Cancer Research AACR Membership  Frontiers in Basic Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Smith, K.
Right arrow Articles by Lee, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Smith, K.
Right arrow Articles by Lee, S.
[Cancer Research 65, 5221-5230, June 15, 2005]
© 2005 American Association for Cancer Research


Cell and Tumor Biology

Silencing of Epidermal Growth Factor Receptor Suppresses Hypoxia-Inducible Factor-2–Driven VHL–/– Renal Cancer

Karlene Smith, Lakshman Gunaratnam, Melissa Morley, Aleksandra Franovic, Karim Mekhail and Stephen Lee

Department of Cellular and Molecular Medicine, Faculty of Medicine, University of Ottawa, Ottawa, Ontario, Canada

Requests for reprints: Stephen Lee, Department of Cellular and Molecular Medicine, Faculty of Medicine, University of Ottawa, 451 Smyth Road, Ottawa, Ontario, Canada K1H 8M5. Phone: 613-562-5800 ext. 8385; Fax: 613-562-5636; E-mail: slee{at}uottawa.ca.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Inactivating mutations in the von Hippel-Lindau (VHL) tumor suppressor gene are associated with clear cell renal cell carcinoma (VHL–/– RCC), the most frequent malignancy of the human kidney. The VHL protein targets the {alpha} subunits of hypoxia-inducible factor (HIF) transcription factor for ubiquitination and degradation. VHL–/– RCC cells fail to degrade HIF resulting in the constitutive activation of its target genes, a process that is required for tumorigenesis. We recently reported that HIF activates the transforming growth factor-{alpha}/epidermal growth factor receptor (TGF-{alpha}/EGFR) pathway in VHL-defective RCC cells. Here, we show that short hairpin RNA (shRNA)–mediated inhibition of EGFR is sufficient to abolish HIF-dependent tumorigenesis in multiple VHL–/– RCC cell lines. The 2{alpha} form of HIF (HIF-2{alpha}), but not HIF-1{alpha}, drives in vitro and in vivo tumorigenesis of VHL–/– RCC cells by specifically activating the TGF-{alpha}/EGFR pathway. Transient incubation of VHL–/– RCC cell lines with small interfering RNA directed against EGFR prevents autonomous growth in two-dimensional culture as well as the ability of these cells to form dense spheroids in a three-dimensional in vitro tumor assay. Stable expression of shRNA against EGFR does not alter characteristics associated with VHL loss including constitutive production of HIF targets and defects in fibronectin deposition. In spite of this, silencing of EGFR efficiently abolishes in vivo tumor growth of VHL loss RCC cells. These data identify EGFR as a critical determinant of HIF-2{alpha}-dependent tumorigenesis and show at the molecular level that EGFR remains a credible target for therapeutic strategies against VHL–/– renal carcinoma.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Inactivating mutations of the von Hippel-Lindau (VHL) tumor suppressor genes are associated with inherited VHL syndrome, of which afflicted individuals are at increased risk to develop a wide variety of neoplasms, including central nervous system hemangioblastoma and clear cell renal cell carcinoma (RCC; ref. 1). Mutations in the VHL gene are also found in the vast majority of sporadic clear cell RCC, the most frequent malignancy of the human kidney (2). Surgery remains the mainstay of treatment for kidney cancer as an incomplete understanding of the molecular mechanisms underlying this disease has limited the development of successful nonsurgical therapies (3). Consequently, the prognosis for patients with recurrent or metastasic renal cancer is often bleak with a mortality rate of 20% within 1 year of diagnosis. Hence, novel clinically relevant therapeutic approaches will directly alter the prognosis of patients with metastatic RCC.

Recent studies have yielded important clues as to the function of the VHL protein. Reintroduction of wild-type VHL in VHL-defective RCC cells prevents tumor formation in nude mice confirming the tumor suppressive function of VHL (4). VHL assembles with elongin B, C, rbx1, and cullin-2 to form and E3 ubiquitin ligase. VHL recruits the {alpha} subunits of hypoxia-inducible factor (HIF{alpha}) for cullin-2-mediated ubiquitination and subsequent degradation by the 26s proteasome (59). HIF is a transcription factor that activates an array of genes involved in cellular adaptation to hypoxia including the angiogenic vascular endothelial growth factor (VEGF; refs. 10, 11). The interaction between VHL and HIF{alpha} is regulated by oxygen tension. In the presence of oxygen (normoxia), HIF prolyl hydroxylases (PHD) hydroxylate key proline residues in the oxygen-dependent degradation domains of HIF{alpha} (1215). This post-translational modification enables recruitment of HIF by VHL to the VBC/Cul-2 complex subsequently leading to ubiquitination and degradation. The HIF PHDs are inhibited by low oxygen tension resulting in the accumulation of HIF{alpha}, assembly with the constitutively expressed HIFß and activation of HIF target genes such as VEGF and glucose transporter-1 (Glut-1). VHL-defective RCC fail to degrade HIFa regardless of oxygen tension leading to the constitutive activation of its targets. Silencing of HIF{alpha} by short hairpin RNA (shRNA) prevents VHL–/– RCC tumor formation in a nude mice xenograft assay showing that the constitutive activation of HIF targets is required for VHL-defective RCC tumorigenesis (16). VHL–/– RCC cells are also unable to form an extracellular fibronectin matrix, which is thought to play an important role in RCC development (17, 18).

Whereas the role of HIF in promoting the highly vascularized phenotype of VHL loss RCC tumors is well characterized, the mechanisms by which this transcription factor can promote tumorigenesis remain debatable (19, 20). There are two active forms of HIF{alpha} called HIF-1{alpha} and HIF-2{alpha}, which activate common as well as distinct targets (21). Recent reports have led to the suggestion that HIF-2{alpha} is the oncogenic form of HIF{alpha}, at least in human RCC (2224). This would imply that HIF-2{alpha} differs from HIF-1{alpha} in its ability to activate a specific target(s) that is involved in oncogenic growth of RCC cells. We recently reported that HIF activates the transforming growth factor-{alpha}/epidermal growth factor (TGF-{alpha}/EGFR) pathway in VHL–/– RCC cells (25). We suggested that HIF-mediated constitutive EGFR activation provides permanent self-sufficiency in growth signaling that drives the growth autonomy of VHL-defective RCC cells, a hallmark of cancer (26). In this report, we put forward an explanation for the differential oncogenic potential of HIF-2{alpha} in RCC cells by identifying TGF-{alpha} as a HIF-2{alpha}-specific target. We show that HIF-2{alpha}, but not HIF-1{alpha}, is able to promote in vitro and in vivo tumorigenesis of VHL–/– RCC cells by constitutively activating the TGF-{alpha}/EGFR oncogenic pathway. Transient and stable silencing of EGFR is sufficient to prevent HIF-2{alpha}-dependent tumorigenesis in multiple VHL–/– RCC cell lines. These data reaffirm EGFR as a crucial therapeutic target for VHL-defective renal cancer treatment.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture and reagents. Normoxic cells were incubated at 37°C under a 5% CO2 environment. Hypoxia was achieved by incubation in a hypoxic chamber at 37°C under 1% O2, 5% CO2, and N2-balanced atmosphere. VHL-deficient, 786-0 and A498 RCC cells, and HCT116 colon carcinoma cells were purchased from the American Type Culture Collection (Rockville, MD). HOP62, MCF7, SKMEL, and PC3 cells were a kind gift from John Bell (Ottawa Regional Cancer Center, Ottawa, Ontario, Canada) and U87MG cells a kind gift from Ian Lorimer (Ottawa Regional Cancer Center, Ottawa, Ontario, Canada). 786-0 and A498 cells stably transfected with HA-VHL (786-0 + VHL and A498 + VHL, respectively) were a kind from Dr. W.G. Kaelin (Harvard University, Boston, MA). KTCL140 cell line was a kind gift from Dr. Peter Ratcliffe (University of Oxford, Oxford, United Kingdom). Primary cultures of human renal cortical epithelial cells were purchased from Clonetics (San Diego, CA). Serum containing medium consisted of DMEM or McCoys 5A (HCT116) medium with 10% fetal bovine serum (FBS). Serum-free medium consisted of DMEM supplemented with 1% insulin-transferrin-selenium (Invitrogen, Burlington, Ontario, Canada). PD153035 (Calbiochem, San Diego, CA) was used as indicated. Treatment of VHL-deficient cells with antisense targeting TGF-{alpha} was carried out as previously described (27).

Adenovirus construction. Adenoviruses encoding the HIF-{alpha} mutants, VHL, GFP, and DN-HIF were generated through Cre-lox recombination as described elsewhere (25, 28). Vectors encoding HIF-{alpha} subunits mutated at proline hydroxylation sites encoding HA-HIF-2{alpha} (P405A and P531{alpha}) and HA-HIF1{alpha} (P402A and P564A) were a kind gift from Dr. W.G. Kaelin. cDNA encoding the constitutively active variants of HIF{alpha} were released by BamHI/NotI restriction digest from their original pcDNA 3.0 vector and subcloned, in-frame, downstream of a Flag-GFP moiety previously cloned into the HindIII and BamHI sites of a pAdlox adenoviral vector. DNA sequencing analysis confirmed the alanine substitutions of the targeted proline residues. Experiments used approximately equal multiplicity of infection.

RNA isolation and reverse transcription-PCR analysis. One microgram of total RNA collected using TRIPURE isolation reagent (Roche, Indianapolis, IN) was used. All primers and cycle details for reverse transcription-PCR (RT-PCR) for TGF-{alpha}, Glut-1, and actin are described elsewhere (25). Semiquantitative RT-PCR was done by taking samples after 30 amplification cycles. Products were analyzed with gel electrophoresis and ethidium bromide staining, and visualized using a Kodak Digital Science IC440 system.

For real-time RT-PCR, triplicate (25 µL) multiplex RT-PCR reactions were done on 50 ng of total RNA using Taqman One-Step RT-PCR master mix reagents (Applied Biosystems, Streetville, Ontario, Canada) and 0.25 µmol/L 5'-VIC TGF-{alpha} and 5'-6FAM actin modified probes. Cycling conditions were 30 minutes at 48°C, 10 minutes at 95°C, then 40 cycles of alternating 15 seconds at 95°C and 1 minutes at 60°C. Amplification and analysis of real-time data was done using ABI PRISM 7000 Sequence Detection System (Applied Biosystems). The quantity of TGF-{alpha} detected in each reaction tube was normalized to the level of coamplified actin endogenous control. Each RNA sample was analyzed in triplicate to obtain an average normalized quantity of TGF-{alpha} transcript (arbitrary units). TGF-{alpha} forward GCACGTCCCCGCTGAGT and TGF-{alpha} reverse CAGGTTCCATGGAAGCAGAA; TGF-{alpha} probe TTTTAATGACTGCCCAGATTCCCACACTCA; ß-actin probe CCGCCGCCCGTCCACACCCGCC. The sequences all other primers used are described elsewhere (25).

Bromodeoxyuridine labeling. Cells were plated at low density on coverslips and incubated overnight in DMEM supplemented with 10% FBS. At the start of the experiment, cells were washed and supplemented with fresh serum-containing or serum-free medium. The cells were infected with adenoviruses as indicated. After the indicated time cells were fixed and stained with an anti-bromodeoxyuridine (BrdUrd) antibody according to instructions of manufacturer (Roche). Nuclei were stained (Hoechst 33258; Sigma, St. Louis, MO) and assessed for BrdUrd incorporation using a Ziess Axiovert S100TV microscope (Thornwood, NY). Data is presented as proportion of nuclei incorporating BrdUrd.

Transforming growth factor-{alpha} ELISA. An equal number of cells were seeded approaching confluence and allowed to settle overnight in DMEM supplemented with 5% FBS. The appropriate cells were infected with adenovirus after addition of fresh culture medium. Medium and total cell lysates were collected and analyzed for TGF-{alpha} protein according to instructions of manufacturer (Oncogene, Boston, MA). Total protein concentration was determined using the bicinchoninic acid protein assay reagent (Pierce, Rockford, IL) to ensure equivalence between samples. Antisense to TGF-{alpha} experiments were as described previously (27).

Western blot. Cells were washed with PBS and harvested in 4% SDS in PBS. Samples (20-100 µg of each) were separated on denaturing polyacrylamide gels containing SDS and transferred to methanol-activated polyvinylidene difluoride membrane (NEN, Boston, MA). Membranes were blocked in skimmed milk before incubation with Flag (Sigma) or EGFR (Ab-12; LabVision, Fremont, CA) monoclonal antibodies. Polyclonal antibodies were used to detect py-EGFR (sc-12351; Santa Cruz Biotechnology, Santa Cruz, CA), HIF-2{alpha} (Novus, Littleton, CO), Glut-1 (Alpha Diagnostic International, San Antonio, TX), and actin (Sigma). After washing with 0.2% Tween-PBS solution, membranes were blotted with secondary antibodies conjugated to horseradish peroxidase (Jackson ImmunoResearch, West Grove, PA) and detected by enhanced chemiluminescence (Pierce).

Immunofluorescence. Cells were grown to confluence for 6 days on glass coverslips, washed thrice with PBS, and fixed/permeabilized in prechilled 95% ethanol at –20°C for 30 minutes. Ethanol was aspirated and residual was allowed to air dry at 4°C. Cells were stained for 1 hour at room temperature with anti-fibronectin antibody as described in (29). Staining was visualized with a Ziess Axiovert S100TV microscope.

Epidermal growth factor receptor RNA interference. For transient inhibition of EGFR mRNA production, VHL-deficient RCC cells were transfected with commercially available double-stranded 21-nucleotide-long small interfering RNA (siRNA) targeting the EGFR or a control siRNA (Ambion, Austin, TX). VHL-deficient RCC cells were also stably transfected to express one of two different shRNA sequences targeting the EGFR (30). For each sequence, two ssDNA oligonucleotides were synthesized (Invitrogen) and subsequently annealed by incubation for 3 minutes at 90°C followed by 1 hour at 50°C. ssDNA were designed with overhangs encoding restriction sites for BamHI/HindIII, and the annealed products were ligated directly into the pSilencer 3.1-H1 neo vector (Ambion). Sequence 1 (5'-3'): shRNA EGFR-1 forward GATCCAACTCTGGAGGAAAAGAAAGTTTCAAGAGAACTTTCTTTTCCTCCAGAGTTTTTTTTGGAAA and shRNA EGFR-1 reverse AGCTTTTCCAAAAAAAACTCTGGAGGAAAAGAAAGTTCTCTTGAAACTTTCTTTTCCTCCAGAGTTG. Sequence 2 (5'-3'): shRNA EGFR-2 forward GATCCAACACAGTGGAGCGAATTCCTTTCAAGAGAAGGAATTCGCTCCACTGTGTTTTTTTTGGAAA and shRNA EGFR-2 reverse AGCTTTTCCAAAAAAAACACAGTGGAGCGAATTCCTTCTCTTGAAAGGAATTCGCTCCACTGTGTTG. A pSilencer 3.1-H1 neo vector encoding random control shRNA was also purchased from Ambion. Stable clones were selected in neomycin containing medium. All transfections were conducted with Effectene transfection reagent (Qiagen, Valencia, CA). All constructs were verified by standard DNA sequencing.

In vitro tumor spheroid. Multicellular spheroids were prepared by the liquid overlay technique (3133) and as described by our group elsewhere (34). Briefly, 24-well plates were coated with 250 µL of preheated 1% Seaplaque agarose (Cambrex, Rockland, ME) in serum-free medium; 105 of indicated cells were plated per 1 mL of DMEM per well. To promote cell-cell adhesion, the plates were gently swirled (32 times) 30 minutes after plating. Spheroids were grown for 6 days at 37°C under 5% CO2 in serum-containing medium. Spheroids were harvested in lysis buffer (4% SDS in PBS) before immunoblotting. Alternatively, spheroids were fixed in 10% formaldehyde, embedded in paraffin, sectioned, mounted on slides, and stained with H&E.

Nude mouse xenograft assays. Nude mouse xenograft assays were done as described elsewhere (4). In brief, 107 viable cells (trypan dye exclusion method) were injected s.c. in the flanks of female nude mice (Charles River, Wilmington, MA). Mice injected with both control and EGFR shRNA were sacrificed 9 weeks post-injection according to facility protocol (University of Ottawa). In keeping with the Animal Facility Guidelines to examine latent tumor formation, a subset of mice was only injected with cells expressing shRNA targeting EGFR. These mice were sacrificed 16 weeks post-injection and did not exhibit any latent tumor formation. Tumor size was measured weekly, and at the time of sacrifice tumors were excised and weighed. Experiments were done blinded.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Hypoxia-inducible factor-2{alpha} specifically promotes growth autonomy of renal cell carcinoma cells. VHL loss RCC cells constitutively overproduce HIF-regulated genes as a consequence of the inability of these cells to degrade HIF{alpha} in normoxia (8). Constitutive HIF activation is required for serum-independent growth of VHL–/– RCC cells in culture as well as for tumor formation in a xenograft nude mice tumor assay (16, 25). In addition, constitutive expression of HIF-2{alpha}, but not HIF-1{alpha}, overrides VHL-mediated RCC tumor suppression (22, 24). To further investigate the role of the two HIF{alpha} forms in RCC tumorigenesis, we produced adenoviruses that express HIF-1{alpha} and HIF-2{alpha} variants that evade VHL recognition in the presence of oxygen (henceforth called HIF-1{alpha} and HIF-2{alpha}; Fig. 1A schematic). To do so, key proline residues in the ODD domain of HIF{alpha} were substituted to alanine, which prevents recognition and degradation by VHL in normoxic cells (Fig. 1A; see ref. 22). HIF{alpha} variants were expressed to similar levels and were functional as they equally promoted the accumulation of Glut-1 mRNA, a well-characterized HIF-regulated gene, in normoxic VHL-competent cells (Fig. 1A). In the absence of exogenous growth factors or serum, VHL-deficient cells are able to engage in autonomous growth, a hallmark of cellular transformation (26). Reintroduction of VHL in VHL-defective cells enables these cells to respond like primary renal epithelial cells and quiesce, a process measured by a decrease in BrdUrd incorporation (Fig. 1B; refs. 25, 35). As previously shown, dominant-negative HIF (DNHIF) abolished BrdUrd incorporation by VHL-deficient RCC cells in serum-free medium, thereby demonstrating that the observed autonomous proliferation of these RCC cells is a consequence of HIF activation (Fig. 1B; ref. 25). Addition of serum restored BrdUrd incorporation in all conditions showing that RCC cells are equally sensitive to exogenous growth factors, regardless of VHL status or HIF activation (Fig. 1B). We asked whether HIF-1{alpha} or HIF-2{alpha} activation could promote growth autonomy of RCC cells by overriding the effect of reintroduction of VHL in VHL-defective RCC cells. Expression of HIF-1{alpha} had no discernable effect on growth of VHL-competent cells in the presence or absence of serum nor did it promote cell death or dominant cell cycle arrest in the presence of serum, as reported for other cell lines (Fig. 1C; data not shown; see ref. 36). In contrast, expression of HIF-2{alpha} was sufficient to promote autonomous growth of RCC cell lines overriding the effect of stable expression of VHL (Fig. 1C). These experiments show that HIF-2{alpha}-specific transcriptional activity differs from HIF-1{alpha} and enables VHL-competent cells to engage in autonomous growth consistent with its ability to promote tumorigenesis in vivo (22).



View larger version (36K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. HIF-2{alpha} promotes autonomous growth of RCC cells. A, HIF-1{alpha} and HIF-2{alpha} variants carrying P-to-A mutations at prolyl hydroxylation sites (schematic) are both able to activate HIF target genes. VHL-deficient 786-0 cells were stably transfected to express HA-VHL and infected with adenoviruses expressing flag-tagged HIF-1{alpha}, HIF-2{alpha}, or GFP. After 48 hours post-infection immunoblotting or RT-PCR was done to detect flag protein or Glut-1 mRNA, respectively. B, HIF activation is required for serum independent growth of VHL-deficient RCCs. 786-0 cells infected to express GFP, VHL, or dominant-negative HIF were incubated for 72 hours in the absence or presence of serum and assessed for BrdUrd incorporation. Columns, average mean of at least three independent experiments in triplicates; bars, SE. C, HIF-2{alpha} but not HIF-1{alpha} is able to promote serum-independent growth in VHL-competent cells. Growth was measured in 786-0 or A498 cells deficient or competent for VHL expression (786-0 + VHL or A498 + VHL, respectively) following infection with an adenovirus encoding GFP, HIF-1{alpha}, or HIF-2{alpha}. Columns, average mean of at least three independent experiments in triplicates; bars, SE.

 
Transforming growth factor-{alpha} is a hypoxia-inducible factor-2{alpha}–specific target. Next, we wanted to uncover the mechanism by which HIF-2{alpha} differs from HIF-1{alpha} and promotes autonomous proliferation. We recently reported that overproduction of TGF-{alpha}, a bona fide epithelial cell mitogen, by RCC cells is triggered by HIF activation (25). Thus, we suspected that TGF-{alpha} might play a key oncogenic role in HIF-2{alpha}-mediated autonomous growth. As shown in Fig. 2A, TGF-{alpha} mRNA is hypoxia-inducible in primary cultures of renal epithelial cells, the cell type from which VHL loss RCC arises (1, 3739). VHL loss RCC cells overproduce TGF-{alpha} mRNA in normoxia, which can be down-regulated by the reintroduction of VHL (Fig. 2B; refs. 27, 40). Whereas HIF-1{alpha} and HIF-2{alpha} equally promoted Glut-1 transcription in normoxic VHL-competent cells, TGF-{alpha} mRNA induction was observed only in cells expressing HIF-2{alpha} (Fig. 2B). TGF-{alpha} protein was present in cellular lysates of HIF-2{alpha}-, but not HIF-1{alpha}-infected, VHL-competent cells (Fig. 2C). In addition, quantitative RT-PCR experiments showed that TGF-{alpha} is a target of endogenous, wild-type HIF-2{alpha} in hypoxic VHL-competent cells or VHL-defective RCC 786-0 cells (Supplementary Fig. S1). An RT-PCR screen revealed that TGF-{alpha} is the only known EGFR ligand to be activated by HIF-2{alpha} or by VHL loss (data not shown; see ref. 25 for the screen in VHL loss RCC cells).



View larger version (41K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Specific induction of TGF-{alpha} by HIF-2{alpha} activates the EGFR. A, hypoxic induction of TGF-{alpha} mRNA as measured by RT-PCR in primary human renal cortical epithelial cells. Real-time PCR results (bottom inset). Columns, average mean of three independent experiments in triplicates; bars, SE. B, HIF-2{alpha} but not HIF-1{alpha} induces TGF-{alpha} mRNA synthesis in VHL-competent cells. RT-PCR was used to detect TGF-{alpha} and Glut-1 in VHL-deficient A498 and 786-0 cells and in A498 and 786-0 cells that stably express reintroduced VHL (A498 + VHL and 786-0 + VHL). Cells were infected to express indicated proteins. C, HIF-2{alpha} but not HIF-1{alpha} induces TGF-{alpha} protein in VHL-competent cells. ELISA was done to detect TGF-{alpha} protein in cellular lysates and media. VHL-deficient 786-0 cells and VHL-competent 786-0 + VHL cells were infected to express the indicated proteins. D, immunoblotting detecting EGFR and phosphorylated, activated EGFR in 786-0 cells treated with PD153035, or infected to express GFP, VHL or DNHIF. Cells were incubated for 48 hours in serum-free conditions before collection of lysates. E, blockade of HIF activation or silencing of its target TGF-{alpha} reduces EGFR activation. 786-0 cells were infected to express GFP or DNHIF, or were treated with TGF-{alpha} antisense or random oligomers. Total cell lysates were submitted to anti-Py-EGFR immunoblotting. In parallel, ELISA was used to detect TGF-{alpha}. Cells were incubated for 48 hours in serum-free conditions before collection of lysates. F, HIF-2{alpha} but not HIF-1{alpha} induces EGFR activation in VHL-competent 786-0 cells. Cells were infected to express the indicated proteins and lysates were submitted to immunoblotting to detect the indicated proteins. Cells were incubated for 48 hours in serum-free conditions before collection of lysates. G, HIF-2{alpha} induces TGF-{alpha} mRNA/protein production and EGF-R activation in cancer cells from various tissue origin. Cells were infected to express HIF-1{alpha} or HIF-2{alpha} and submitted to RT-PCR analysis to detect TGF-{alpha} mRNA and to immunoblotting to detect increased phosphorylation of EGFR as described in (B), (C), and (F). Data is presented as a table for the sake of simplicity.

 
We next asked if HIF-2{alpha} was able to activate EGFR through production of TGF-{alpha} ligand. VHL-deficient 786-0 RCC cells expressing endogenous HIF-2{alpha} displayed strong EGFR phosphorylation, in the absence of exogenous growth factors (Fig. 2D). Expression of VHL or DNHIF was essentially as efficient as PD15035 at abolishing EGFR phosphorylation in VHL-deficient RCC cells. In addition, antisense-mediated inhibition of TGF-{alpha} production blocks autonomous growth of VHL-deficient cells (27) and abrogates EGFR phosphorylation (Fig. 2E). Expression of HIF-2{alpha} resulted in a marked activation of the EGFR in VHL-competent 786-0 (Fig. 2F) and A498 cells (data not shown). In contrast, HIF-1{alpha} did not activate the EGFR, further supporting the notion that HIF-1{alpha} is unable to drive the production of active EGFR ligands (Fig. 2F). HIF-2{alpha}-specific induction of TGF-{alpha} mRNA was observed in the majority of tested cancer cell lines maintained in normal oxygen tension (Fig. 2G). No significant TGF-{alpha} transcript or protein was detected in HIF-1{alpha}-expressing cells, although HIF-1{alpha} was as efficient as HIF-2{alpha} at promoting Glut-1 mRNA accumulation (Fig. 2G; data not shown). Furthermore, activation of the EGFR was observed only in cancer cell lines where HIF-2{alpha} induced TGF-{alpha} production. These results support the hypothesis that HIF-2{alpha} drives autonomous proliferation by activating EGFR through the specific production of TGF-{alpha}. The data also suggest that HIF-1{alpha} activation alone is insufficient to promote serum-free growth of VHL-competent RCC cells.

Transient silencing of epidermal growth factor receptor by small interfering RNA prevents formation of dense renal cell carcinoma tumors in vitro. We next asked whether EGFR activation plays a central role in the ability of HIF-2{alpha} to drive VHL loss RCC tumorigenesis. To do so, a panel of VHL-defective RCC cell lines was incubated in the presence of a siRNA directed against EGFR mRNA. The cell lines included the widely characterized VHL-defective RCC 786-0 and A498 cell lines. In addition, we used the KTCL140 line reported to harbor VHL inactivating mutations and overexpress HIF-2{alpha} and its targets (8). KTCL140 overproduce TGF-{alpha} and display strong EGFR phosphorylation that can be repressed by reintroduction of VHL or expression of DNHIF (data not shown; Fig. 5). The siRNA efficiently decreased levels of EGFR protein in VHL–/– RCC cells (Fig. 3A) and, importantly, prevented HIF-2{alpha}-mediated autonomous growth as efficiently as the EGFR tyrosine kinase inhibitor PD153035 for 786-0 and A498 (Fig. 3B-C). The effect of silencing EGFR on growth was restricted to serum-free conditions because addition of fresh serum abolished the growth inhibitory effect of the siRNA, as expected. These data show that the ability of HIF-2{alpha} to drive growth autonomy of VHL–/– RCC cells requires activation of EGFR.



View larger version (53K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Inhibition of EGFR does not correct other defects associated with VHL loss. A, stable inhibition of EGFR does not alter HIF-2{alpha} protein levels. Immunoblots were done to monitor HIF-2{alpha} protein levels in 786-0 or KTCL140 cells stably expressing shRNA directed against EGFR. B, stable silencing of EGFR by shRNA does not prevent activation of HIF-2{alpha}-regulated genes. RT-PCR was done from RNA isolated from the indicted clones to detect TGF-{alpha} and Glut-1 mRNA as well as actin mRNA for loading comparison. C, inhibition of EGFR does not correct defects of VHL–/– RCC cells in fibronectin matrix deposition. Immunofluorescence to detect fibronectin was as described in Material and Methods. Arrows point to fibronectin matrix only found in VHL-expressing cells.

 


View larger version (61K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Transient silencing of EGFR with siRNA prevents serum-free growth and formation of dense tumor spheroids. A, transient incubation with siRNA directed against EGFR mRNA suppresses EGFR protein production in multiple VHL-defective cells. Immunoblots were done to detect EGFR in untreated cells, cells treated with effectene, control siRNA, or siRNA against EGFR. B-C, siRNA directed against EGFR prevents serum-independent growth of multiple VHL–/– RCC cells. Cells were incubated in the presence of 10% serum or in the absence of serum for 72 hours followed by addition of serum for 48 hours. BrdUrd labeling was for 3 hours in all conditions. Transient incubation with siRNA was as described in Materials and Methods. PD153035 was added for the duration of the experiments without noticeable toxic effects. Columns, average mean of at least three independent experiments in triplicates; bars, SE. D-E, siRNA directed against EGFR prevents dense spheroid formation. In vitro tumor spheroids were produced as described in Materials and Methods for 6 days in the presence or absence of control siRNA or siRNA directed against EGFR. Histology from spheroids is visualized at a magnification of 400x. Immunoblot detection of EGFR shown in (D) was from lysates of spheroids incubated for 6 days to show inhibition of EGFR protein production by siRNA. F, density was measured at 400x magnification in four independent spheroids in at least three sections per spheroid and reported as nuclei/field. Columns, average mean of at least three independent experiments in triplicates; bars, SE.

 
VHL-deficient RCC cells, like most tumorigenic cell lines, are able to form dense tumor spheroids in vitro (33), an accepted assay that measures the tumorigenic potential of cancer cells (31, 32). This assay has also the advantage of measuring tumorigenicity in the absence of neovascularization, a variable especially important in the case of the highly angiogenic VHL–/– RCC tumors. Tumor density was measured by nuclei/field in several sections of tumor spheroids. As shown in Fig. 3E, VHL-deficient RCC cells form highly dense in vitro tumors. In contrast, VHL-competent RCC cells are characterized by a loose arrangement of cells and a significant decrease of cell density (Fig. 3F). Transient incubation with siRNA against EGFR suppressed EGFR protein levels in the spheroids (Fig. 3D) and prevented formation of dense tumors in VHL–/– RCC 786-0 and KTCL140 cell lines to levels similar to those observed with reintroduction of VHL (Fig. 3E and F). These data show that siRNA to EGFR suppresses autonomous growth and dense tumor spheroid formation as efficiently as reintroduction of VHL.

Stable silencing of epidermal growth factor receptor suppresses tumorigenesis of von Hippel-Lindau–defective renal cell carcinoma. Based on the data obtained in Fig. 3, we decided to engineer VHL–/– RCC cells with stably inactivated EGFR by expression of shRNA. For these experiments, we used the VHL–/– RCC cells 786-0, which has been extensively characterized by several other groups (4, 33, 40, 41). The 786-0 cells form tumors in nude mice, which can be suppressed by reintroduction of VHL or shRNA-mediated inhibition of HIF-2{alpha} (4, 16). Several different shRNA targeted against different regions of the EGFR mRNA were tested for their ability to efficiently suppress EGFR protein production. After initial screening of several shRNA-expressing stable clones, two different shRNAs, called shRNA1 and shRNA2, were further characterized because of their ability to mediate a stable and efficient decrease in EGFR protein levels (data not shown). VHL–/– RCC 786-0 cells stably expressing shRNA1 or shRNA2 displayed a significant decrease in EGFR protein levels compared with parental cells and cells stably expressing control scrambled shRNA (Fig. 4A). Importantly, loss of phosphorylated EGFR was also observed in shRNA-expressing cells demonstrating a near-complete loss of EGFR function (Fig. 4A). As observed with transient inhibition of EGFR, we did not notice a significant difference in two-dimensional growth in the presence of serum between parental 786-0 cells, or 786-0 cells expressing either VHL, control shRNA or shRNA against EGFR mRNA. However, shRNA-mediated inhibition of EGFR restored the ability of VHL-defective RCC cells to withdraw from the cell cycle upon serum withdrawal, a process that could be rescued by the addition of fresh serum. The ability of the shRNA against EGFR to abolish growth autonomy of VHL-defective RCC cells was similar to that observed upon reintroduction of VHL, expression of DNHIF (Fig. 4B), transient incubation with siRNA against EGFR, treatment with PD153035 (Fig. 3) or incubation with antisense oligonucleotides against TGF-{alpha} mRNA (27). EGFR protein levels and phosphorylation were also significantly diminished in the KTCL140 line stably expressing shRNA1 (Fig. 4A). The effects of suppressing EGFR expression in KTCL140 cells were very similar to those shown for 786-0 cells (data not shown). Stable silencing of EGFR by shRNA resulted in low-density spheroids formation in 786-0 and KTCL140 cells (Fig. 4C). These experiments confirm that VHL-defective 786-0 clones stably expressing shRNA directed against EGFR mRNA display significant decrease in EGFR protein level, phosphorylation status, and activity without significant dominant effect on the cell cycle in medium supplemented with exogenous growth factors. The data also suggest that observations made in 786-0 can be generalized to other VHL–/– RCC cells.



View larger version (55K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. Stable inhibition of EGFR protein and activity by shRNA in VHL–/– RCC cells. A, shRNA directed against EGFR mRNA suppresses EGFR protein levels. VHL–/– RCC 786-0 and KTCL140 were stably transfected with pSilencer expressing control shRNA (called shRNA control) or expressing shRNA1 or shRNA2 directed against EGFR mRNA (called shRNA EGFR-1 or shRNA EGFR-2, respectively). Cell lines of 786-0 cells stably expressing reintroduced VHL are denoted VHL. Immunoblots were done to detect EGFR or phosphorylated EGFR. B, stable silencing of EGFR by shRNA abolishes growth autonomy of VHL–/– RCC cells as efficiently as expression of VHL or DNHIF. VHL–/– RCC 786-0 cells infected to express GFP, VHL, or DNHIF as well as stably expressing control shRNAs or shRNA EGFR-1 or EGFR-2 were incubated in 10% serum, transferred to serum-free conditions for 72 hours followed by addition of serum for 48 hours. BrdUrd incubation was for 3 hours in each case. Similar data were obtained for KTCL140 cell line but omitted for the sake of clarity. Columns, average mean of at least three independent experiments in triplicates; bars, SE. C, stable silencing of EGFR by shRNA prevents dense tumor formation. In vitro tumor spheroids were produced as described in Materials and Methods for 6 days. Histology from spheroids is visualized at a magnification of 400x.

 
We next wanted to examine the effect of EGFR knockdown on defects associated with VHL loss. shRNA-mediated silencing of EGFR did not affect HIF-2{alpha} protein levels and its ability to activate downstream targets, such as Glut-1 and TGF-{alpha} (Fig. 5A-B). In addition, EGFR knockdown failed to restore the ability of VHL–/– RCC 786-0 cells to form a fibronectin extracellular matrix (Fig. 5C; ref. 17). Similar data were obtained with the KTCL140 cell lines stably expressing shRNA1 against EGFR (Fig. 5A; data not shown). These data indicate that RCC cells expressing shRNA against EGFR display all of the cancer-like biochemical characteristics associated with VHL loss including constitutive activation of HIF-2{alpha}-regulated genes and loss of fibronectin deposition.

Finally, we examined the effect of EGFR knockdown on the tumorigeneic potential of VHL-deficient RCC cells by injecting clones into nude mice and monitoring tumor formation for a period of 9 weeks. Parental 786-0 cells as well as 786-0 cells expressing vector alone or control shRNA cells produced large tumors detectable after 4 to 5 weeks. VHL–/– RCC cells expressing reintroduced VHL did not form tumors after 9 weeks of incubation (Fig. 6A-B). RCC 786-0 cells expressing either shRNA1 or shRNA2 directed against EGFR mRNA failed to form tumors after 9 weeks post-injection (Fig. 6A-C). It should be noted that prolong periods of incubation resulted in measurable tumor formation by VHL-competent RCC cells. In contrast, we were unable to detect small tumors in shRNA-expressing cells even after 15 weeks of incubation suggesting that EGFR knockdown abolishes latent tumor formation observed in VHL-competent RCC cells (data not shown). Similar data were obtained with VHL–/– RCC KTCL140 cells expressing shRNA1, although tumor size observed with KTCL140 cells expressing control shRNA was smaller than that observed with the 786-0 cells (Fig. 6C). These results show that shRNA-mediated silencing of EGFR phenocopies the effect of reintroduction of VHL, or silencing of HIF-2{alpha}, suggesting that EGFR is a central downstream target of HIF-dependent tumorigenesis.



View larger version (63K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. Silencing of EGFR suppresses VHL–/– RCC tumor formation. A, representative nude mice injected with VHL–/– RCC 786-0 cells expressing vector alone, reintroduced VHL (VHL), control shRNA and shRNA-1 directed against EGFR. B, average of tumor mass 9 weeks post-injection of at least four injections per cell line. In all cases, we failed to detect a tumor even after 15 weeks following injection of shRNA to EGFR-expressing VHL–/– RCC cells; thus, no statistical analysis is shown. Small tumors were detected after ~12 weeks in the cases of 786-0 cells expressing reintroduced VHL. Notice that the tumor mass is lower in the KTCL140 cells compared with 786-0. Columns, average mean of tumor weight; bars, SE. C, cell line used in this study, number of injections, number of tumors observed after 9 weeks of incubation, and average size of tumors (±SE) when detectable. Experiments were blinded.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We report that oncogenic EGFR signaling is involved in HIF-2{alpha}-dependent tumorigenesis in VHL loss RCC cells because silencing of EGFR prevents tumor formation in vivo, phenocopying the effect of HIF-2{alpha} silencing or reintroduction of VHL (4, 16). Kaelin et al. originally proposed that HIF-2{alpha} might act as an oncogene based on the ability of this transcription factor to override tumor suppression by VHL and drive tumorigenesis of human renal cancer cells (16, 22). Here, we provide a mechanistic explanation for HIF-2{alpha}-dependent tumorigenesis. We show that HIF-2{alpha} is able to promote autonomous growth of RCC cells by specifically activating the TGF-{alpha}/EGFR pathway. Silencing of EGFR is sufficient to block the oncogenic activity of HIF-2{alpha} and to prevent HIF-2{alpha}-driven tumor formation of VHL-defective RCC cells in vitro and in a xenograft nude mice assay. In stark contrast, HIF-1{alpha} fails to promote autonomous growth of RCC cells and is unable to activate the TGF-{alpha} gene or the EGFR pathway. Our previous observation that overexpression of wild-type HIF-1{alpha} induced expression of TGF-{alpha} in VHL-competent 786-0 cells is explained by accumulation of endogenous HIF-2{alpha}, likely the result of saturation of the ß-domain of VHL by overproduced wild-type HIF-1{alpha} (23). Our studies provide an explanation for the inability of this particular HIF{alpha} form to drive tumorigenesis of renal cancer cells. Inactivating mutations of the VHL gene confer a number of molecular defects to cells including improper assembly of a fibronectin matrix and constitutive HIF{alpha} activation. Despite these cellular flaws, silencing of EGFR was sufficient to block tumorigenesis overriding the effect of VHL loss, HIF-2{alpha} activation, and failed fibronectin deposition. The observation that transient or stable inactivation of EGFR prevented dense spheroids formation in the avascular in vitro tumor assay argues that suppression of tumorigenesis is not an indirect outcome of failed angiogenesis. Likewise, we showed that silencing of EGFR prevents autonomous growth of VHL-defective RCC cells providing further evidence that HIF-2{alpha} acts as an oncogene through activation of the TGF-{alpha}/EGFR pathway. It is also noteworthy that TGF-{alpha} expression can be induced by hypoxia in primary cultures of human renal epithelial cells, the cell type thought to give rise to RCC. We thus propose that VHL loss and subsequent HIF-2{alpha} activation, observed in early multicellular lesions of the distal nephrons, results in aberrant growth by eliciting permanent EGFR signaling by way of TGF-{alpha} activation (37). These data also explain why HIF-1{alpha} is not tumorigenic in RCC, which is most likely the consequence of the inability of this HIF{alpha} subunit to activate TGF-{alpha}/EGFR pathway. Immunohistochemical studies have shown expression of HIF-2{alpha}, but not HIF-1{alpha}, in premalignant multicellular foci in nephrons upon VHL loss, which is consistent with the inability of HIF-1{alpha} to drive EGFR activation and proliferation (24, 37). We therefore suggest that the oncogenic activity of HIF-2{alpha} is linked to its ability to activate TGF-{alpha}/EGFR pathway.

Hanahan and Weinberg proposed that the malignant phenotype is the manifestation of six essential alterations in cell physiology called hallmarks of cancer (26). Oncogenic dysregulation or environmental activation of HIF-2{alpha} may play a central role in at least two of these hallmarks. First, HIF-2{alpha} activation provides an environment of continued production of endogenous growth factor (TGF-{alpha}) and permanent EGFR signaling reducing the dependence of cancer cells on exogenous growth factors to maintain proliferation. Therefore, HIF-2{alpha}-expressing cells acquire the ability to engage in permanent EGFR signaling, which provides the necessary cellular milieu for growth autonomy. Whereas these data were obtained from renal cancer cells, we suggest that HIF-2{alpha} activation and subsequent EGFR signaling may have a broad implication in human malignancies. HIF-2{alpha} is induced in the vast majority of human cancer as a consequence of altered microenvironment conditions (e.g., hypoxia and acidosis) found in the core of tumors (34, 42). TGF-{alpha} overexpression and oncogenic dysregulation of EGFR activity are common features of human malignancies and are thought to provide permanent self-sufficiency in growth signaling that drives growth autonomy of cancer cells. Whereas still unproven, TGF-{alpha}/EGFR activation found in many tumors may be rationalized by HIF-2{alpha} activation and may explain why the hypoxic core of tumors is associated with increased probability of metastasis and poor prognosis. This hypothesis is supported by data shown in this report, which suggest that HIF-2{alpha} activation drives TGF-{alpha} production and EGFR activation in human cancer cell lines from different tissue origins. Second, although the data presented here focuses on the oncogenic potential of HIF-2{alpha}, its role in tumor angiogenesis has been previously well documented. HIF-2{alpha}, in cooperation with HIF-1{alpha}, activates genes such as VEGF and TGF-ß to sustain proper tumor vascularization required for growth and metastasis, another hallmark of tumorigenesis.

Lastly, the data shown here supports the hypothesis that HIF-2{alpha} acts as an oncogene in VHL loss RCC by promoting EGFR signaling. VHL loss is associated with several cancer-like defects and HIF-2{alpha} activates an array of genes in RCC, some of which have generated interest as potential therapeutic targets to treat patients afflicted with RCC (4345). The results shown here argue that the EGFR should remain a prime and bona fide therapeutic target for nonsurgical treatment of VHL-defective RCC. Consistent with our data, preclinical trials testing the effect of EGFR inhibitors in RCC have yielded encouraging results (46, 47). Whereas there have not been any large-scale randomized trials monitoring the effect of multiple EGFR inhibitors specifically targeting VHL loss RCC, a recent phase II trial of Gefitinib (Iressa) in stage IV or recurrent renal carcinoma did not alter outcome in those patients (48). One obvious explanation is that blocking EGFR phosphorylation is insufficient to prevent tumor growth of advance primary or metastasic RCC, which tumor cells may use alternative growth stimulatory pathways. Another possibility is that HIF-2{alpha}-mediated activation of the EGFR confers altered biochemical properties to receptor rendering it refractory to the inhibitory effect of these small molecules. Nonetheless, given that all cell lines used in this study were derived from patients with RCC, our findings support the search for effective therapies that target the EGFR pathway in RCC.


    Acknowledgments
 
Grant support: Cancer Research Society of Canada (S. Lee), Canadian Institute of Health Research (S. Lee), National Cancer Institute of Canada Harold. E. Johns award (S. Lee), Natural Science and Engineering Research Council of Canada studentships (M. Morley, A. Franovic, and K. Mekhail), and Ontario Graduate Scholarship program (K. Smith).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Christine Lavigne and Erika Sanger for their expert technical help.


    Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

K. Smith and L. Gunaratnam contributed equally to this work.

Received 1/18/05. Revised 3/29/05. Accepted 4/ 6/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Kaelin WG. Molecular basis of the VHL hereditary cancer syndrome. Nat Rev Cancer 2002;2:673–82.[CrossRef][Medline]
  2. Gnarra JR, Tory K, Weng Y, et al. Mutations of the VHL tumour suppressor gene in renal carcinoma. Nat Genet 1994;7:85–90.[CrossRef][Medline]
  3. Bukowski RM, Novick AC. Renal cell carcinoma: molecular biology, immunology, and clinical management. 1st ed. New Jersey: Humana Press Inc.; 2000.
  4. Iliopoulos O, Kibel A, Gray S, Kaelin WG Jr. Tumour suppression by the human von Hippel-Lindau gene product. Nat Med 1995;1:822–6.[CrossRef][Medline]
  5. Clifford SC, Astuti D, Hooper L, Maxwell PH, Ratcliffe PJ, Maher ER. The pVHL-associated SCF ubiquitin ligase complex: molecular genetic analysis of elongin B and C, Rbx1 and HIF-1{alpha} in renal cell carcinoma. Oncogene 2001;20:5067–74.[CrossRef][Medline]
  6. Iwai K, Yamanaka K, Kamura T, et al. Identification of the von Hippel-Lindau tumor-suppressor protein as part of an active E3 ubiquitin ligase complex. Proc Natl Acad Sci U S A 1999;96:12436–41.[Abstract/Free Full Text]
  7. Kamura T, Koepp DM, Conrad MN, et al. Rbx1, a component of the VHL tumor suppressor complex and SCF ubiquitin ligase. Science 1999;284:657–61.[Abstract/Free Full Text]
  8. Maxwell PH, Wiesener MS, Chang GW, et al. The tumour suppressor protein VHL targets hypoxia-inducible factors for oxygen-dependent proteolysis. Nature 1999;399:271–5.[CrossRef][Medline]
  9. Ohh M, Park CW, Ivan M, et al. Ubiquitination of hypoxia-inducible factor requires direct binding to the ß-domain of the von Hippel-Lindau protein. Nat Cell Biol 2000;2:423–7.[CrossRef][Medline]
  10. Pugh CW, Ratcliffe PJ. Regulation of angiogenesis by hypoxia: role of the HIF system. Nat Med 2003;9:677–84.[CrossRef][Medline]
  11. Semenza GL. HIF-1 and mechanisms of hypoxia sensing. Curr Opin Cell Biol 2001;13:167–71.[CrossRef][Medline]
  12. Epstein AC, Gleadle JM, McNeill LA, et al. C. elegans EGL-9 and mammalian homologs define a family of dioxygenases that regulate HIF by prolyl hydroxylation. Cell 2001;107:43–54.[CrossRef][Medline]
  13. Ivan M, Kondo K, Yang H, et al. HIF{alpha} targeted for VHL-mediated destruction by proline hydroxylation: implications for O2 sensing. Science 2001;292:464–8.[Abstract/Free Full Text]
  14. Bruick RK, McKnight SL. A conserved family of prolyl-4-hydroxylases that modify HIF. Science 2001;294:1337–40.[Abstract/Free Full Text]
  15. Jaakkola P, Mole DR, Tian YM, et al. Targeting of HIF-{alpha} to the von Hippel-Lindau ubiquitylation complex by O2-regulated prolyl hydroxylation. Science 2001;292:468–72.[Abstract/Free Full Text]
  16. Kondo K, Kim WY, Lechpammer M, Kaelin WG Jr. Inhibition of HIF2{alpha} is sufficient to suppress pVHL-defective tumor growth. PLoS Biol 2003;1:E83.[Medline]
  17. Ohh M, Yauch RL, Lonergan KM, et al. The von Hippel-Lindau tumor suppressor protein is required for proper assembly of an extracellular fibronectin matrix. Mol Cell 1998;1:959–68.[CrossRef][Medline]
  18. Stickle NH, Chung J, Klco JM, Hill RP, Kaelin WG Jr, Ohh M. pVHL modification by NEDD8 is required for fibronectin matrix assembly and suppression of tumor development. Mol Cell Biol 2004;24:3251–61.[Abstract/Free Full Text]
  19. Rathmell WK, Hickey MM, Bezman NA, Chmielecki CA, Carraway NC, Simon MC. In vitro and in vivo models analyzing von Hippel-Lindau disease-specific mutations. Cancer Res 2004;64:8595–603.[Abstract/Free Full Text]
  20. Mack FA, Rathmell WK, Arsham AM, Gnarra J, Keith B, Simon MC. Loss of pVHL is sufficient to cause HIF dysregulation in primary cells but does not promote tumor growth. Cancer Cell 2003;3:75–88.[CrossRef][Medline]
  21. Sowter HM, Raval R, Moore J, Ratcliffe PJ, Harris AL. Predominant role of hypoxia-inducible transcription factor (Hif)-1{alpha} versus Hif-2{alpha} in regulation of the transcriptional response to hypoxia. Cancer Res 2003;63:6130–4.[Abstract/Free Full Text]
  22. Kondo K, Klco J, Nakamura E, Lechpammer M, Kaelin WG Jr. Inhibition of HIF is necessary for tumor suppression by the von Hippel-Lindau protein. Cancer Cell 2002;1:237–46.[CrossRef][Medline]
  23. Seagroves T, Johnson RS. Two HIFs may be better than one. Cancer Cell 2002;1:211–3.[CrossRef][Medline]
  24. Maranchie JK, Vasselli JR, Riss J, Bonifacino JS, Linehan WM, Klausner RD. The contribution of VHL substrate binding and HIF1-{alpha} to the phenotype of VHL loss in renal cell carcinoma. Cancer Cell 2002;1:247–55.[CrossRef][Medline]
  25. Gunaratnam L, Morley M, Franovic A, et al. Hypoxia inducible factor activates the transforming growth factor-{alpha}/epidermal growth factor receptor growth stimulatory pathway in VHL(–/–) renal cell carcinoma cells. J Biol Chem 2003;278:44966–74.[Abstract/Free Full Text]
  26. Hanahan D, Weinberg RA. The hallmarks of cancer. Cell 2000;100:57–70.[CrossRef][Medline]
  27. de Paulsen N, Brychzy A, Fournier MC, et al. Role of transforming growth factor-{alpha} in von Hippel-Lindau (VHL)(–/–) clear cell renal carcinoma cell proliferation: a possible mechanism coupling VHL tumor suppressor inactivation and tumorigenesis. Proc Natl Acad Sci U S A 2001;98:1387–92.[Abstract/Free Full Text]
  28. Groulx I, Lee S. Oxygen-dependent ubiquitination and degradation of hypoxia-inducible factor requires nuclear-cytoplasmic trafficking of the von Hippel-Lindau tumor suppressor protein. Mol Cell Biol 2002;22:5319–36.[Abstract/Free Full Text]
  29. Bonicalzi ME, Groulx I, de Paulsen N, Lee S. Role of exon 2-encoded ß-domain of the von Hippel-Lindau tumor suppressor protein. J Biol Chem 2001;276:1407–16.[Abstract/Free Full Text]
  30. Nagy P, Arndt-Jovin DJ, Jovin TM. Small interfering RNAs suppress the expression of endogenous and GFP-fused epidermal growth factor receptor (erbB1) and induce apoptosis in erbB1-overexpressing cells. Exp Cell Res 2003;285:39–49.[CrossRef][Medline]
  31. Sutherland RM. Cell and environment interactions in tumor microregions: the multicell spheroid model. Science 1988;240:177–84.[Abstract/Free Full Text]
  32. Kunz-Schughart LA, Kreutz M, Knuechel R. Multicellular spheroids: a three-dimensional in vitro culture system to study tumour biology. Int J Exp Pathol 1998;79:1–23.[CrossRef][Medline]
  33. Lieubeau-Teillet B, Rak J, Jothy S, Iliopoulos O, Kaelin W, Kerbel RS. von Hippel-Lindau gene-mediated growth suppression and induction of differentiation in renal cell carcinoma cells grown as multicellular tumor spheroids. Cancer Res 1998;58:4957–62.[Abstract/Free Full Text]
  34. Mekhail K, Gunaratnam L, Bonicalzi ME, Lee S. HIF activation by pH-dependent nucleolar sequestration of VHL. Nat Cell Biol 2004;6:642–7.[CrossRef][Medline]
  35. Pause A, Lee S, Lonergan KM, Klausner RD. The von Hippel-Lindau tumor suppressor gene is required for cell cycle exit upon serum withdrawal. Proc Natl Acad Sci U S A 1998;95:993–8.[Abstract/Free Full Text]
  36. Koshiji M, Kageyama Y, Pete EA, Horikawa I, Barrett JC, Huang LE. HIF-1{alpha} induces cell cycle arrest by functionally counteracting Myc. EMBO J 2004;23:1949–56.[CrossRef][Medline]
  37. Mandriota SJ, Turner KJ, Davies DR, et al. HIF activation identifies early lesions in VHL kidneys: evidence for site-specific tumor suppressor function in the nephron. Cancer Cell 2002;1:459–68.[CrossRef][Medline]
  38. Everitt JI, Walker CL, Goldsworthy TW, Wolf DC. Altered expression of transforming growth factor-{alpha}: an early event in renal cell carcinoma development. Mol Carcinog 1997;19:213–9.[CrossRef][Medline]
  39. Gomella LG, Sargent ER, Wade TP, Anglard P, Linehan WM, Kasid A. Expression of transforming growth factor {alpha} in normal human adult kidney and enhanced expression of transforming growth factors {alpha} and ß 1 in renal cell carcinoma. Cancer Res 1989;49:6972–5.[Abstract/Free Full Text]
  40. Knebelmann B, Ananth S, Cohen HT, Sukhatme VP. Transforming growth factor {alpha} is a target for the von Hippel-Lindau tumor suppressor. Cancer Res 1998;58:226–31.[Abstract/Free Full Text]
  41. Koochekpour S, Jeffers M, Wang PH, et al. The von Hippel-Lindau tumor suppressor gene inhibits hepatocyte growth factor/scatter factor-induced invasion and branching morphogenesis in renal carcinoma cells. Mol Cell Biol 1999;19:5902–12.[Abstract/Free Full Text]
  42. Talks KL, Turley H, Gatter KC, et al. The expression and distribution of the hypoxia-inducible factors HIF-1{alpha} and HIF-2{alpha} in normal human tissues, cancers, and tumor-associated macrophages. Am J Pathol 2000;157:411–21.[Abstract/Free Full Text]
  43. Ratcliffe PJ, Pugh CW, Maxwell PH. Targeting tumors through the HIF system. Nat Med 2000;6:1315–6.[CrossRef][Medline]
  44. Semenza GL. Targeting HIF-1 for cancer therapy. Nat Rev Cancer 2003;3:721–32.[CrossRef][Medline]
  45. Giaccia A, Siim BG, Johnson RS. HIF-1 as a target for drug development. Nat Rev Drug Discov 2003;2:803–11.[CrossRef][Medline]
  46. Weber KL, Doucet M, Price JE, Baker C, Kim SJ, Fidler IJ. Blockade of epidermal growth factor receptor signaling leads to inhibition of renal cell carcinoma growth in the bone of nude mice. Cancer Res 2003;63:2940–7.[Abstract/Free Full Text]
  47. Dancey JE. Epidermal growth factor receptor and epidermal growth factor receptor therapies in renal cell carcinoma: do we need a better mouse trap? J Clin Oncol 2004;22:2975–7.[Free Full Text]
  48. Drucker B, Bacik J, Ginsberg M, et al. Phase II trial of ZD1839 (IRESSA) in patients with advanced renal cell carcinoma. Invest New Drugs 2003;21:341–5.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
Z. S. Morris and A. I. McClatchey
Aberrant epithelial morphology and persistent epidermal growth factor receptor signaling in a mouse model of renal carcinoma
PNAS, June 16, 2009; 106(24): 9767 - 9772.
[Abstract] [Full Text] [PDF]


Home page
Acta Biochim Biophys SinHome page
D. He and B. Fang
Small hairpin RNA targeting at Bcl-2 increases cytarabine-induced apoptosis in Raji cells
Acta Biochim Biophys Sin, February 1, 2009; 41(2): 131 - 136.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
F. Pistollato, H.-L. Chen, B. R. Rood, H.-Z. Zhang, D. D'Avella, L. Denaro, M. Gardiman, G. te Kronnie, P. H. Schwartz, E. Favaro, et al.
Hypoxia and HIF1{alpha} Repress the Differentiative Effects of BMPs in High-Grade Glioma
Stem Cells, January 1, 2009; 27(1): 7 - 17.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Pan, J. Yu, L. Zhang, A. Carpenter, H. Zhu, L. Li, D. Ma, and J. Yuan
A Novel Small Molecule Regulator of Guanine Nucleotide Exchange Activity of the ADP-ribosylation Factor and Golgi Membrane Trafficking
J. Biol. Chem., November 7, 2008; 283(45): 31087 - 31096.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Bommi-Reddy, I. Almeciga, J. Sawyer, C. Geisen, W. Li, E. Harlow, W. G. Kaelin Jr, and D. A. Grueneberg
Kinase requirements in human cells: III. Altered kinase requirements in VHL-/- cancer cells detected in a pilot synthetic lethal screen
PNAS, October 28, 2008; 105(43): 16484 - 16489.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
A. Ravaud, R. Hawkins, J. P. Gardner, H. von der Maase, N. Zantl, P. Harper, F. Rolland, B. Audhuy, J.-P. Machiels, F. Petavy, et al.
Lapatinib Versus Hormone Therapy in Patients With Advanced Renal Cell Carcinoma: A Randomized Phase III Clinical Trial
J. Clin. Oncol., May 10, 2008; 26(14): 2285 - 2291.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Khacho, K. Mekhail, K. Pilon-Larose, J. Payette, and S. Lee
Cancer-Causing Mutations in a Novel Transcription-Dependent Nuclear Export Motif of VHL Abrogate Oxygen-Dependent Degradation of Hypoxia-Inducible Factor
Mol. Cell. Biol., January 1, 2008; 28(1): 302 - 314.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Franovic, L. Gunaratnam, K. Smith, I. Robert, D. Patten, and S. Lee
Translational up-regulation of the EGFR by tumor hypoxia provides a nonmutational explanation for its overexpression in human cancer
PNAS, August 7, 2007; 104(32): 13092 - 13097.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
L. Li, L. Zhang, X. Zhang, Q. Yan, Y. A. Minamishima, A. F. Olumi, M. Mao, S. Bartz, and W. G. Kaelin Jr.
Hypoxia-Inducible Factor Linked to Differential Kidney Cancer Risk Seen with Type 2A and Type 2B VHL Mutations
Mol. Cell. Biol., August 1, 2007; 27(15): 5381 - 5392.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
W. G. Kaelin Jr.
The von Hippel-Lindau Tumor Suppressor Protein and Clear Cell Renal Carcinoma
Clin. Cancer Res., January 15, 2007; 13(2): 680s - 684s.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. Jones and T. A. Libermann
Genomics of Renal Cell Cancer: The Biology Behind and the Therapy Ahead
Clin. Cancer Res., January 15, 2007; 13(2): 685s - 692s.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Franovic, I. Robert, K. Smith, G. Kurban, A. Pause, L. Gunaratnam, and S. Lee
Multiple Acquired Renal Carcinoma Tumor Capabilities Abolished upon Silencing of ADAM17
Cancer Res., August 15, 2006; 66(16): 8083 - 8090.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
V. H. Haase
Hypoxia-inducible factors in the kidney
Am J Physiol Renal Physiol, August 1, 2006; 291(2): F271 - F281.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. S. Lutz and R. D. Burk
Primary cilium formation requires von hippel-lindau gene function in renal-derived cells.
Cancer Res., July 15, 2006; 66(14): 6903 - 6907.
[Abstract] [Full Text] [PDF]


Home page
Sci SignalHome page
J. A. Garcia
HIFing the Brakes: Therapeutic Opportunities for Treatment of Human Malignancies
Sci. Signal., May 30, 2006; 2006(337): pe25 - pe25.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Smith, K.
Right arrow Articles by Lee, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Smith, K.
Right arrow Articles by Lee, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online