furthermore, blockade of IGF-I receptor (IGF-IR) ameliorates retinoid resistance (17) and results in suppression of neuroblastoma xenograft tumor growth (18).
Little is known about the regulation of VEGF in neuroblastoma under normoxic conditions. Here, we study the regulation of VEGF expression in neuroblastoma cell lines by serum and the growth factor IGF-I. We find that serum and serum-derived growth factors, especially IGF-I, induce VEGF expression and secretion in neuroblastoma cells through induction of HIF-1
expression via both PI3K/Akt and mitogen-activated protein kinase (MAPK) pathways. Additionally, the VHL gene, a major negative regulator of HIF-1
, is not mutated in neuroblastoma cell lines. Targeted decreases in HIF-1
expression using a HIF1-
small interfering RNA (siRNA) decrease VEGF expression, and treatment with topotecan, a drug under clinical evaluation in neuroblastoma, inhibits HIF-1
and recombinant VEGF expression in neuroblastoma cells.
| Materials and Methods |
|---|
|
|
|---|
inhibitor U73122 (Sigma-Aldrich, Milwaukee, WI), or anti-IGF-IR monoclonal antibody
IR-3 (Oncogene Research Products, Darmstadt, Germany). When used, topotecan (0-200 nmol/L) was added concurrently with IGF-I or control solvent. After incubations SK-N-BE2, SK-N-AS, SMS-KCNR, or SH-SY5Y cells for 6 hours in serum-free RPMI 1640, the cells were treated with topotecan in a dose-dependent manner (0-200 µmol/L) with or without IGF-I (100 ng/mL) for 8 hours. Western and ELISA analyses (as described in Materials and Methods) for evaluation of HIF-1
, HIF-1ß, and VEGF were done. Sequence of VHL gene. Exons 1 to 3 of the VHL gene were amplified by PCR using genomic DNA from SK-N-AS, SK-N-BE2, CHP-212, CHP-126, CHP-134B, CHP-382, CHP-404, GICAN, IMR32, SMS-KCNR, LAN-5, LAN-1, NBLS, NGP, and SK-N-DZ neuroblastoma cell lines for template as published previously (19). DNA sequencing was done using a commercially available kit (ABI Research, Oyster Bay, NY) with dideoxy terminators. Sequences were analyzed on an automated DNA sequencer (ABI) and compared with control sequence.
In vitro human umbilical vascular endothelial cell survival assay. After incubations SMS-KCNR or SH-SY5Y cells for 6 hours in serum-free RPMI 1640, the cells were treated as indicated and culture supernatants were collected, centrifuged, concentrated, and used to stimulate human umbilical vascular endothelial cells (HUVEC), which were kindly provided by Dr. Hynda Kleinman's laboratory. HUVECs (5,000 per well) were plated in 96-well tissue culture plates in medium containing growth factors (EGM medium, Clonetics Corp., San Diego, CA). After incubation for 6 hours in medium containing no growth factors (EBM medium), HUVECs were incubated at 37°C for 96 hours in conditioned medium of SMS-KCNR or SH-SY5Y neuroblastoma cells treated as indicated (50-fold concentrated supernatant, diluted 1:3 in EBM + 1% fetal bovine serum). After incubation, HUVECs were stained with trypan blue and counted. To evaluate their capacity to block endothelial cell proliferation induced by SH-SY5Y conditioned medium, a specific antibody against VEGF (Santa Cruz Biotechnology, Santa Cruz, CA) was incubated with SH-SY5Y conditioned medium.
RNA interference. The HIF-1
siRNA (AAAGGACAAGTCACCACAGGA) to target HIF-1
and a nonspecific siRNA control (AATTCTCCGAACGTGTCACGT; Qiagen, Inc., Valencia, CA) were used. One million SK-N-AS cells were transfected with HIF-1
siRNA using Lipofectamine 2000 according to the manufacturer's instructions (Invitrogen, Carlsbad, CA). After 24 hours, the cell supernatants were collected and evaluated for VEGF protein expression by ELISA, whereas the cells were lysed with 1% NP40 lysis buffer and protein expression was evaluated by Western blot analysis.
Northern blotting. Cells were harvested and total RNA was extracted using a RNeasy kit (Qiagen, Santa Clarita, CA). Northern blotting analysis of RNA (25 µg) and blotting for VEGF were done according to the protocol described previously (18).
Protein assays. Western blotting and immunoprecipitation were done as described previously (18). Antibodies used were anti-phosphotyrosine antibody, anti-Flk-1 antibody, anti-HIF-1
antibody (BD Transduction Laboratories, San Jose, CA), anti-HIF-1ß antibody (BD Transduction Laboratories), anti-phospho-mTOR antibody, anti-phospho-4E-BP1 antibody, anti-GSK-3ß antibody, anti-Akt antibody, anti-phospho-Akt antibody, antiextracellular signal-regulated kinase (ERK) 1/2, or anti-phospho-ERK1/2 antibody (Cell Signaling Technology). For measurement of VEGF protein concentration in conditioned medium, 2 x 105 cells were incubated at 80% confluence for 24 hours in complete medium in 12-well plates. The conditioned medium of neuroblastoma cells was collected, centrifuged at 3,000 rpm for 10 minutes, and stored at 80°C. The concentration of VEGF protein was measured using ELISA kits with a mouse monoclonal antibody against VEGF according to the manufacturer's instruction.
| Results |
|---|
|
|
|---|
major regulator of VEGF expression. To determine whether the increased expression of VEGF in neuroblastoma cells may arise by mutations in VHL, exons 1 to 3 of the VHL gene were amplified by PCR in 15 neuroblastoma cell lines and sequenced. No mutations were found in the VHL gene in these cell lines.
To assess whether serum or serum-derived growth factors regulate VEGF expression, SMS-KCNR neuroblastoma cells were incubated for 8 hours in serum-free medium followed by the addition of 0.5% or 10% FCS. Such treatment resulted in a marked increase in VEGF expression as determined by ELISA (Fig. 1A). IGF-I, EGF, and PDGF stimulated increases in VEGF mRNA in SMS-KCNR neuroblastoma cells. To examine whether the IGF system contributes to FCS induction of VEGF expression, we pretreated cells with
IR-3, an anti-IGF-IR blocking antibody, and measured VEGF concentration in conditioned medium by ELISA. Serum increased the level of VEGF expression by
4-fold and
IR-3 inhibited almost half of the increased expression. Both differences are statistically significant (P < 0.005; Fig. 1C) and indicate involvement of IGFs in serum-induced VEGF expression. IGF-I induced VEGF expression in both N-myc amplified (LAN-1 and SK-N-BE2) and single-copy N-myc (SH-SY5Y and SK-N-AS) neuroblastoma cell lines (Fig. 1D). In SK-N-AS cells compared with the other cell lines, VEGF was more highly expressed even in the absence of serum (Fig. 1D) perhaps due to the previously described IGF-II autocrine loop (13).
|
60% HUVECs from the cell death (Fig. 2A and B). To verify that the effect of neuroblastoma conditioned medium was cell-derived VEGF, we assessed phosphorylation of Flk-1, a VEGF receptor, on HUVECs by conditioned medium. There was a basal level of Flk-1 phosphorylation from the conditioned medium of SMS-KCNR cells; however, the conditioned medium of IGF-I-treated SMS-KCNR cells markedly increased Flk-1 phosphorylation. The increase in Flk-1 phosphorylation was not due to the presence of IGF-I in the conditioned medium, as IGF-I alone did not induce Flk-1 phosphorylation (Fig. 2C, lane 5). Moreover, Flk-1 phosphorylation was completely abrogated when conditioned medium from IGF-stimulated SMS-KCNR cells was preincubated with an anti-VEGF neutralizing antibody (Fig. 2C, lane 4).
|
|
3-fold compared with levels in control-treated cells (Fig. 3D). Consistent with inhibition at the transcriptional level, LY294002, the PI3K inhibitor, and rapamycin blocked the IGF-I-induced VEGF protein secretion from SMS-KCNR cells. PD98059 partially inhibited but phospholipase C-
inhibitor (U73122) did not affect the VEGF secretion (Fig. 3D). These findings indicate that PI3K/Akt and MAPK pathways are involved in IGF-I-induced VEGF expression.
Induction of hypoxia-inducible factor-1
expression by insulin-like growth factor-I. Major transcriptional modulators of VEGF are dimers of HIF-1
(HIF-1
and HIF-1ß). To test whether IGF stimulated HIF-1
, cells were treated for indicated times with IGF-I and analyzed for HIF-1
expression by Western blot analysis. IGF-I stimulated a marked increase in HIF-1
, but HIF-1ß levels were unaffected (Fig. 4A). Pharmacologic inhibitors of the PI3K and mTOR blocked HIF-1
expression (Fig. 4B) but had no effect on HIF-1ß levels (data not shown).
|
mediates activity stimulating vascular endothelial growth factor protein expression. To directly evaluate whether HIF-1
plays a role in stimulating VEGF protein expression, we transfected a HIF-1
siRNA or a control siRNA into SK-N-AS cells and cultured for 24 hours under three conditions: in the absence of serum (0% FCS) and in the presence of 10% FCS or IGF-I (100 ng/mL). According to Western blot analysis, HIF-1
protein expression decreased 63% to 73% in cells transfected with the HIF-1
siRNA compared with cells transfected with the control siRNA (Fig. 5A and B). When VEGF protein levels were measured in the supernatants from these same samples, VEGF protein levels decreased 34% to 40% in the HIF-1
siRNA-transfected samples compared with the control siRNA-transfected samples (Fig. 5C). These results indicate that a large portion of the expression of VEGF is regulated by the levels of HIF-1
.
|
but not hypoxia-inducible factor-1ß and resulted in a decrease in vascular endothelial growth factor. Recent evidence indicates that camptothecins inhibit HIF-1
expression (20). To evaluate the effects of camptothecins on HIF-1
and VEGF expression, several neuroblastoma cell lines were treated with different concentrations of topotecan for 8 hours. In the four neuroblastoma cell lines examined, topotecan inhibited HIF-1
but not HIF-1ß levels (Fig. 6A). Furthermore, the levels of VEGF secreted into the medium decreased after topotecan treatment (Fig. 6B). Topotecan at 200 nmol/L also inhibited basal VEGF secretion in three of four neuroblastoma cell lines evaluated. In three of four neuroblastoma cell lines stimulated by IGF-I and treated with topotecan, there was a general dose-dependent decrease in VEGF levels, which was similar to the dose-dependent decrease in HIF-1
levels (Fig. 6C).
|
| Discussion |
|---|
|
|
|---|
is a major mediator of this effect. The increased VEGF expression produced by IGF-treated neuroblastoma cells stimulates proliferation of vascular endothelial cells. The finding that the IGF-I-stimulated increase in VEGF was blocked by antibodies to the IGF-IR indicates that strategies aimed at targeting this receptor will not only affect neuroblastoma cell survival but also affect surrounding vasculature dependent on tumor-derived VEGF.
These findings in neuroblastoma tumor cells are similar to those reported for IGF-induced increases in VEGF in Ewing's sarcoma, another pediatric tumor of neuroectodermal origin (21), and prostate epithelial cells (22). Although it is well known that hypoxia stimulates VEGF levels, hypoxia coordinately stimulates increases in IGF-II and VEGF expression in neuroblastoma cells (10), and in tumor xenografts, hypoxic areas of tumors coexpressed VEGF and IGF-II (11). These data provide evidence that an additional role of IGFs in neuroblastoma tumor progression may be enhancement of angiogenesis via up-regulation of VEGF. Thus, strategies that target HIF-1
may reduce the angiogenic potential of neuroblastoma cells.
A major mechanism for induction of HIF-1
under hypoxic conditions is inhibition of HIF-1
degradation by inactivation of the HIF-1
ubiquitination ligase, VHL (2). DNA sequence analysis indicated that VHL is not mutated in neuroblastoma cell lines; thus, regulation of VEGF levels may be primarily modulated by external signals. Growth factors, including IGF-I, EGF, and PDGF, have been shown to induce HIF-1
expression, and we extend this observation to neuroblastoma cells. Our results indicate that in neuroblastoma cells IGF-I through the PI3K/mTOR pathway mediates increases in HIF-1
, whereas the PI3K/mTOR and MAPK pathways influence VEGF levels. This is similar to findings in colon and prostate cells (3, 4).
Although HIF-1
is a major regulator of VEGF promoter, recent studies indicate that additional transcriptional factors, such as activator protein-1, are needed to maximally stimulate VEGF expression (23, 24). In our study, we show that targeting HIF-1
using a HIF-1
siRNA results in a major reduction in VEGF protein levels. This would suggest that HIF-1
plays a part in transcriptionally regulating VEGF in neuroblastoma cells. Whether additional cis-acting regulatory regions are important in modulating the VEGF promoter in neuroblastoma cells is currently under study.
Small molecule inhibitors of key targets that regulate processes important in tumorigenesis are a major goal of current cancer therapeutic initiatives. The important role of HIF-1
in modulating VEGF expression in neuroblastoma cells led us to examine the effects of camptothecins on neuroblastoma cells. Camptothecins have been found to inhibit HIF-1
through a novel DNA replicationindependent, topoisomerase Imediated effect on HIF-1
mRNA translation (20). Using topotecan, we find inhibition of HIF-1
but not HIF-1ß in neuroblastoma cells. Additionally, topotecan causes a decrease in VEGF protein levels. The decrease in VEGF levels is similar to the decrease in HIF-1
levels in two of four neuroblastoma cell lines examined. However, at 200 nmol/L topotecan, the VEGF protein levels in all cell lines examined are decreased to background levels or below. Thus, it is possible that topotecan may have effects on VEGF expression in neuroblastoma cells that are independent of its ability to affect HIF-1
mRNA translation. Future studies are aimed at evaluating the effects of camptothecins on VEGF mRNA. Whatever the mechanism, these results indicate that camptothecins may have important effects on neuroblastoma tumors in vivo. Dose intensive trials of topotecan alone or in multimodality chemotherapeutic regimens have had minimal effects in advanced stage neuroblastoma (25). However, Kim et al. (26) have shown in a preclinical model of neuroblastoma that "low-dose pulse" topotecan either alone or with anti-VEGF therapies significantly reduces tumor growth. Our study has identified several potential target sites in the PI3K pathway as well as HIF-1
, which, if modulated using small molecule inhibitors or drugs, may be effective in regulating VEGF levels and ultimately the growth of neuroblastoma cells.
| Acknowledgments |
|---|
We thank Dr. Hynda Kleinman and the members of her laboratory for help in endothelial proliferation assay, Choh Yeung for technical advice, and Dr. Lee Helman, and Dr. Giovanni Melillo for insightful discussions. And we thank the other members of the Cell and Molecular Biology Section for support.
| Footnotes |
|---|
Received 9/14/04. Revised 1/18/05. Accepted 3/25/05.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. Puppo, F. Battaglia, C. Ottaviano, S. Delfino, D. Ribatti, L. Varesio, and M. C. Bosco Topotecan inhibits vascular endothelial growth factor production and angiogenic activity induced by hypoxia in human neuroblastoma by targeting hypoxia-inducible factor-1{alpha} and -2{alpha} Mol. Cancer Ther., July 1, 2008; 7(7): 1974 - 1984. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Boller, A. Schramm, K. T. Doepfner, T. Shalaby, A. O. von Bueren, A. Eggert, M. A. Grotzer, and A. Arcaro Targeting the Phosphoinositide 3-Kinase Isoform p110{delta} Impairs Growth and Survival in Neuroblastoma Cells Clin. Cancer Res., February 15, 2008; 14(4): 1172 - 1181. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Peddinti, R. Zeine, D. Luca, R. Seshadri, A. Chlenski, K. Cole, B. Pawel, H. R. Salwen, J. M. Maris, and S. L. Cohn Prominent Microvascular Proliferation in Clinically Aggressive Neuroblastoma Clin. Cancer Res., June 15, 2007; 13(12): 3499 - 3506. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Martin and R. C. Baxter Expression of Insulin-Like Growth Factor Binding Protein-2 by MCF-7 Breast Cancer Cells Is Regulated through the Phosphatidylinositol 3-Kinase/AKT/Mammalian Target of Rapamycin Pathway Endocrinology, May 1, 2007; 148(5): 2532 - 2541. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. T. Kurmasheva, F. C. Harwood, and P. J. Houghton Differential regulation of vascular endothelial growth factor by Akt and mammalian target of rapamycin inhibitors in cell lines derived from childhood solid tumors Mol. Cancer Ther., May 1, 2007; 6(5): 1620 - 1628. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Pezzolo, F. Parodi, M. V. Corrias, R. Cinti, C. Gambini, and V. Pistoia Tumor Origin of Endothelial Cells in Human Neuroblastoma J. Clin. Oncol., February 1, 2007; 25(4): 376 - 383. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Tanno, C. Mancini, R. Vitali, M. Mancuso, H. P. McDowell, C. Dominici, and G. Raschella Down-Regulation of Insulin-Like Growth Factor I Receptor Activity by NVP-AEW541 Has an Antitumor Effect on Neuroblastoma Cells In vitro and In vivo. Clin. Cancer Res., November 15, 2006; 12(22): 6772 - 6780. [Abstract] [Full Text] [PDF] |
||||
![]() |
K S Kimbro and J W Simons Hypoxia-inducible factor-1 in human breast and prostate cancer. Endocr. Relat. Cancer, September 1, 2006; 13(3): 739 - 749. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F. McCarty and K. I. Block Toward a core nutraceutical program for cancer management. Integr Cancer Ther, June 1, 2006; 5(2): 150 - 171. [Abstract] [PDF] |
||||
![]() |
K. Nakamura, K. C. Martin, J. K. Jackson, K. Beppu, C.-W. Woo, and C. J. Thiele Brain-Derived Neurotrophic Factor Activation of TrkB Induces Vascular Endothelial Growth Factor Expression via Hypoxia-Inducible Factor-1{alpha} in Neuroblastoma Cells. Cancer Res., April 15, 2006; 66(8): 4249 - 4255. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |