Cancer Research SABCS  EMT and Cancer Progression and Treatment
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hallak, L. K.
Right arrow Articles by Russell, S. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hallak, L. K.
Right arrow Articles by Russell, S. J.
[Cancer Research 65, 5292-5300, June 15, 2005]
© 2005 American Association for Cancer Research


Experimental Therapeutics, Molecular Targets, and Chemical Biology

Targeted Measles Virus Vector Displaying Echistatin Infects Endothelial Cells via {alpha}vß3 and Leads to Tumor Regression

Louay K. Hallak1, Jaime R. Merchan2, Chris M. Storgard1, Joseph C. Loftus3 and Stephen J. Russell1

1 Molecular Medicine Program and 2 Department of Oncology, Mayo Clinic, Rochester, Minnesota and 3 Biochemistry and Molecular Biology, Mayo Clinic, Scottsdale, Arizona

Requests for reprints: Stephen J. Russell, Molecular Medicine Program, Mayo Clinic, 200 First Street Southwest, Rochester, MN 55905. Phone: 507-284-5373; Fax: 507-284-8388; E-mail: sjr{at}mayo.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Targeting tumor-associated vascular endothelium by replication-competent viral vectors is a promising strategy for cancer gene therapy. Here we describe the development of a viral vector based on the Edmonston vaccine strain of measles virus targeted to integrin {alpha}vß3, which is expressed abundantly on activated but not quiescent vascular endothelium. We displayed a disintegrin, M28L echistatin that binds with a high affinity to integrin {alpha}vß3 on the COOH terminus of the viral attachment (H) protein and rescued the replication-competent recombinant virus by reverse genetics. The new targeted virus was named measles virus echistatin vector (MV-ERV). Its native binding to CD46 was purposefully retained to allow virus infection of tumor cells expressing this receptor. MV-ERV correctly displayed echistatin on the outer surface of its envelope and produced interesting ring formation phenomena due to cell detachment upon infection of susceptible Vero cells in vitro. MV-ERV grew to 106 plaque-forming units/mL, slightly lower than the parental Edmonston strain of measles virus (MV-Edm), but it selectively infected Chinese hamster ovary cells expressing integrin {alpha}vß3. It also selectively infected both bovine and human endothelial cells on matrigels and unlike MV-Edm, MV-ERV infected newly formed blood vessels in chorioallantoic membrane assays. In animal models, MV-ERV but not the control MV-Edm caused the regression of s.c. xenografts of resistant multiple myeloma tumors (MM1) in severe combined immunodeficient mice. The tumors were either completely eradicated or their growth was significantly retarded. The specificity, potency, and feasibility of MV-ERV infection clearly show the potential use of MV-ERV in gene therapy for targeting tumor-associated vasculature for the treatment of solid tumors.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Exploiting the oncolytic properties of certain viruses, such as measles virus, provides a promising alternative approach for the treatment of cancers. Measles virus is an enveloped negative strand RNA virus that belongs to the Morbillivirus genus of the Paramyxoviridae family. Measles virus has long been suspected to have oncolytic properties against Hodgkin's (16) and non-Hodgkin's lymphomas (7, 8). These properties have later been confirmed using the Edmonston vaccine strain of measles viruses (912). Resistant multiple myeloma MM1 xenografts in animals were completely eradicated by a combination of treatment with untargeted recombinant MV-Edm expressing the sodium iodide symporter, MV-NIS, followed by radiotherapy (13). The vaccine strain MV-Edm can infect human nucleated cell types in cell culture through CD46 (1417) and it can also infect cells via CDw150 (also called signaling lymphocyte activation molecule, SLAM) receptor (18).

Integrin {alpha}vß3 is expressed on activated but not quiescent endothelial cells (19). Therefore, it has been explored as a target receptor on tumor-associated vascular endothelium as an approach to prevent angiogenesis and tumor growth. In vivo selected peptides that bind integrin {alpha}vß3 coupled to anticancer drugs were shown to induce tumor regression (20). Even uncoupled antagonists against integrin {alpha}vß3 such as cyclic RGD peptides or antibodies can induce apoptosis of proliferating endothelial cells and lead to regression of tumors (21) or decrease of angiogenesis in rheumatoid arthritis models in animals (22). Coupling nanoparticles to an integrin {alpha}vß3–targeting polymer was used to selectively deliver a mutant Raf kinase gene to proliferating endothelial cells that subsequently caused tumors to regress (23). Other examples of targeted peptide interaction with integrin {alpha}vß3 strategies have been reviewed (24, 25). Radioligand-binding filtration assays have shown that short RGD-containing peptides such as acPenRGD, cycloRGDdFV, and GRGDdSP (IC50 = 1,280, 2,380, and 6,730 nmol/L, respectively) are at least 1,000-fold less potent than the disintegrin echistatin (IC50 = 1.1 nmol/L) for binding RGD-dependent integrins on fibroblast cells. The specific binding affinity (Ki) of GRGDdSP to integrin {alpha}vß3 has been measured at 4,300 nmol/L compared with only 1.7 nmol/L for echistatin (26).

Echistatin is a 49-residue RGD-containing peptide that binds to integrins {alpha}vß3 (27) and {alpha}5ß1. Replacement of M28 with Leu28 selectively reduces the binding of echistatin to integrin {alpha}5ß1 (28). Echistatin has been exploited to target integrin {alpha}vß3 for different purposes. For example, it has been shown to bind human umbilical vein endothelial cells (HUVEC) through {alpha}vß3 and to block HUVEC binding to immobilized vitronectin and fibronectin (29). It has also been shown to inhibit the adhesion of murine melanoma cells to extracellular matrix components (30) and it has been used in conjugation with microbubbles directed to integrin {alpha}vß3 for detection and imaging of tumor angiogenesis by contrast ultrasound (31) techniques.

Two proteins project from the measles viral envelope: the fusion protein (F) and the attachment (H) glycoprotein. Both proteins are required for infection and subsequent cell-to-cell fusion, but the determinants of receptor specificity are located on the H protein of the virus (32). Therefore, we developed a targeted form of measles virus to target and destroy tumor cells and their associated proliferating endothelial cells. The dual targeting of the new vector was achieved by displaying a synthetic mutant form of the snake venom peptide echistatin on the COOH terminus of the viral attachment H protein. This peptide binds to integrins expressed on endothelial cells during angiogenesis (33, 34) and several tumor types including some multiple myeloma cells (35). Therefore, targeting of activated endothelial cells in this vector is mediated by the usage of integrin {alpha}vß3 via echistatin binding and targeting of tumors is mediated by the native CD46-binding capability of the virus.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture. Vero, 293-3-46, CHO-K1, and CHO-{alpha}vß3 were maintained in DMEM supplemented with 10% fetal bovine serum (FBS) at 37°C in a humidified incubator. CHO-{alpha}vß3 cells were generated as described (36) and maintained under 1 mg/mL G418. Cow pulmonary artery endothelial (CPAE) cells were a generous gift from Vikas Sukhatme.] and were maintained in DMEM supplemented with 10% FBS and 1% penicillin/streptomycin. HUVECs were obtained from Clontech Lab, Inc. (Palo Alto, CA) and used between passages 3 and 5. They were maintained in EGM2-MV medium (Clontech Lab) that contains endothelial basal medium (EBM-2) supplemented with 5% FBS, gentamicin, amphotericin B, hydrocortisone, ascorbic acid, and the following growth factors: vascular endothelial growth factor (VEGF), basic fibroblast growth factor (bFGF), hEGF, and insulin-like growth factor-I. Cells were grown at 37°C in a humidified incubator with 5% CO2. Cells were grown to 80% to 90% confluency, harvested with trypsin, and resuspended to the cell density required for each assay. MM1 multiple myeloma cells were provided by Dr. D. Dingli (Mayo Clinic, Rochester, MN) and were maintained in RPMI 1640 supplemented with 10% FBS at 37°C.

Cotransfection of viral fusion protein and chimeric or wild-type attachment protein. Vero, Chinese hamster ovary (CHO), or CHO-{alpha}vß3 cells (2 x 105) were seeded in each well of 6-well plates. After overnight incubation, cells were cotransfected with 5 µg pCGF, an expression plasmid for the viral F protein and equal amount of pCGH or pCGH-echistain using calcium phosphate precipitation method. Twenty-four to 48 hours post-transfection, growth medium was removed, cells monolayers were fixed with 4% paraformaldehyde for 15 minutes, washed, and stained with 0.1% crystal violet solution 2% ethanol.

Reconstruction of the echistatin gene. Echistatin amino acid sequence was reverse translated from the following sequence: Glu-Cys-Glu-Ser-Gly-Pro-Cys-Cys-Arg-Asn-Cys-Lys-Phe-Leu-Lys-Glu-Gly-Thr-Ile-Cys-Lys-Arg-Ala-Arg-Gly-Asp-Asp-Met-Asp-Asp-Tyr-Cys-Asn-Gly-Lys-Thr-Cys-Asp-Cys-Pro-Arg-Asn-Pro-His-Lys-Gly-Pro-Ala-Thr to DNA sequence using Vector NTI software (Invitrogen Corp., Carlsbad, CA), with substitution of residue Met28 (italics, underlined) from methionine to leucine. The gene with flanking cohesive ends for AscI and BstBI restriction enzymes was generated entirely by oligonucleotide synthesis and was provided as a generous gift by Integrated DNA Technologies (Coralville, IA). The 163-nucleotide sense strand was synthesized as 5' proximal 91-mer oligonucleotide (5'-CGCGCCATGAATGCGAATCAGGTCCATGCTGTCGTAACTGCAAGTTCCTTAAGGAAGGTACCATCTGTAAGCGCGCACGTGGTGATGATCT) and 5'-phosphorylated 72-mer oligonucleotide (5'-pCGACGACTACTGCAACGGTAAGACCTGTGACTGCCCGAGAAACCCACACAAGGGTCCAGCTACCTGATGATT). The 161-nucleotide antisense strand was synthesized as 5' proximal 66-mer oligonucleotide (5'-CGAATCATCAGGTAGCTGGACCCTTGTGTGGGTTTCTCGGGCAGTCACAGGTCTTACCGTTGCAGT) and 5'-phosphorylated 95-mer oligonucleotide (5'-pAGTCGTCGAGATCATCACCACGTGCGCGCTTACAGATGGTACCTTCCTTAAGGAACTTGCAGTTACGACAGCATGGACCTGATTCGCATTCATGG). Complementary oligonucleotides (91 and 95) and (72 and 66) were hybridized at gradually decreasing temperatures from 90°C to room temperature overnight. Hybridized DNA fragments were then purified by ethanol precipitation, redissolved in H2O, and ligated in a total volume of 20 µL by T4 DNA ligase for 1 hour at room temperature. Ligated product was purified by ethanol precipitation and redissolved in 50 µL H2O. To confirm successful ligation, 10 µL of purified product of hybridization mix before and after ligation were analyzed on 1.2% agarose gel stained with ethidium bromide.

Cloning of p(+)MV-echistatin. The plasmid p(+)MV-echistatin was constructed stepwise. Step 1: SacII-PacI restriction fragment was isolated from 1 µg of plasmid p(+)MVNSe and cloned at SacII (position 3500) to PacI (position 8698) restriction positions in p(+)MVGFP to remove an SpeI (position 4833) restriction site and to introduce 18 nucleotides from positions 4838 to 4856 that correspond to positions 3985 to 4003 in p(+)MVNse and are missing from p(+)MVGFP plasmid. The resulting plasmid was denoted p(+)MVGFP+. Step 2: to make pCGHA/B, an expression plasmid for the H protein, with unique restriction sites downstream of the H gene, SfiI and NotI restriction sites were replaced with AscI and BstBI, respectively by PCR mutagenesis techniques. Modified plasmid was amplified in Escherichia coli DH5{alpha} bacterial cells, extracted using QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA). Plasmid DNA was then purified and sequenced. Step 3: Restriction fragment PacI-SpeI was isolated from pCGHA/B by sequential digestion and gel purification and cloned in PacI-SpeI digested and purified p(+)MVGFP+. The resulting p(+)MVGFPA/B plasmid has unique restriction sites AscI and BstBI downstream of the H gene and unique PacI and SpeI flanking the H chimeric gene construct. Step 4: Synthetic echistatin DNA flanked by AscI and BstBI was ligated at a molar ratio 3:1 with p(+)MVGFPA/B resulting in a 19,943-bp p(+)MV-echistatin. The authenticity of the final product was confirmed by restriction analysis and sequencing.

Rescue of measles virus echistatin vector. MV-Edm and measles virus echistatin vector (MV-ERV) were rescued using a measles virus rescue system as described by Radecke et al. (37); briefly, 5 µg of purified plasmids p(+)MVGFP or p(+)MV-echistatin plus 100 ng plasmid pEMCLa, an expression plasmid for the viral polymerase, were cotransfected into 293-3-46 cells rescue cell line in 6-well plates. Forty-eight hours post-transfection, cells were overlaid on monolayers of Vero cells and incubated at 37°C in a humidified incubator. Cocultured cells were examined 72 hours later for green fluorescent protein (GFP) expression and plaque formation. Individual plaques of rescued viruses were isolated and amplified on Vero cells.

Immunoblot analysis of the H protein. Chimeric H protein from replicating MV-ERV and MV-Edm were analyzed by immunoblotting. Viruses were propagated on Vero cell on 75-cm2 flasks. Infected cells were harvested then subjected to repeated freeze-thaw cycles to release cell associated viruses in PBS. Cell lysate was spun at 1,500 x g for 10 minutes to remove cell debris. Viruses were purified by ultracentrifugation at 40,000 rpm for 2 hours on a continuous density gradient of 10% to 60% Opti-Prep medium (Sigma-Aldrich Co., St. Louis, MO). Bands were collected, diluted in Opti-MEM medium, and tested for infectivity. Bands with high concentration of Opti-Prep were diluted in Opti-MEM and ultracentrifuged at 30,000 rpm for 1 hour before testing for infectivity. Fifty microliters from each band that contained the infectious viruses were lyzed in lysis buffer containing 20% DTT, boiled, and 10 µL of each sample was electrophoresed and transferred onto Hybond-ECL nitrocellulose membrane (Amersham Biosciences, Piscataway, NJ). For immunoblotting, the membrane was soaked in blocking buffer (5% milk in PBS and 0.1% Tween 20) for 1 hour. The membrane was rinsed in wash buffer (PBS plus 0.1% Tween 20) and blotted with rabbit anti-measles antisera at 1:10,000 concentration for 1 hour at room temperature. The membrane was rinsed thrice and blotted with horseradish peroxidase–conjugated goat anti-rabbit immunoglobulin G antibody (Calbiochem, La Jolla, CA) at 10:10,000 concentration. The membrane was rinsed thrice with wash buffer and SuperSignal West chemiluminescent substrate (Pierce, Rockford, IL) was added. Excess substrate was removed and the chemiluminescent signals were captured on X-ray film for 10 seconds.

Reverse transcription-PCR. Vero cells (n = 200,000) in duplicate 35-cm2 dishes were infected with MV-ERV or MV-Edm for 2 hours. After overnight incubation, cells were lyzed in their tissue culture plates and their total RNA content were extracted with RNAqueous (Ambion, Inc., Austin, TX). Reverse transcription-PCR (RT-PCR) was done using Titan one-tube RT-PCR system (F. Hoffmann-La Roche Ltd., Basel, Switzerland) according to manufacturer's instructions.

Determination of released and cell-associated virus titers by plaque formation assay. Vero cells were inoculated with MV-ERV or MV-Edm at multiplicity of infection (MOI) = 3 for 2 hours at 37°C in a humidified incubator. Unbound virus was removed and cells were covered with complete medium. Supernatant and cells were collected for analysis every 6 hours. Virus samples were freeze thawed thrice in liquid nitrogen and centrifuged at 1,500 x g for 10 minutes at 4°C to remove cell debris. The supernatant was serially diluted at 1:10 in Opti-MEM and inoculated on Vero cells for 2 hours at 37°C in 5% CO2. Unbound virus was removed and cells were overlaid with 2 mL of MEM (Invitrogen) containing 5% FBS and 1% methylcellulose (Sigma-Aldrich). After 2 days of incubation at 37°C in a humidified incubator containing 5% CO2, cells were washed with PBS, fixed with 4% paraformaldehyde, and stained with 1% crystal violet. Plaques were counted under an inverted microscope.

Soluble echistatin-competitive inhibitory assay. Fixed volume of Opti-MEM medium containing 50,000 plaque-forming units (pfu) of MV-ERV were mixed with each of 1:10 serial dilutions of synthetic echistatin (Sigma-Aldrich) producing final concentrations of 10 to 0.0001 µmol/L were incubated on CHO-{alpha}vß3 cells for 3 hours at 37°C. Unbound virus was removed by rinsing cells thrice with Opti-MEM and cells were reincubated in complete medium containing 0.2 mmol/L fusion inhibitory peptide (Z-D-Phe-Phe-Gly-OH; BachemCalifornia, Inc., Torrance, CA) for additional 48 hours.

Endothelial cell infection with viral particles. CPAE cells (2 x 104 in 300 µL) were plated on matrigel-coated 48-well plates (50 µL per well) and incubated overnight. Wells were inoculated with MV-Edm or MV-ERV diluted in Opti-MEM at a MOI = 1 for 2 hours. After 48 hours of incubation, cells were examined. Photographs were taken using UV or white light microscope.

In vivo chick chorioallantoic membrane assay. Windows were made through the shell of 10-day-old embryonated eggs as previously published (38). Ten nanograms of bFGF were placed within a 5 mm ID steam sterilized silicone ring placed on the chorioallantoic membrane (CAM) to induce angiogenesis. 24 hours later, the membranes were inoculated with 4 x 104 infectious MV-ERV or MV-Edm particles per membrane in the ring and incubated for additional 48 hours and in some instances for 72 hours to observe cytolytic effects of the viruses. Membranes were excised and examined under UV light microscope with 100x magnification for GFP expression.

In vitro angiogenesis assays and infection with viral particles. Matrigel (Collaborative Biomedical Products, Bedford, MA), a basement membrane preparation, purchased from the Engelbreth-Holm-Swarm mouse sarcoma, was used at 7 mg/mL for in vitro tube formation angiogenesis assays. Phenol red–free matrigel was purchased from the same company and it was used for in vivo matrigel plug assays (see below). Basic fibroblast growth factor and VEGF were purchased from R&D Systems (Minneapolis, MN). For the matrigel tube formation assay, unpolymerized matrigel (7 mg/mL) was placed in the wells (50 µL per well) of a prechilled 48-well cell culture plate and incubated at 37°C for 30 to 45 minutes. HUVECs were harvested in trypsin and resuspended in EC medium (2 x 104 in 300 µL). After 16 hours of incubation, endothelial tubes were infected with either MV-Edm or MV-ERV diluted in Opti-MEM at a MOI = 1 for 2 hours. Pictures of the areas of abundant tubes mostly in the center of wells were taken at 48, 72, and 96 hours. Experiments were done in triplicate.

In vivo tumorigenicity and viral injections. Thirty 4- to 5-week-old severe combined immunodeficient (SCID) mice were housed in groups of five. Twenty-four hours before tumor cell injections, the mice were irradiated with 160 rad each. MM1 cells (5 x 106) suspended in 100 µL of PBS were injected s.c. into the right flanks of the mice and the animals were observed for tumor growth until the tumor became palpable. Tumor size was measured every other day and the mean tumor volume was calculated by the formula (square root of width x length / 0.52). Animals were randomized into three groups and injected with MV-ERV, MV-Edm (2 x 105 pfu), or control PBS (100 µL) when tumors became palpable. Vector injection was repeated six times at 5-day intervals. Mice were euthanized when tumor volume became ≥1.0 cm3.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Orientation of the binding sites of echistatin is harmonious with that of the H protein of measles virus and allows the formation of a functional chimera. The integrin-binding domain on echistatin is located in an RGD-containing loop supported by the last nine amino acids at the COOH-terminal end of the molecule (39). This structural orientation is harmonious with the orientation of the H protein of measles virus. To confirm that our engineered echistatin display is functional, we generated a chimeric H-echistatin protein in an expression vector pCGH and cotransfected it along with pCGF, an expression vector for the fusion protein (F) into Vero-susceptible cells or CHO cells expressing integrin {alpha}vß3 but lacking the natural viral receptors CD46 and SLAM. Both the F and the H proteins are required for cell-cell fusion to occur. Cotansfection of either pCGH-echistatin or pCGH-Edm resulted in rapid (24 hours post-transfection) and large syncytia formation in Vero cells indicating that the H protein attachment and fusion support functions have not been compromised. Cotransfection of pCGH-echistatin but not pCGH-Edm with pCGF into CHO-{alpha}vß3 cells resulted in the formation of syncytial cells confirming the utilization of integrin {alpha}vß3 and confirming that H-echistatin is functional. However, syncytia formation in CHO-{alpha}vß3 was slower (48 hours post-transfection) than that in Vero cells and the size of the syncytial cells was smaller, about 20 nuclei per syncytium. These results showed that echistatin can mediate cell-cell fusion and that its incorporation at the COOH terminus of the H protein did not affect the H protein functions of binding and fusion support (Fig. 1).



View larger version (139K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Functional syncytia formation assay of recombinant H and H-echistatin proteins. Vero, wild-type CHO-K1, or CHO-{alpha}vß3 cells were cotransfected with the viral fusion protein expression plasmid (pCGF) plus viral H or H-echistatin expression plasmids as indicated. Cells were fixed, stained, and photographed 24 hours post-transfection for Vero cells and 48 hours for CHO-K1 and CHO-{alpha}vß3 cells. Magnification, 100x with inverted light microscope.

 
Cloning of echistatin on the COOH-terminal end of measles H protein and the rescue of infectious replicative and targeted measles virus echistatin vector. To generate measles virus displaying echistatin, we linked the COOH terminus of the attachment (H) glycoprotein of measles virus to a synthetic copy of the modified echistatin gene at position 28 (Fig. 2A). Replacement of Met28 with Leu28 dramatically reduces echistatin binding to integrin {alpha}5ß1 without affecting its high affinity binding to integrin {alpha}vß3 found on activated endothelial cells. Therefore, we cloned Leu28 echistatin to limit our targeted virus vector to use {alpha}vß3 integrin and the resulting plasmid was named p(+)MV-echistatin. Two plaques of infectious recombinant echistatin-displaying measles viruses were rescued as described in Materials and Methods. Interestingly, the rescued virus MV-echistatin produced green ring syncytial plaque structures when viewed under a UV light microscope. Based on the observed syncytial phenotype, the virus was named MV-echistatin ring vector (MV-ERV; Fig. 2B and C). Plaques were collected in serum-free Opti-MEM medium and amplified on Vero cells. Unlike MV-Edm–infected cells, MV-ERV–infected cells roll outward from a central point where cells lose their attachment to the plastic surface of the tissue culture plates.



View larger version (47K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Schematic representation of p(+)MV-echistatin showing site of echistatin insertion within viral genome, rescue, and biochemical characterization of MV-ERV. A, the H gene of measles virus located between the fusion (F) and the viral polymerase (L) genes in a full-length cDNA copy of measles virus. Constructed echistatin gene was inserted at artificially constructed AscI and BstBI restriction enzyme sites at the COOH-terminal end of the H protein. GFP was inserted as an additional gene before the N gene. The whole genome is flanked by a leader and a trailer sequences. T7 promoter and terminator sites and hepatitis delta virus ribozyme locations to show the precise genome start and genome ends. Asterisk, H-echistatin gene end. Italics L in the amino acid sequence of echistatin is the mutated position to remove binding of echistatin to integrin {alpha}5ß1. MV-ERV rescued on Vero cells resulted in the formation of atypical ring structures: (B) white light and (C) UV light. Extracted antigenomic viral RNA from two rescued plaques of each of MV-ERV and MV-Edm were analyzed by RT-PCR (D). Primers for the RT-PCR analysis span 150 bp at the COOH-terminal end of the H protein and ligand regions. Immunoblot analysis of H proteins purified from replicating virions (E). Lane 1, control chimeric H-VEGF121 with mobility at 94 kDa; lane 2, chimeric H-echistatin from MV-ERV, 82 kDa; lane 3, unlinked control H protein with mobility at 76 kDa. F, one-step growth curve for viral titers and competitive inhibitory effect of echistatin on MV-ERV infection of CHO-{alpha}vß3: Vero cells were inoculated with MV-ERV (diamonds) or MV-Edm (triangles) for 2 hours at MOI of 3. Infected cells were incubated in complete medium and samples were collected at indicated time points.

 
Echistatin was correctly incorporated into the viral genome and displayed on replicating measles virus echistatin vector which in turn replicated efficiently on Vero cells and was released into the culture supernatant. RT-PCR was done on viral mRNA extracted from MV-ERV– or MV-Edm–infected Vero cells (Fig. 2D). RT-PCR products were sequenced and the results confirmed the incorporation of the echistatin peptide in the viral genome of the recombinant viruses. To confirm that the H-echistatin protein is present on replicating viruses, we analyzed the chimeric proteins by immunoblotting under reducing conditions. MV-ERV or MV-Edm viruses were propagated on Vero cells, purified on continuous Opti-Prep density gradients and the bands were tested for infectivity before immunoblotting. The chimeric H-echistatin protein from MV-ERV migrated at 82 kDa compared with controls of MV-VEGF121 (94 kDa) or unmodified H glycoprotein (76 kDa; Fig. 2E). On Vero cells, both MV-ERV and MV-Edm had an eclipse phase during the first 24 hours of growth followed by a rapid progression of virus release during the next 24 hours. Cell-associated virus titers peaked at 24 hours for MV-Edm (6 x 106 pfu/mL) and 30 hours for MV-ERV (1 x 106 pfu/mL). Titers of released viruses were about one log of magnitude lower than cell associated viruses and they peaked at 36 hours (5 x 105 pfu/mL) and 48 hours (1 x 105 pfu/mL) for MV-Edm and MV-ERV, respectively (Fig. 2F). These results indicate that MV-ERV assembly and released is only slightly affected by the display of echistatin on the H protein.

Functional targeting, specific infection, and syncytia formation in cell culture. CHO cells are normally resistant to infection by measles virus because they do not express CD46 or SLAM, the native measles virus receptors. In this experiment, we compared MV-Edm and MV-ERV to infect CHO cells via {alpha}vß3 integrin. We inoculated CHO-{alpha}vß3 or untransfected CHO cells with MV-ERV or MV-Edm as a control at a MOI of 1 and allowed infection for 2 hours in serum-free medium; cells were incubated 48 hours at 37°C in complete medium. As expected, cells expressing {alpha}vß3 were infected with MV-ERV but not MV-Edm and they formed syncytia (Fig. 3A and B). To determine the specificity of MV-ERV virus for endothelial cells, bovine pulmonary aortic endothelial (CPAE) cells plated on matrigel were inoculated with either the wild-type MV-Edm or MV-ERV. After 48 hours of incubation, MV-ERV infected CPAE cells more efficiently than MV-Edm and induced syncytial formation (Fig. 3C). Because CPAE are non–primate cells and do not express measles natural receptors, this result provides a clear evidence of viral endothelial targeting.



View larger version (60K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Specificity of targeted MV-ERV: infection of CHO-{alpha}vß3 and CPAE cells and HUVEC tubules via integrin {alpha}vß3 and dose-dependent inhibition of infection by soluble echistatin. CHO (A) or CHO-{alpha}vß3 (B) cells were inoculated with MV-Edm or MV-ERV serum-free medium at MOI of 1. Cells were photographed 48 hours post-infection. Note syncytia formation of MV-ERV–infected CHO-{alpha}vß3. C, CPAE primary cells plated on matrigel were inoculated with MV-Edm or MV-ERV at MOI of 1. After 48 hours, CPAE cells were infected with MV-ERV more efficiently than MV-Edm as assessed by green fluorescence. D, dose-dependent inhibition of MV-ERV infection by soluble echistatin: soluble echistatin was serially diluted at 1:10 in Opti-MEM and mixed with fixed volume of MV-ERV at MOI of 1. MV-ERV and soluble echistatin mix were inoculated on CHO-{alpha}vß3 cells for 3 hours. Unbound virus was removed and complete medium containing fusion inhibitory peptide was added to prevent syncytia. Cells were incubated 48 hours to allow GFP expression, trypsinized, washed in PBS by centrifugation, resuspended, and analyzed by flow cytometry for GFP expression. Concentration of echistatin in each data point is indicated (diamonds). The (–) control shown on the x-axis are control cells that were not inoculated with MV-ERV and (+) control cells did not receive echistatin. Mock dilutions with PBS were also included (circles). Y-axis is plotted with percentage of GFP-positive cells in a total of 10,000 count events for each data point. Points, averages of a duplicate set of data.

 
Soluble echistatin peptide competitively blocked measles virus echistatin vector infection of CHO-{alpha}vß3 cells in a dose-dependent manner. If the interaction between echistatin displayed on the viral envelope with integrin {alpha}vß3 expressed on CHO-{alpha}vß3 is specific, then it is expected that soluble echistatin would compete with viral interaction thereby blocking infection. Indeed, soluble echistatin inhibited MV-ERV infection. Serially diluted echistatin was allowed to compete with MV-ERV at MOI of 1 for 2 hours at 37°C. Unbound viruses were removed and cells were incubated in complete medium containing a fusion inhibitory peptide to inhibit cell-cell fusion. Forty-eight hours later, cells were trypsinized and 10,000 cells from each sample were analyzed by flow cytometry and the percentage of cells that express GFP was plotted (Fig. 3D). Eighty percent of the infection was blocked by 0.1 µmol/L of soluble echistatin and the IC50 was 10 nmol/L, at which 50% of MV-ERV infection of CHO-{alpha}vß3 was blocked. It is interesting to note that there is a step in the inhibition curve seen with echistatin at a concentration of 100 nmol/L after which MV-ERV seemed resistant to further echistatin blockade. The step was detected in a duplicate set of experiments. This could be explained by the fact that measles virus infects CHO cells at basal levels through an unidentified receptor that echistatin does not recognize. These results indicate that MV-ERV infection of CHO-{alpha}vß3 cells was dependent on its ability to use {alpha}vß3 integrin as a receptor.

Measles virus echistatin vector infected and destroyed newly formed capillaries of chick chorioallantoic membrane. Consistent with the clear biological effects of MV-ERV in cell culture, MV-ERV targeted angiogenesis and infected small capillaries in an in vivo CAM angiogenesis assay. Angiogenesis was stimulated on the CAM and inoculated with MV-ERV or MV-Edm as described in Materials and Methods. Membranes were excised and examined under UV light microscope at 100x magnification. At 48 hours post-viral inoculation, MV-ERV infected newly formed angiogenic tubes (Fig. 4A) and small but not large capillaries with some destructive effect. At 72 hours, MV-ERV–infected capillaries were further destroyed. Wild-type MV-Edm on the other hand was completely inert. It did not infect small or large capillaries (Fig. 4, image A4). In tissue culture plates, HUVECs were equally infectable by both MV-Edm and MV-ERV, but interestingly, only MV-ERV was able to infect HUVEC capillary-like tubules formed on matrigel (Fig. 4B).



View larger version (70K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. Evidence of targeting angiogenesis in vivo. A, infection of newly formed but not preformed blood capillaries in CAM assay: angiogenesis was stimulated on the CAM of 10-day-old embryonated eggs. The membranes were inoculated with MV-ERV (A1, A2, and A3) or MV-Edm (A4) and incubated for 48 hours (A1, A2, and A4) or 72 hours (A3). Membranes were harvested and examined under UV light microscope for GFP expression using 100x magnification. Examples of angiogenic tube formations being infected with MV-ERV (A1). Examples of thin capillaries infected with MV-ERV glow with GFP fluorescence (A2, 48 hours and A3, 72 hours post-infection). Note the lack of infection of preformed thick capillaries (nonfluorescent, dark capillaries). MV-Edm did not infect any capillaries. Representative membranes and photos. B, infection of HUVEC tube-like structures: HUVEC cells were incubated overnight on matrigel to allow tube formation and were inoculated with MV-Edm or MV-ERV at a MOI = 1 for 96 hours. Tubules exposed to MV-ERV but not MV-Edm were infected as evidenced by expression of GFP. Representative of experiments done in triplicate.

 
Virotherapeutic effect of measles virus echistatin vector against resistant multiple myeloma MM1 tumors. We have established that MV-ERV is functional in in vitro and in vivo assays and that it infects cells via integrin {alpha}vß3. In this experiment, we assessed MV-ERV therapeutic effect in a resistant MM1 tumor model in SCID mice. The multiple myeloma MM1 cell line that lacks the expression of integrin {alpha}vß3 (Fig. 5A) was used to establish s.c. xenografts in SCID mice. MM1 cells were injected s.c. into the right flanks of 29 SCID mice and they were allowed to grow to palpable size. Animals were divided into three groups (10 mice PBS, 9 mice MV-Edm, and 10 mice MV-ERV) and tumors were treated with intratumoral injections of a total of 6 x 105 pfu of MV-ERV, MV-Edm, or 100 µL control PBS in each group at 5-day intervals. Tumor diameters were measured every other day and the tumor volume was calculated by the formula (square root of width x length / 0.52). When tumor volume reached 1 cm3, the animals were euthanized. Four weeks after tumor cell injection, the average tumor volume in the MV-ERV group was 14.32-fold less than that of the control PBS and 9.02-fold less than that of the control MV-Edm–injected tumors (Fig. 5B). We did not observed any signs of adverse effect associated with MV-ERV, MV-Edm, or PBS intratumoral injections. All MV-ERV–treated animals remained alive and healthy and they maintained their normal weight during the study until they were euthanized. Nine days after the onset of therapy or 22 days after MM1 cell implantation, tumors in two mice from the control group reached or surpassed the cutoff value of 1 cm3 and they were euthanized. By day 38, all PBS control mice were euthanized, and by day 44, all mice treated with untargeted measles virus were also euthanized. In contrast, all 10 mice in the group that was treated with echistatin targeted virus MV-ERV were alive up to 2 months from time of implantation of tumor. In one animal, number 7, injected with MV-ERV, the tumor regressed from a diameter of 0.54 mm on day 20 to 0.0 mm on day 43 and the tumor was completely eradicated until the end of the study on day 100. In MV-ERV–injected animals, numbers 1, 4, 5, and 10, the tumors transiently regressed from 3.2 to 6.2 to 0.0 mm in diameter but gradually reappeared. The regrowth of tumors from unmeasurable size was expected because MV-ERV targeted and killed tumor associated endothelial cells and prevented tumor cells from accessing direct blood supply; when virotherapy was stopped, tumor cells recruited new endothelial progenitors and angiogenesis resumed allowing tumors to regrow. MV-ERV therapy was given only during the first 30 days. MV-ERV treatment doubled survival times of treated animals compared with the controls (Fig. 5C) or completely eradicated the tumor in one animal.



View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Therapeutic effects of MV-ERV on s.c. xenograft model of multiple myeloma tumors in SCID mice. A, multiple myeloma tumor cells (MM1) were tested for the lack of expression of integrin {alpha}vß3. Cells were stained with R-phycoerythrin–conjugated mouse anti-human monoclonal antibody 23C6 against integrin {alpha}vß3 (black curve) or R-phycoerythrin–conjugated isotype control (red curve) and analyzed by flow cytometry. Control isotype and anti-{alpha}vß3 curves completely overlap. B, average tumor size post implantation. C, probability of animal survivals treated with MV-ERV or MV-Edm compared with control PBS. Statistical Ps < 0.001 for MV-ERV survivals versus MV-Edm– or PBS-injected animals. Injection times (arrows).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Targeting neovessels is a promising strategy for tumor cytoreductive therapy (4042) and advances in this field have recently prompted the Food and Drug Administration to approve the first drug that targets angiogenesis for the treatment of colorectal cancers in conjunction with chemotherapy (43). Our approach to targeting tumors and their associated blood vessels is based on the use of two receptors by one virus vector. One receptor is expressed on proliferating endothelial cells and that is integrin {alpha}vß3; the other is CD46 that is expressed on human tumor cells. Targeting measles virus to integrin {alpha}vß3 was achieved by displaying a high-affinity ligand, echistatin, on the outer envelope of the vaccine strain of measles virus. We have shown that measles virus vectors expressing echistatin can replicate efficiently and they can enter cells via integrin {alpha}vß3 and via their natural receptor CD46. MV-ERV infected newly formed blood vessels in CAM assays and more importantly, it produced a potent antitumor effect in MM1 tumor model. Unlike MV-Edm, MV-ERV strongly suppressed tumor growth by blocking nutrients and blood supply from reaching tumor mass. In one animal, the tumor completely disappeared until the end of study on day 100. In some animals, the tumor regressed to unmeasurable level and regrew after the virotherapy was stopped. This observation of regrowth supports the notion that a small mass of tumor cells do not require direct blood supply and the MM1 cells were able to recruit fresh endothelial cells to revascularize the tumor allowing it to grow after cessation of antiendothelial cell virotherapy. Although we have chosen a highly resistant and aggressive multiple myeloma cell line, MV-ERV virotherapy significantly extended the lives of treated animals. We should note that in addition to the direct infection of susceptible cells by MV-ERV, the displayed peptide echistatin has been shown to interfere with cell-to-matrix adhesion and this seems the mechanism for the ring formation in cell culture and that might have contributed to destructive mechanism against activated endothelial cells by preventing them cells from binding to extracellular matrix.

Preexisting antibodies against measles virus in patients could interfere with MV-ERV virotherapy in immunocompetent patients; however, certain cancer patients such as those with multiple myeloma, a plasma cell abnormality, the level of antibodies in their blood is too low to present a challenge to MV-ERV virotherapy. Direct intratumor administration of the viral vector could be used to avoid the interaction of host's immune system with virus directly; but because MV-infected cells display foreign proteins on their surface, it might be useful to use preexisting antibodies to initiate antibody-mediated cell destruction of infected tumor or activated endothelial cells. It should also be noted that MV-ERV has the ability to spread from cell-to-cell avoiding immunosurveillance and it has a strong immunosupressive effect on the host (44).

Measles-based viral vectors have several advantages in targeted gene therapy. Measles is a replicating virus that can amplify itself as long as there is a substrate for its infection (i.e., proliferating endothelial or tumor cells). The vector can accommodate larger gene inserts compared with replicating adenovirus vectors for instance. The safety of the Edmonston strain of measles virus has been studied extensively and it has been in use as a vaccine for decades (4547). Currently, vaccination against measles virus is a universal and effective preventive measure against measles virus infection, a measure that provides additional safety barriers against unintended infection by measles vectors; therefore, measles-based vectors should pose no risk to the general population. There are no recombination events in the life cycle of measles virus and it does not integrate in the genome of infected cells. Although the rate of spontaneous mutations in the RNA viruses is higher than that of the DNA viruses due to the lack of endonuclease-proofreading function in the viral RNA-dependent RNA polymerase (48), the lack of homologous recombination events on the other hand contributes to the stability of the genome (49) and the inserted foreign genes making MV-ERV a very stable vector. In MV-ERV, the ligand M28L echistatin is not only more specific to binding integrin {alpha}vß3 than short RGD peptides, but it also has 1,000-fold higher affinity to this integrin. This higher affinity and specificity is important to keep the virus vector localization to proliferating endothelial and tumor cells. Adherent cells including endothelial and many tumor cells require adhesion to extracellular matrix for their survival. Prevention of such adhesion induces anoikis, cell death because of detachment, and such adhesion can be efficiently blocked by RGD-containing peptides (50) such as echistatin. In addition, the mere binding of echistatin to integrin {alpha}vß3 on cells can induce apoptotic signals and cell death (51). Therefore, it is reasonable to hypothesize that even defective MV-ERV particles and cell membrane debris of infected cells can induce cell death by the displayed echistatin molecule on the viral envelope or the cell membrane anchored H-echistatin glycoproteins.


    Acknowledgments
 
Grant support: Multiple Myeloma Research Foundation and NIH grants CA100634-02 and HL66958-04P4.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Suzanne Greiner for her technical help with the animal study, Gabriela A. Rosales for statistical analysis, Sompong Vongpunsawad and Mark E. Peeples for helpful discussions on the rescue system of measles virus, and Maureen Craft for help on preparation of the article.

Received 8/10/04. Revised 1/27/05. Accepted 4/ 5/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Zwitter M. Hodgkin's disease: therapeutic role of measles vaccine. Am J Med 1984 Dec;77:A49, A52, A64.
  2. Schattner A. Therapeutic role of measles vaccine in Hodgkin's disease. Lancet 1984 Jan 21;1:171.
  3. Greentree LB. Hodgkin's disease: therapeutic role of measles vaccine. Am J Med 1983 Dec;75:928.
  4. Taqi AM, Abdurrahman MB, Yakubu AM, Fleming AF. Regression of Hodgkin's disease after measles. Lancet 1981 May 16;1:1112.
  5. Mota HC. Infantile Hodgkin's disease: remission after measles. Br Med J 1973 May 19;2:421.
  6. Zygiert Z. Hodgkin's disease: remissions after measles. Lancet 1971 Mar 20;1:593.
  7. Bluming AZ, Ziegler JL. Regression of Burkitt's lymphoma in association with measles infection. Lancet 1971 Jul 10;2:105–6.
  8. Pasquinucci G. Possible effect of measles on leukaemia. Lancet 1971 Jan 16;1:136.
  9. Bucheit AD, Kumar S, Grote DM, et al. An oncolytic measles virus engineered to enter cells through the CD20 antigen. Mol Ther 2003 Jan;7:62–72.[CrossRef][Medline]
  10. Grote D, Russell SJ, Cornu TI, et al. Live attenuated measles virus induces regression of human lymphoma xenografts in immunodeficient mice. Blood 2001 Jun 15;97:3746–54.
  11. Phuong LK, Allen C, Peng KW, et al. Use of a vaccine strain of measles virus genetically engineered to produce carcinoembryonic antigen as a novel therapeutic agent against glioblastoma multiforme. Cancer Res 2003 May 15;63:2462–9.
  12. Peng KW, TenEyck CJ, Galanis E, Kalli KR, Hartmann LC, Russell SJ. Intraperitoneal therapy of ovarian cancer using an engineered measles virus. Cancer Res 2002 Aug 15;62:4656–62.
  13. Dingli D, Peng KW, Harvey ME, et al. Image-guided radiovirotherapy for multiple myeloma using a recombinant measles virus expressing the thyroidal sodium iodide symporter. Blood 2004 Mar 1;103:1641–6.
  14. Dorig RE, Marcil A, Richardson CD. CD46, a primate-specific receptor for measles virus. Trends Microbiol 1994 Sep;2:312–8.[CrossRef][Medline]
  15. Tatsuo H, Okuma K, Tanaka K, et al. Virus entry is a major determinant of cell tropism of Edmonston and wild-type strains of measles virus as revealed by vesicular stomatitis virus pseudotypes bearing their envelope proteins. J Virol 2000 May;74:4139–45.[Abstract/Free Full Text]
  16. Naniche D, Varior-Krishnan G, Cervoni F, et al. Human membrane cofactor protein (CD46) acts as a cellular receptor for measles virus. J Virol 1993 Oct;67:6025–32.[Abstract/Free Full Text]
  17. Dorig RE, Marcil A, Chopra A, Richardson CD. The human CD46 molecule is a receptor for measles virus (Edmonston strain). Cell 1993 Oct 22;75:295–305.
  18. Tatsuo H, Ono N, Tanaka K, Yanagi Y. SLAM (CDw150) is a cellular receptor for measles virus. Nature 2000 Aug 24;406:893–7.
  19. Brooks PC, Clark RA, Cheresh DA. Requirement of vascular integrin {alpha}vß3 for angiogenesis. Science 1994 Apr 22;264:569–71.
  20. Arap W, Pasqualini R, Ruoslahti E. Cancer treatment by targeted drug delivery to tumor vasculature in a mouse model. Science 1998 Jan 16;279:377–80.
  21. Brooks PC, Montgomery AM, Rosenfeld M, et al. Integrin {alpha}vß3 antagonists promote tumor regression by inducing apoptosis of angiogenic blood vessels. Cell 1994 Dec 30;79:1157–64.
  22. Storgard CM, Stupack DG, Jonczyk A, Goodman SL, Fox RI, Cheresh DA. Decreased angiogenesis and arthritic disease in rabbits treated with an {alpha}vß3 antagonist. J Clin Invest 1999 Jan;103:47–54.[Medline]
  23. Hood JD, Bednarski M, Frausto R, et al. Tumor regression by targeted gene delivery to the neovasculature. Science 2002 Jun 28;296:2404–7.
  24. Kumar CC. Integrin {alpha}vß3 as a therapeutic target for blocking tumor-induced angiogenesis. Curr Drug Targets 2003 Feb;4:123–31.[CrossRef][Medline]
  25. Ruegg C, Dormond O, Foletti A. Suppression of tumor angiogenesis through the inhibition of integrin function and signaling in endothelial cells: which side to target? Endothelium 2002;9:151–60.[CrossRef][Medline]
  26. Thibault G. Sodium dodecyl sulfate-stable complexes of echistatin and RGD-dependent integrins: a novel approach to study integrins. Mol Pharmacol 2000 Nov;58:1137–45.[Abstract/Free Full Text]
  27. Kumar CC, Nie H, Rogers CP, et al. Biochemical characterization of the binding of echistatin to integrin {alpha}vß3 receptor. J Pharmacol Exp Ther 1997 Nov;283:843–53.[Abstract/Free Full Text]
  28. Wierzbicka-Patynowski I, Niewiarowski S, Marcinkiewicz C, Calvete JJ, Marcinkiewicz MM, McLane MA. Structural requirements of echistatin for the recognition of {alpha}(v)ß(3) and {alpha}(5)ß(1) integrins. J Biol Chem 1999 Dec 31;274:37809–14.
  29. Juliano D, Wang Y, Marcinkiewicz C, Rosenthal LA, Stewart GJ, Niewiarowski S. Disintegrin interaction with {alpha} V ß 3 integrin on human umbilical vein endothelial cells: expression of ligand-induced binding site on ß3 subunit. Exp Cell Res 1996 May 25;225:132–42.
  30. Staiano N, Villani GR, Di Martino E, Squillacioti C, Vuotto P, Di Natale P. Echistatin inhibits the adhesion of murine melanoma cells to extracellular matrix components. Biochem Mol Biol Int 1995 Jan;35:11–9.[Medline]
  31. Ellegala DB, Leong-Poi H, Carpenter JE, et al. Imaging tumor angiogenesis with contrast ultrasound and microbubbles targeted to {alpha}(v)ß3. Circulation 2003 Jul 22;108:336–41.
  32. Nussbaum O, Broder CC, Moss B, Stern LB, Rozenblatt S, Berger EA. Functional and structural interactions between measles virus hemagglutinin and CD46. J Virol 1995 Jun;69:3341–9.[Abstract]
  33. Brooks PC, Clark RA, Cheresh DA. Requirement of vascular integrin {alpha}vß3 for angiogenesis. Science 1994 Apr 22;264:569–71.
  34. Varner JA, Cheresh DA. Tumor angiogenesis and the role of vascular cell integrin avh3. In: De Vita VT,Hellman S, Rosenberg SA, editors. Important AdvOncol. Philadelphia: Lippincott-Raven Publishers; 1996.p. 66–87.
  35. Ria R, Vacca A, Ribatti D, Di Raimondo F, Merchionne F, Dammacco F. {alpha}(v)ß(3) integrin engagement enhances cell invasiveness in human multiple myeloma. Haematologica 2002 Aug;87:836–45.[Abstract/Free Full Text]
  36. O'Toole TE, Loftus JC, Du XP, et al. Affinity modulation of the {alpha} IIb ß3 integrin (platelet GPIIb-IIIa) is an intrinsic property of the receptor. Cell Regul 1990 Nov;1:883–93.[Medline]
  37. Radecke F, Spielhofer P, Schneider H, et al. Rescue of measles viruses from cloned DNA. EMBO J 1995 Dec 1;14:5773–84.
  38. Storgard CM, Mikolon D, Stupack DG. Angiogenesis assays in the chick CAM. In: Guan J-L, editor. Cell migration. Totowa (NJ): Humana Press; 2004. p. 123–36.
  39. Marcinkiewicz C, Vijay-Kumar S, McLane MA, Niewiarowski S. Significance of RGD loop and C-terminal domain of echistatin for recognition of {alpha}IIb ß3 and {alpha}(v) ß3 integrins and expression of ligand-induced binding site. Blood 1997 Aug 15;90:1565–75.
  40. Folkman J. Anti-angiogenesis: new concept for therapy of solid tumors. Ann Surg 1972 Mar;175:409–16.[Medline]
  41. Folkman J. Angiogenesis inhibitors: a new class of drugs. Cancer Biol Ther 2003 Jul;2:S127–33.[Medline]
  42. Kim KJ, Li B, Winer J, et al. Inhibition of vascular endothelial growth factor-induced angiogenesis suppresses tumour growth in vivo. Nature 1993 Apr 29;362:841–4.
  43. Goodman L. Persistence-luck-Avastin. J Clin Invest 2004 Apr;113:934.[Medline]
  44. Sun X, Burns JB, Howell JM, Fujinami RS. Suppression of antigen-specific T cell proliferation by measles virus infection: role of a soluble factor in suppression. Virology 1998 Jun 20;246:24–33.
  45. Wong-Chew RM, Islas-Romero R, Garcia-Garcia ML, et al. Induction of cellular and humoral immunity after aerosol or subcutaneous administration of Edmonston-Zagreb measles vaccine as a primary dose to 12-month-old children. J Infect Dis 2004 Jan 15;189:254–7.[CrossRef]
  46. Brown P, Gajdusek DC, Tsai T. Persistence of measles antibody in the absence of circulating natural virus five years after immunization of an isolated virgin population with Edmonston B vaccine. Am J Epidemiol 1969 Dec;90:514–8.[Abstract/Free Full Text]
  47. Benson PF, Butler NR, Goffe AP, et al. Vaccination of infants with living attenuated measles vaccine (Edmonston strain) with and without {gamma}-globulin. Br Med J 1964 Oct 3;5413:851–3.
  48. Drake JW, Holland JJ. Mutation rates among RNA viruses. Proc Natl Acad Sci U S A 1999 Nov 23;96:13910–3.
  49. Wertz GW, Perepelitsa VP, Ball LA. Gene rearrangement attenuates expression and lethality of a nonsegmented negative strand RNA virus. Proc Natl Acad Sci U S A 1998 Mar 31;95:3501–6.
  50. Michel JB. Anoikis in the cardiovascular system: known and unknown extracellular mediators. Arterioscler Thromb Vasc Biol 2003 Dec;23:2146–54.[Abstract/Free Full Text]
  51. Brassard DL, Maxwell E, Malkowski M, Nagabhushan TL, Kumar CC, Armstrong L. Integrin {alpha}(v)ß(3)-mediated activation of apoptosis. Exp Cell Res 1999 Aug 25;251:33–45.



This article has been cited by other articles:


Home page
Cancer Res.Home page
Y. Jing, C. Tong, J. Zhang, T. Nakamura, I. Iankov, S. J. Russell, and J. R. Merchan
Tumor and Vascular Targeting of a Novel Oncolytic Measles Virus Retargeted against the Urokinase Receptor
Cancer Res., February 15, 2009; 69(4): 1459 - 1468.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
H. Akbulut, Y. Tang, K. G. Akbulut, J. Maynard, L. Zhang, and A. Deisseroth
Antitumor immune response induced by i.t. injection of vector-activated dendritic cells and chemotherapy suppresses metastatic breast cancer.
Mol. Cancer Ther., August 1, 2006; 5(8): 1975 - 1985.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Liu and A. Deisseroth
Tumor vascular targeting therapy with viral vectors
Blood, April 15, 2006; 107(8): 3027 - 3033.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. H. Verheije, T. Wurdinger, V. W. van Beusechem, C. A. M. de Haan, W. R. Gerritsen, and P. J. M. Rottier
Redirecting Coronavirus to a Nonnative Receptor through a Virus-Encoded Targeting Adapter
J. Virol., February 1, 2006; 80(3): 1250 - 1260.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hallak, L. K.
Right arrow Articles by Russell, S. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hallak, L. K.
Right arrow Articles by Russell, S. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online