Cancer Research Meeting Calendar  Metabolism
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Beppu, K.
Right arrow Articles by Thiele, C. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Beppu, K.
Right arrow Articles by Thiele, C. J.
[Cancer Research 65, 4775-4781, June 1, 2005]
© 2005 American Association for Cancer Research


Cell and Tumor Biology

Topotecan Blocks Hypoxia-Inducible Factor-1{alpha} and Vascular Endothelial Growth Factor Expression Induced by Insulin-Like Growth Factor-I in Neuroblastoma Cells

Kiichiro Beppu1, Katsuya Nakamura1, W. Marston Linehan2, Annamaria Rapisarda3 and Carol J. Thiele1

1 Pediatric Oncology Branch and 2 Urologic Oncology Branch, Center for Cancer Research, National Cancer Institute, NIH, Bethesda, Maryland and 3 Science Applications International Corp.-Frederick, Inc., National Cancer Institute, Frederick, Maryland

Requests for reprints: Carol J. Thiele, Cell and Molecular Biology Section, Pediatric Oncology Branch, Center for Cancer Research, National Cancer Institute, NIH, 1-3940 MSC-1105, Bethesda, MD 20892. Phone: 301-496-1543; Fax: 301-451-7052; E-mail: ct47a{at}nih.gov.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The extent of angiogenesis and/or vascular endothelial growth factor (VEGF) expression in neuroblastoma tumors correlates with metastases, N-myc amplification, and poor clinical outcome. Understanding the mechanisms regulating VEGF expression in neuroblastoma cells provides additional therapeutic options to control neuroblastoma tumor growth. VEGF mRNA is controlled by growth factors and hypoxia via the transcription factor hypoxia-inducible factor (HIF-1{alpha}). HIF-1{alpha} protein levels are regulated by the von Hippel Lindau tumor suppressor gene, VHL, which targets HIF-1{alpha} degradation. To determine whether the levels of VEGF in neuroblastomas are due to mutations in VHL, we evaluated genomic DNA from 15 neuroblastoma cell lines using PCR. We found no mutations in exons 1, 2, or 3 of the VHL gene. VEGF mRNA levels in neuroblastoma cells cultured in serum-free medium increased after 8 to 16 hours in serum, insulin-like growth factor–I (IGF–I), epidermal growth factor, or platelet-derived growth factor. Serum/IGF–I induced increases in HIF-1{alpha} protein that temporally paralleled increases in VEGF mRNA, whereas HIF-1ß levels were unaffected. VEGF and HIF-1{alpha} levels were blocked by inhibitors of phosphatidylinositol 3-kinase and mammalian target of rapamycin. Furthermore, we confirmed that HIF-1{alpha} mediates ~40% of the growth factor activity stimulating VEGF protein expression. Topotecan blocked the IGF-I-stimulated increase in HIF-1{alpha} but not HIF-1ß, and this resulted in a decrease in VEGF in four neuroblastoma cell lines tested. These data indicate that growth factors in an autocrine or paracrine manner play a major role in regulating VEGF levels in neuroblastoma cells and that targeted therapies to phosphatidylinositol 3-kinase, mammalian target of rapamycin, and/or HIF-1{alpha} have the potential to inhibit VEGF expression and limit neuroblastoma tumor growth.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Angiogenesis, the growth of new capillary blood vessels, is essential for tumor development and metastasis. To initiate angiogenesis, tumor cells make an angiogenic switch by perturbing the local balance of proangiogenic and antiangiogenic factors (1). Vascular endothelial growth factor (VEGF) is a strong proangiogenic factor and an attractive target for antiangiogenic therapies. A major regulator of VEGF is the hypoxia-inducible factor (HIF)-1{alpha}. The importance of this factor in the regulation of VEGF levels was revealed with the finding that the von Hippel Lindau gene (VHL) tumor suppressor gene in kidney cancer encoded a protein that targets HIF-1{alpha} protein to the proteosome for degradation (2). Mutations in VHL lead to increased levels of HIF-1{alpha} and, in turn, constitutively high VEGF levels. Although hypoxia via HIF-1{alpha} is a major regulator of VEGF levels, recent in vitro studies reveal that insulin-like growth factor-I (IGF-I) induces VEGF expression in colon and prostate cancer through a phosphatidylinositol 3-kinase (PI3K)–dependent mechanism either directly and/or indirectly mediated by HIF-1{alpha} (3, 4).

Neuroblastoma is the most common extracranial solid tumor in childhood (5). The extent of angiogenesis or VEGF expression in neuroblastoma tumor tissue is correlated with metastatic disease, N-myc amplification, and poor clinical outcome (6, 7). Together with frequent expression of VEGF in neuroblastoma cell lines and tumors (8), VEGF targeted therapy may be effective against neuroblastoma. In fact, blockade of VEGF function inhibits neuroblastoma tumor growth (9). In neuroblastoma cells exposed to hypoxic conditions, there is evidence of coexpression of IGFs and VEGF in vitro (10) and in vivo (11). Moreover, IGFs play a role in neuroblastoma tumor progression by stimulating N-myc expression (12), cell survival/proliferation (13), and motility (14); enhancing cell survival (15); affecting chemosensitivity (16); and mediating resistance to retinoids (17). Furthermore, blockade of IGF-I receptor (IGF-IR) ameliorates retinoid resistance (17) and results in suppression of neuroblastoma xenograft tumor growth (18).

Little is known about the regulation of VEGF in neuroblastoma under normoxic conditions. Here, we study the regulation of VEGF expression in neuroblastoma cell lines by serum and the growth factor IGF-I. We find that serum and serum-derived growth factors, especially IGF-I, induce VEGF expression and secretion in neuroblastoma cells through induction of HIF-1{alpha} expression via both PI3K/Akt and mitogen-activated protein kinase (MAPK) pathways. Additionally, the VHL gene, a major negative regulator of HIF-1{alpha}, is not mutated in neuroblastoma cell lines. Targeted decreases in HIF-1{alpha} expression using a HIF1-{alpha} small interfering RNA (siRNA) decrease VEGF expression, and treatment with topotecan, a drug under clinical evaluation in neuroblastoma, inhibits HIF-1{alpha} and recombinant VEGF expression in neuroblastoma cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture and reagents. One million neuroblastoma cells (SMS-KCNR, SK-N-BE2, SH-SY5Y, LAN-1, and SK-N-AS cells) per well were cultured into six-well plates in RPMI 1640 plus 10% fetal bovine serum for 8 hours. Neuroblastoma cells were shifted into serum-free RPMI 1640 for 6 hours and then treated with control medium or IGF-I (100 ng/mL) for 8 hours. Cells and medium were collected and stored as described previously (18). Cells were treated with 100 ng/mL IGF-I, 100 ng/mL epidermal growth factor (EGF), 50 ng/mL platelet-derived growth factor (PDGF), or 50 ng/mL VEGF (R&D Systems, Minneapolis, MN) for the indicated times with or without a 1-hour pretreatment of the PI3K inhibitor LY294002, MAPK kinase (MEK) inhibitor PD98059, mammalian target of rapamycin (mTOR) inhibitor rapamycin (Cell Signaling Technology, Beverly, MA), phospholipase C-{gamma} inhibitor U73122 (Sigma-Aldrich, Milwaukee, WI), or anti-IGF-IR monoclonal antibody {alpha}IR-3 (Oncogene Research Products, Darmstadt, Germany). When used, topotecan (0-200 nmol/L) was added concurrently with IGF-I or control solvent. After incubations SK-N-BE2, SK-N-AS, SMS-KCNR, or SH-SY5Y cells for 6 hours in serum-free RPMI 1640, the cells were treated with topotecan in a dose-dependent manner (0-200 µmol/L) with or without IGF-I (100 ng/mL) for 8 hours. Western and ELISA analyses (as described in Materials and Methods) for evaluation of HIF-1{alpha}, HIF-1ß, and VEGF were done.

Sequence of VHL gene. Exons 1 to 3 of the VHL gene were amplified by PCR using genomic DNA from SK-N-AS, SK-N-BE2, CHP-212, CHP-126, CHP-134B, CHP-382, CHP-404, GICAN, IMR32, SMS-KCNR, LAN-5, LAN-1, NBLS, NGP, and SK-N-DZ neuroblastoma cell lines for template as published previously (19). DNA sequencing was done using a commercially available kit (ABI Research, Oyster Bay, NY) with dideoxy terminators. Sequences were analyzed on an automated DNA sequencer (ABI) and compared with control sequence.

In vitro human umbilical vascular endothelial cell survival assay. After incubations SMS-KCNR or SH-SY5Y cells for 6 hours in serum-free RPMI 1640, the cells were treated as indicated and culture supernatants were collected, centrifuged, concentrated, and used to stimulate human umbilical vascular endothelial cells (HUVEC), which were kindly provided by Dr. Hynda Kleinman's laboratory. HUVECs (5,000 per well) were plated in 96-well tissue culture plates in medium containing growth factors (EGM medium, Clonetics Corp., San Diego, CA). After incubation for 6 hours in medium containing no growth factors (EBM medium), HUVECs were incubated at 37°C for 96 hours in conditioned medium of SMS-KCNR or SH-SY5Y neuroblastoma cells treated as indicated (50-fold concentrated supernatant, diluted 1:3 in EBM + 1% fetal bovine serum). After incubation, HUVECs were stained with trypan blue and counted. To evaluate their capacity to block endothelial cell proliferation induced by SH-SY5Y conditioned medium, a specific antibody against VEGF (Santa Cruz Biotechnology, Santa Cruz, CA) was incubated with SH-SY5Y conditioned medium.

RNA interference. The HIF-1{alpha} siRNA (AAAGGACAAGTCACCACAGGA) to target HIF-1{alpha} and a nonspecific siRNA control (AATTCTCCGAACGTGTCACGT; Qiagen, Inc., Valencia, CA) were used. One million SK-N-AS cells were transfected with HIF-1{alpha} siRNA using Lipofectamine 2000 according to the manufacturer's instructions (Invitrogen, Carlsbad, CA). After 24 hours, the cell supernatants were collected and evaluated for VEGF protein expression by ELISA, whereas the cells were lysed with 1% NP40 lysis buffer and protein expression was evaluated by Western blot analysis.

Northern blotting. Cells were harvested and total RNA was extracted using a RNeasy kit (Qiagen, Santa Clarita, CA). Northern blotting analysis of RNA (25 µg) and blotting for VEGF were done according to the protocol described previously (18).

Protein assays. Western blotting and immunoprecipitation were done as described previously (18). Antibodies used were anti-phosphotyrosine antibody, anti-Flk-1 antibody, anti-HIF-1{alpha} antibody (BD Transduction Laboratories, San Jose, CA), anti-HIF-1ß antibody (BD Transduction Laboratories), anti-phospho-mTOR antibody, anti-phospho-4E-BP1 antibody, anti-GSK-3ß antibody, anti-Akt antibody, anti-phospho-Akt antibody, anti–extracellular signal-regulated kinase (ERK) 1/2, or anti-phospho-ERK1/2 antibody (Cell Signaling Technology). For measurement of VEGF protein concentration in conditioned medium, 2 x 105 cells were incubated at 80% confluence for 24 hours in complete medium in 12-well plates. The conditioned medium of neuroblastoma cells was collected, centrifuged at 3,000 rpm for 10 minutes, and stored at –80°C. The concentration of VEGF protein was measured using ELISA kits with a mouse monoclonal antibody against VEGF according to the manufacturer's instruction.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Regulation of vascular endothelial growth factor. In neuroblastoma, VEGF is frequently expressed (8) and its expression is correlated with poor outcome of patients (7). Mutations in VHL have been shown to lead to constitutive expression of HIF-1{alpha} major regulator of VEGF expression. To determine whether the increased expression of VEGF in neuroblastoma cells may arise by mutations in VHL, exons 1 to 3 of the VHL gene were amplified by PCR in 15 neuroblastoma cell lines and sequenced. No mutations were found in the VHL gene in these cell lines.

To assess whether serum or serum-derived growth factors regulate VEGF expression, SMS-KCNR neuroblastoma cells were incubated for 8 hours in serum-free medium followed by the addition of 0.5% or 10% FCS. Such treatment resulted in a marked increase in VEGF expression as determined by ELISA (Fig. 1A). IGF-I, EGF, and PDGF stimulated increases in VEGF mRNA in SMS-KCNR neuroblastoma cells. To examine whether the IGF system contributes to FCS induction of VEGF expression, we pretreated cells with {alpha}IR-3, an anti-IGF-IR blocking antibody, and measured VEGF concentration in conditioned medium by ELISA. Serum increased the level of VEGF expression by ~4-fold and {alpha}IR-3 inhibited almost half of the increased expression. Both differences are statistically significant (P < 0.005; Fig. 1C) and indicate involvement of IGFs in serum-induced VEGF expression. IGF-I induced VEGF expression in both N-myc amplified (LAN-1 and SK-N-BE2) and single-copy N-myc (SH-SY5Y and SK-N-AS) neuroblastoma cell lines (Fig. 1D). In SK-N-AS cells compared with the other cell lines, VEGF was more highly expressed even in the absence of serum (Fig. 1D) perhaps due to the previously described IGF-II autocrine loop (13).



View larger version (25K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Serum and serum-derived growth factors regulate VEGF levels in neuroblastoma cells. A, culture medium from SMS-KCNR cells (1 x 105) incubated with indicated concentrations of FCS for 16 hours was analyzed by ELISA for VEGF expression. Columns, mean of triplicate values for each condition; bars, SD. B, Northern analysis of 25 µg total RNA from SMS-KCNR cells after stimulation of serum-deprived cells (8 hours) with serum or indicated growth factors for an additional 8 or 16 hours. 18S rRNA is shown as a loading control. C, conditioned medium from SMS-KCNR cells (1 x 105) incubated with 10% FCS in the absence or presence of 1 µg/mL {alpha}IR-3 antibody, which inhibits the IGF-IR for 16 hours, was analyzed by ELISA for VEGF expression. Columns, mean of triplicate values for each condition; bars, SD. *, P < 0.01. D, Northern analysis of VEGF mRNA levels in 25 µg total RNA from indicated neuroblastoma cell lines treated for 16 hours with IGF-I. 18S rRNA is shown as a loading control.

 
The conditioned medium of neuroblastoma cells promotes survival of human umbilical vascular endothelial cells. To determine the functional importance of IGF-induced increases in VEGF expression, we evaluated the effects of conditioned medium from IGF-I-treated neuroblastoma cells on the growth of HUVECs. HUVECs were incubated for 48 hours with either EGM, EBM (RPMI 1640 alone), conditioned medium, or IGF-I alone. Conditioned medium was obtained from the supernatants of SMS-KCNR cells treated with or without IGF-I in the presence or absence of pretreatment with an anti-VEGF neutralizing antibody. Culture of HUVECs in EBM markedly induced cell death. Although conditioned medium of SMS-KCNR cells without IGF-I treatment did not affect the cell death, conditioned medium of SMS-KCNR cells treated with IGF-I prevented ~60% HUVECs from the cell death (Fig. 2A and B). To verify that the effect of neuroblastoma conditioned medium was cell-derived VEGF, we assessed phosphorylation of Flk-1, a VEGF receptor, on HUVECs by conditioned medium. There was a basal level of Flk-1 phosphorylation from the conditioned medium of SMS-KCNR cells; however, the conditioned medium of IGF-I-treated SMS-KCNR cells markedly increased Flk-1 phosphorylation. The increase in Flk-1 phosphorylation was not due to the presence of IGF-I in the conditioned medium, as IGF-I alone did not induce Flk-1 phosphorylation (Fig. 2C, lane 5). Moreover, Flk-1 phosphorylation was completely abrogated when conditioned medium from IGF-stimulated SMS-KCNR cells was preincubated with an anti-VEGF neutralizing antibody (Fig. 2C, lane 4).



View larger version (36K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Conditioned medium from IGF-treated neuroblastoma cells stimulates HUVEC proliferation. A, morphology of HUVECs treated with EGM, EBM, conditioned medium from IGF-I-treated SMS-KCNR cells (IGF-I-NB-CM), and IGF-treated neuroblastoma conditioned medium and 1 µg/mL anti-VEGF antibody. B, assessment of cell number after indicated treatments as described in Materials and Methods. The number of cells from each treatment condition was normalized to the number of cells incubated in EGM. C, protein lysates (30 µg) from HUVECs treated under indicated conditions were immunoprecipitated with anti-Flk-1 antibody as described previously and immunoprecipitated proteins were assessed for tyrosine phosphorylation and total Flk-1 levels.

 
Both phosphatidylinositol 3-kinase/Akt pathway and mitogen-activated protein kinase pathway are involved in insulin-like growth factor-I-induced VEGF expression. Recent evidence has shown that PI3K/Akt/mTOR and MAPK pathways are involved in induction of VEGF expression by IGF-I (4, 5). IGF-I rapidly induced phosphorylation of Akt and the phosphorylation level peaked at 30 minutes to 1 hour after IGF-I treatment and then gradually diminished (Fig. 3A). The change in GSK-3 phosphorylation and mTOR phosphorylation paralleled changes in Akt phosphorylation, whereas 4E-BP1 phosphorylation remained elevated 8 hours after IGF-I treatment (Fig. 3A). In addition to Akt, ERK1/2 was also phosphorylated by IGF-I and the peak of this phosphorylation level was at 30 minutes after the treatment (Fig. 3B).



View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. IGF-I regulates VEGF levels via PI3K/mTOR and MAPK pathways. A, analysis of level of activation of downstream targets of the PI3K pathway in protein lysates from serum-starved SMS-KCNR cells incubated with IGF-I for indicated times. B, analysis of level of phosphorylated ERK and total ERK in protein lysates from serum-starved SMS-KCNR cells incubated with IGF-I for indicated times. C, Northern analysis of 25 µg total RNA from serum-deprived (8 hours) SMS-KCNR cells pretreated with control solvent or indicated inhibitor for 30 minutes followed by stimulation with IGF-I for 16 hours. 18S rRNA is shown as a loading control. D, conditioned medium from SMS-KCNR cells (1 x 105) incubated with IGF-I for 16 hours following a 30-minute preincubation with control solvent or indicated inhibitor was analyzed by ELISA for VEGF expression. Columns, mean of triplicate values for each condition; bars, SD. *, P < 0.01; {dagger}, P < 0.05; ¶, no significant difference.

 
To determine which pathway(s) contributed to IGF-I-induced VEGF expression in neuroblastoma cells, we used pharmacologic inhibitors, including PI3K inhibitor (LY294002), mTOR inhibitor (rapamycin), and MEK inhibitor (PD98059). When SMS-KCNR cells were treated with IGF-I following pretreatment with either LY294002 or rapamycin, IGF-I-induced VEGF expression was markedly inhibited at the transcriptional level (Fig. 3C). In addition, pretreatment with PD98059, the MAPK inhibitor, partially inhibited the IGF-I-induced VEGF expression (Fig. 3C). To determine which signaling pathways mediated VEGF secretion from neuroblastoma cells, the concentration of VEGF in conditioned medium of SMS-KCNR cells was measured by ELISA. IGF-I increased VEGF levels in conditioned medium by ~3-fold compared with levels in control-treated cells (Fig. 3D). Consistent with inhibition at the transcriptional level, LY294002, the PI3K inhibitor, and rapamycin blocked the IGF-I-induced VEGF protein secretion from SMS-KCNR cells. PD98059 partially inhibited but phospholipase C-{gamma} inhibitor (U73122) did not affect the VEGF secretion (Fig. 3D). These findings indicate that PI3K/Akt and MAPK pathways are involved in IGF-I-induced VEGF expression.

Induction of hypoxia-inducible factor-1{alpha} expression by insulin-like growth factor-I. Major transcriptional modulators of VEGF are dimers of HIF-1{alpha} (HIF-1{alpha} and HIF-1ß). To test whether IGF stimulated HIF-1{alpha}, cells were treated for indicated times with IGF-I and analyzed for HIF-1{alpha} expression by Western blot analysis. IGF-I stimulated a marked increase in HIF-1{alpha}, but HIF-1ß levels were unaffected (Fig. 4A). Pharmacologic inhibitors of the PI3K and mTOR blocked HIF-1{alpha} expression (Fig. 4B) but had no effect on HIF-1ß levels (data not shown).



View larger version (31K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. Regulation of HIF-1{alpha} by IGF-I in neuroblastoma cells. A, Western analysis of 30 µg total protein lysates from indicated neuroblastoma cell lines treated for 16 hours with IGF-I for HIF-1{alpha} and HIF-1ß levels. B, Western analysis of 30 µg HIF-1{alpha} levels in protein lysates of serum-starved SMS-KCNR cells treated for 16 hours with IGF-I following a 30-minute preincubation with control solvent or indicated inhibitors.

 
Hypoxia-inducible factor-1{alpha} mediates activity stimulating vascular endothelial growth factor protein expression. To directly evaluate whether HIF-1{alpha} plays a role in stimulating VEGF protein expression, we transfected a HIF-1{alpha} siRNA or a control siRNA into SK-N-AS cells and cultured for 24 hours under three conditions: in the absence of serum (0% FCS) and in the presence of 10% FCS or IGF-I (100 ng/mL). According to Western blot analysis, HIF-1{alpha} protein expression decreased 63% to 73% in cells transfected with the HIF-1{alpha} siRNA compared with cells transfected with the control siRNA (Fig. 5A and B). When VEGF protein levels were measured in the supernatants from these same samples, VEGF protein levels decreased 34% to 40% in the HIF-1{alpha} siRNA-transfected samples compared with the control siRNA-transfected samples (Fig. 5C). These results indicate that a large portion of the expression of VEGF is regulated by the levels of HIF-1{alpha}.



View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. HIF-1{alpha} mediates VEGF protein expression. A, Western analysis of 30 µg total protein lysates from indicated SK-N-AS cells for 6 hours in serum-free RPMI 1640–transfected HIF-1{alpha} siRNA with or without 10% FCS or IGF-I after 24 hours for HIF-1{alpha} and HIF-1ß levels. B, normalized HIF-1{alpha} protein expression of Fig. 4A. RDU*, relative densitometric unit. C, VEGF protein levels from the same samples were analyzed by ELISA. Columns, mean of triplicate values for each condition; bars, SD.

 
Topotecan blocks the insulin-like growth factor-I–stimulated increase in hypoxia-inducible factor-1{alpha} but not hypoxia-inducible factor-1ß and resulted in a decrease in vascular endothelial growth factor. Recent evidence indicates that camptothecins inhibit HIF-1{alpha} expression (20). To evaluate the effects of camptothecins on HIF-1{alpha} and VEGF expression, several neuroblastoma cell lines were treated with different concentrations of topotecan for 8 hours. In the four neuroblastoma cell lines examined, topotecan inhibited HIF-1{alpha} but not HIF-1ß levels (Fig. 6A). Furthermore, the levels of VEGF secreted into the medium decreased after topotecan treatment (Fig. 6B). Topotecan at 200 nmol/L also inhibited basal VEGF secretion in three of four neuroblastoma cell lines evaluated. In three of four neuroblastoma cell lines stimulated by IGF-I and treated with topotecan, there was a general dose-dependent decrease in VEGF levels, which was similar to the dose-dependent decrease in HIF-1{alpha} levels (Fig. 6C).



View larger version (36K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. Topotecan (Topo) blocks the IGF-I-stimulated increase in HIF-1{alpha} and VEGF. A, after incubating SK-N-AS, SK-N-BE2, SH-SY5Y, or SMS-KCNR cells for 6 hours in serum-free RPMI 1640, the cells were treated in topotecan dose-dependent manner (0-200 nmol/L) with or without IGF-I (100 ng/mL) for 8 hours. Western analysis of 30 µg total protein lysates from these four neuroblastoma cell lines for HIF-1{alpha} and HIF-1ß levels. B, VEGF protein levels from the same samples were analyzed by ELISA. Columns, mean of triplicate values for each condition; bars, SD. C, a fold increase of normalized HIF-1{alpha} and VEGF protein levels from Fig. 5A and B.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IGFs are important in the proliferation, survival, chemosensitivity, and motility of neuroblastoma cells (1318). In the present study, we show that serum-derived growth factors, particularly IGF-I, stimulate VEGF levels in vitro. This identifies an additional role for IGF-I in neuroblastoma tumorigenesis. Our data indicate that IGF induces VEGF expression via PI3K/Akt/mTOR pathway and that IGF induction of HIF-1{alpha} is a major mediator of this effect. The increased VEGF expression produced by IGF-treated neuroblastoma cells stimulates proliferation of vascular endothelial cells. The finding that the IGF-I-stimulated increase in VEGF was blocked by antibodies to the IGF-IR indicates that strategies aimed at targeting this receptor will not only affect neuroblastoma cell survival but also affect surrounding vasculature dependent on tumor-derived VEGF.

These findings in neuroblastoma tumor cells are similar to those reported for IGF-induced increases in VEGF in Ewing's sarcoma, another pediatric tumor of neuroectodermal origin (21), and prostate epithelial cells (22). Although it is well known that hypoxia stimulates VEGF levels, hypoxia coordinately stimulates increases in IGF-II and VEGF expression in neuroblastoma cells (10), and in tumor xenografts, hypoxic areas of tumors coexpressed VEGF and IGF-II (11). These data provide evidence that an additional role of IGFs in neuroblastoma tumor progression may be enhancement of angiogenesis via up-regulation of VEGF. Thus, strategies that target HIF-1{alpha} may reduce the angiogenic potential of neuroblastoma cells.

A major mechanism for induction of HIF-1{alpha} under hypoxic conditions is inhibition of HIF-1{alpha} degradation by inactivation of the HIF-1{alpha} ubiquitination ligase, VHL (2). DNA sequence analysis indicated that VHL is not mutated in neuroblastoma cell lines; thus, regulation of VEGF levels may be primarily modulated by external signals. Growth factors, including IGF-I, EGF, and PDGF, have been shown to induce HIF-1{alpha} expression, and we extend this observation to neuroblastoma cells. Our results indicate that in neuroblastoma cells IGF-I through the PI3K/mTOR pathway mediates increases in HIF-1{alpha}, whereas the PI3K/mTOR and MAPK pathways influence VEGF levels. This is similar to findings in colon and prostate cells (3, 4).

Although HIF-1{alpha} is a major regulator of VEGF promoter, recent studies indicate that additional transcriptional factors, such as activator protein-1, are needed to maximally stimulate VEGF expression (23, 24). In our study, we show that targeting HIF-1{alpha} using a HIF-1{alpha} siRNA results in a major reduction in VEGF protein levels. This would suggest that HIF-1{alpha} plays a part in transcriptionally regulating VEGF in neuroblastoma cells. Whether additional cis-acting regulatory regions are important in modulating the VEGF promoter in neuroblastoma cells is currently under study.

Small molecule inhibitors of key targets that regulate processes important in tumorigenesis are a major goal of current cancer therapeutic initiatives. The important role of HIF-1{alpha} in modulating VEGF expression in neuroblastoma cells led us to examine the effects of camptothecins on neuroblastoma cells. Camptothecins have been found to inhibit HIF-1{alpha} through a novel DNA replication–independent, topoisomerase I–mediated effect on HIF-1{alpha} mRNA translation (20). Using topotecan, we find inhibition of HIF-1{alpha} but not HIF-1ß in neuroblastoma cells. Additionally, topotecan causes a decrease in VEGF protein levels. The decrease in VEGF levels is similar to the decrease in HIF-1{alpha} levels in two of four neuroblastoma cell lines examined. However, at 200 nmol/L topotecan, the VEGF protein levels in all cell lines examined are decreased to background levels or below. Thus, it is possible that topotecan may have effects on VEGF expression in neuroblastoma cells that are independent of its ability to affect HIF-1{alpha} mRNA translation. Future studies are aimed at evaluating the effects of camptothecins on VEGF mRNA. Whatever the mechanism, these results indicate that camptothecins may have important effects on neuroblastoma tumors in vivo. Dose intensive trials of topotecan alone or in multimodality chemotherapeutic regimens have had minimal effects in advanced stage neuroblastoma (25). However, Kim et al. (26) have shown in a preclinical model of neuroblastoma that "low-dose pulse" topotecan either alone or with anti-VEGF therapies significantly reduces tumor growth. Our study has identified several potential target sites in the PI3K pathway as well as HIF-1{alpha}, which, if modulated using small molecule inhibitors or drugs, may be effective in regulating VEGF levels and ultimately the growth of neuroblastoma cells.


    Acknowledgments
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Dr. Hynda Kleinman and the members of her laboratory for help in endothelial proliferation assay, Choh Yeung for technical advice, and Dr. Lee Helman, and Dr. Giovanni Melillo for insightful discussions. And we thank the other members of the Cell and Molecular Biology Section for support.


    Footnotes
 
Note: K. Beppu and K. Nakamura contributed equally to this work.

Received 9/14/04. Revised 1/18/05. Accepted 3/25/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Folkman J. Fundamental concepts of the angiogenic process. Curr Mol Med 2003;3:643–51.[CrossRef][Medline]
  2. Maxwell PH, Wiesener MS, Chang GW, et al. The tumor suppressor protein VHL targets hypoxia-inducible factors for oxygen-dependent proteolysis. Nature 1999;399:271–5.[CrossRef][Medline]
  3. Fukuda R, Hirota K, Fan F, Jung YD, Ellis LM, Semenza GL. Insulin-like growth factor 1 induces hypoxia-inducible factor 1-mediated vascular endothelial growth factor expression, which is dependent on MAP kinase and phosphatidylinositol 3-kinase signaling in colon cancer cells. J Biol Chem 2002;277:38205–11.[Abstract/Free Full Text]
  4. Burroughs KD, Oh J, Barrett JC, DiAugustine RP. Phosphatidylinositol 3-kinase and mek1/2 are necessary for insulin-like growth factor-I-induced vascular endothelial growth factor synthesis in prostate epithelial cells: a role for hypoxia-inducible factor-1? Mol Cancer Res 2003;1:312–22.[Abstract/Free Full Text]
  5. Brodeur GM, Maris JM. Neuroblastoma. In: Pizzo PA, Poplack DG, editors. Principles and practice of pediatric oncology. 4th ed. Philadelphia (PA): Lippincott; 2002. p. 895–937.
  6. Meitar D, Crawford SE, Rademaker AW, Cohn SL. Tumor angiogenesis correlates with metastatic disease, N-myc amplification, and poor outcome in human neuroblastoma. J Clin Oncol 1996;14:405–14.[Abstract/Free Full Text]
  7. Eggert A, Ikegaki N, Kwiatkowski J, Zhao H, Brodeur GM, Himelstein BP. High-level expression of angiogenic factors is associated with advanced tumor stage in human neuroblastomas. Clin Cancer Res 2000;6:1900–8.[Abstract/Free Full Text]
  8. Meister B, Grunebach F, Bautz F, et al. Expression of vascular endothelial growth factor (VEGF) and its receptors in human neuroblastoma. Eur J Cancer 1999;35:445–9.
  9. Kim ES, Serur A, Huang J, et al. Potent VEGF blockade causes regression of coopted vessels in a model of neuroblastoma. Proc Natl Acad Sci U S A 2002;99:11399–404.[Abstract/Free Full Text]
  10. Jogi A, Vallon-Christersson J, Holmquist L, Axelson H, Borg A, Pahlman S. Human neuroblastoma cells exposed to hypoxia: induction of genes associated with growth, survival, and aggressive behavior. Exp Cell Res 2004;295:469–87.[CrossRef][Medline]
  11. Hedborg F, Ulleras E, Grimelius L, et al. Evidence for hypoxia-induced neuronal-to-chromaffin metaplasia in neuroblastoma. FASEB J 2003;17:598–609.[Abstract/Free Full Text]
  12. Chambery D, Mohseni-Zadeh S, de Galle B, Babajko S. N-myc regulation of type I insulin-like growth factor receptor in a human neuroblastoma cell line. Cancer Res 1999;59:2898–902.[Abstract/Free Full Text]
  13. El-Badry OM, Romanus JA, Helman LJ, Cooper MJ, Rechler MM, Israel MA. Autonomous growth of a human neuroblastoma cell line is mediated by insulin-like growth factor II. J Clin Invest 1989;84:829–39.
  14. Meyer GE, Shelden E, Kim B, Feldman EL. Insulin-like growth factor I stimulates motility in human neuroblastoma cells. Oncogene 2001;20:7542–50.[CrossRef][Medline]
  15. Gil-Ad I, Shtaif B, Luria D, Karp L, Fridman Y, Weizman A. Insulin-like-growth-factor-I (IGF-I) antagonizes apoptosis induced by serum deficiency and doxorubicin in neuronal cell culture. Growth Horm IGF Res 1999;9:458–64.[CrossRef][Medline]
  16. Matsumoto K, Lucarelli E, Minniti C, Gaetano C, Thiele CJ. Signals transduced via insulin-like growth factor I receptor (IGFR) mediate resistance to retinoic acid-induced cell growth arrest in a human neuroblastoma cell line. Cell Death Differ 1994;1:49–58.
  17. Liu X, Turbyville T, Fritz A, Whitesell L. Inhibition of insulin-like growth factor I receptor expression in neuroblastoma cells induces the regression of established tumors in mice. Cancer Res 1998;58:5432–8.[Abstract/Free Full Text]
  18. Beppu K, Jaboin J, Merchant MS, Mackall C, Thiele CJ. Anti-tumor activity of imatinib mesylate against neuroblastoma: involvement of anti-angiogenic effect via downregulation of vascular endothelial growth factor. J Nat Cancer Inst 2004;96:46–55.[Abstract/Free Full Text]
  19. Humphrey JS, Klausner RD, Linehan WM. Von Hippel-Lindau syndrome: hereditary cancer arising from inherited mutations of the VHL tumor suppressor gene. Cancer Treat Res 1996;88:13–39.[Medline]
  20. Rapisarda A, Uranchimeg B, Sordet O, Pommier Y, Shoemaker RH, Melillo G. Topoisomerase I-mediated inhibition of hypoxia-inducible factor 1: mechanism and therapeutic implications. Cancer Res 2004;64:1475–82.[Abstract/Free Full Text]
  21. Strammiello R, Benini S, Manara MC, et al. Impact of IGF-1/IGF-1R circuit on the angiogenetic properties of Ewing's sarcoma cells. Horm Metab Res 2003;35:675–84.[CrossRef][Medline]
  22. Burroughs KD, Oh J, Barrett JC, DiAugustine RP. Phosphatidylinositol 3-kinase and mek1/2 are necessary for insulin-like growth factor-I-induced vascular endothelial growth factor synthesis in prostate epithelial cells: a role for hypoxia-inducible factor-1? Mol Cancer Res 2003;1:312–22.
  23. Salnikow K, Kluz T, Costa M, et al. The regulation of hypoxic genes by calcium involves c-Jun/AP-1, which cooperates with hypoxia-inducible factor 1 in response to hypoxia. Mol Cell Biol 2002;22:1734–41.[Abstract/Free Full Text]
  24. Damert A, Ikeda E, Risau W. Activation-protein-1 binding potentiates the hypoxia-inducible factor-1-mediated hypoxia-induced transcriptional activation of vascular-endothelial growth factor expression in C6 glioma cells. Biochem J 1997;327:419–23.
  25. Blaney SM, Needle MN, Gillespie A, et al. Phase II trial of topotecan administered as 72-hour continuous infusion in children with refractory solid tumors: a collaborative Pediatric Branch, National Cancer Institute, and Children's Cancer Group Study. Clin Cancer Res 1998;2:357–60.
  26. Kim ES, Soffer SZ, Huang J, et al. Distinct response of experimental neuroblastoma to combination antiangiogenic strategies. J Pediatr Surg 2002;37:518–22.[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Clin. Endocrinol. Metab.Home page
F. M. Barlaskar, A. C. Spalding, J. H. Heaton, R. Kuick, A. C. Kim, D. G. Thomas, T. J. Giordano, E. Ben-Josef, and G. D. Hammer
Preclinical Targeting of the Type I Insulin-Like Growth Factor Receptor in Adrenocortical Carcinoma
J. Clin. Endocrinol. Metab., January 1, 2009; 94(1): 204 - 212.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
M. Puppo, F. Battaglia, C. Ottaviano, S. Delfino, D. Ribatti, L. Varesio, and M. C. Bosco
Topotecan inhibits vascular endothelial growth factor production and angiogenic activity induced by hypoxia in human neuroblastoma by targeting hypoxia-inducible factor-1{alpha} and -2{alpha}
Mol. Cancer Ther., July 1, 2008; 7(7): 1974 - 1984.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
D. Boller, A. Schramm, K. T. Doepfner, T. Shalaby, A. O. von Bueren, A. Eggert, M. A. Grotzer, and A. Arcaro
Targeting the Phosphoinositide 3-Kinase Isoform p110{delta} Impairs Growth and Survival in Neuroblastoma Cells
Clin. Cancer Res., February 15, 2008; 14(4): 1172 - 1181.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. Peddinti, R. Zeine, D. Luca, R. Seshadri, A. Chlenski, K. Cole, B. Pawel, H. R. Salwen, J. M. Maris, and S. L. Cohn
Prominent Microvascular Proliferation in Clinically Aggressive Neuroblastoma
Clin. Cancer Res., June 15, 2007; 13(12): 3499 - 3506.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. L. Martin and R. C. Baxter
Expression of Insulin-Like Growth Factor Binding Protein-2 by MCF-7 Breast Cancer Cells Is Regulated through the Phosphatidylinositol 3-Kinase/AKT/Mammalian Target of Rapamycin Pathway
Endocrinology, May 1, 2007; 148(5): 2532 - 2541.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
R. T. Kurmasheva, F. C. Harwood, and P. J. Houghton
Differential regulation of vascular endothelial growth factor by Akt and mammalian target of rapamycin inhibitors in cell lines derived from childhood solid tumors
Mol. Cancer Ther., May 1, 2007; 6(5): 1620 - 1628.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
A. Pezzolo, F. Parodi, M. V. Corrias, R. Cinti, C. Gambini, and V. Pistoia
Tumor Origin of Endothelial Cells in Human Neuroblastoma
J. Clin. Oncol., February 1, 2007; 25(4): 376 - 383.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
B. Tanno, C. Mancini, R. Vitali, M. Mancuso, H. P. McDowell, C. Dominici, and G. Raschella
Down-Regulation of Insulin-Like Growth Factor I Receptor Activity by NVP-AEW541 Has an Antitumor Effect on Neuroblastoma Cells In vitro and In vivo.
Clin. Cancer Res., November 15, 2006; 12(22): 6772 - 6780.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
K S Kimbro and J W Simons
Hypoxia-inducible factor-1 in human breast and prostate cancer.
Endocr. Relat. Cancer, September 1, 2006; 13(3): 739 - 749.
[Abstract] [Full Text] [PDF]


Home page
Integr Cancer TherHome page
M. F. McCarty and K. I. Block
Toward a Core Nutraceutical Program for Cancer Management
Integr Cancer Ther, June 1, 2006; 5(2): 150 - 171.
[Abstract] [PDF]


Home page
Cancer Res.Home page
K. Nakamura, K. C. Martin, J. K. Jackson, K. Beppu, C.-W. Woo, and C. J. Thiele
Brain-Derived Neurotrophic Factor Activation of TrkB Induces Vascular Endothelial Growth Factor Expression via Hypoxia-Inducible Factor-1{alpha} in Neuroblastoma Cells.
Cancer Res., April 15, 2006; 66(8): 4249 - 4255.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Beppu, K.
Right arrow Articles by Thiele, C. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Beppu, K.
Right arrow Articles by Thiele, C. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online