| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Experimental Therapeutics, Molecular Targets, and Chemical Biology |
1 Department of Microbiology and Immunology and the 2 Leo Jenkins Cancer Center, Brody School of Medicine at East Carolina University, Greenville, North Carolina
Requests for reprints: Richard A. Franklin, Department of Microbiology and Immunology, Brody School of Medicine at East Carolina University, Brody Building, Greenville, NC 27834. Phone: 252-744-2705; Fax: 252-744-3104; E-mail: franklinr{at}mail.ecu.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The calcium/calmodulin-dependent kinases (CaM-K) are a family of structurally related serine/threonine protein kinases that include CaM-K kinase (CaM-KK), phosphorylase kinase, myosin light chain kinase (MLCK), and CaM-KI to CaM-KIV (reviewed in ref. 5). CaM-KI, CaM-KII, and CaM-KIV have broad substrate specificity. CaM-KIII, phosphorylase kinase, and MLCK have limited substrate specificity. CaM-KK is an upstream activator/kinase for CaM-KI (6) and CaM-KIV (7). The traditional mechanism of activation for the CaM-Ks is through calcium/calmodulin complex binding, which induces phosphorylation of other CaM-Ks (CaM-KI and CaM-IV) by CaM-KK or via autophosphorylation. In certain cell types, oxidative stress can lead to the calcium-independent activation of the CaM-Ks (8, 9). CaM-KI is broadly distributed and is localized in the cytosol. CaM-KIV is mainly expressed in neurons but is also expressed in T cells and testis. CaM-KII is clearly the best characterized of the multifunctional CaM-Ks and is expressed in a variety of tissues (10). Multiple isoforms of CaM-KK and CaM-KII are reported to exist (11, 12).
Cell proliferation can be regulated by growth factors, cytokines, and hormones and is often deregulated in the case of cancer (13). Many signaling pathways are capable of transmitting proliferative signals from the cell membrane or cytoplasm to the nucleus. The role of intracellular calcium has been extensively demonstrated to be required for cell proliferation (reviewed in ref. 14). It is also well known that calcium binds calmodulin and this complex can induce the activation of the CaM-Ks. The CaM-Ks have also been implicated in cell cycle regulation; however, the characterization and magnitude of this involvement has not been well defined. Kahl and Means (14) have noted that a weakness with the majority of the studies describing the role of the CaM-Ks in proliferation is that they have solely involved the use of chemical inhibitors, such as KN-62 or KN-93. These inhibitors are known to suppress CaM-KII activity but have also been shown effective in inhibiting CaM-KI and CaM-KIV (5). In a recent article, Kahl and Means showed that CaM-KI is involved in the regulation of the cell cycle at the G1 checkpoint in primary fibroblasts (15). The role of the CaM-Ks in the regulation of the cell cycle in breast cancer cells has not been studied.
We investigated the effect of CaM-K inhibition on cell cycle progression in MCF-7 human breast cancer cells, an extensively used cellular model for breast cancer research. We found that the CaM-K inhibitor KN-93, but not its inactive analogue KN-92, inhibited the proliferation of MCF-7 breast cancer cells. These studies show that arrest occurs primarily in the G1 phase of the cell cycle. Furthermore, we show by silencing specific CaM-K expression with siRNA that CaM-KI and not CaM-KII is responsible for the G1 cell cycle progression in MCF-7 human breast cancer cells. In support of this finding, we found that CaM-KK inhibition with siRNA also resulted in cell cycle arrest.
| Materials and Methods |
|---|
|
|
|---|
Reagents and antisera. Anti-CaM-KII, anti-CaM-KIV, and anti-CaM-KK antibodies were purchased from BD Biosciences Transduction Labs (San Diego, CA). Anti-CaM-KI and anti-cyclin E antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-cyclin D1, anti-cyclin D3, anti-cdk4, anti-cdk6, anti-p27, and anti-pRb antibodies were purchased from Cell Signaling Technologies (Beverly, MA). Anti-actin antibody was purchased from Sigma. Alkaline phosphataseconjugated-goat anti-rabbit IgG (Fc), alkaline phosphataseconjugated-goat anti-mouse immunoglobulin G (H + L), and the 5-bromo-4-chloro-3-indolyl phosphate (BCIP), and nitroblue tetrazolium (NBT) Color Development Substrate (ProtoBlot II AP System) were purchased from Promega (Madison, WI). KN-92 and KN-93 were obtained from Calbiochem (San Diego, CA) and were dissolved in DMSO. LipofectAMINE 2000 and Opti-MEM I were purchased from Invitrogen Life Technologies. All other reagents were purchased from Sigma.
Cell lysis and immunoblot analysis. Cell lysates were prepared as previously described (8). Following harvest, the cells were centrifuged for 1 minute, supernatants were removed, and cell pellets were resuspended in cold lysis buffer [25 mmol/L Tris (pH 7.4), 50 mmol/L sodium chloride, 2% IGEPAL, 0.2% SDS, and 0.5% sodium deoxycholate] and placed on ice for 15 minutes. Lysates were centrifuged for 10 minutes at 14,000 rpm in a microcentrifuge. Supernatants were removed and placed into fresh tubes. Protein concentrations were calculated using the Bio-Rad DC Protein Assay (Hercules, CA). Lysates were mixed with 3.3x sample buffer [200 mmol/L Tris (pH 6.8), 33% glycerol, 6.6% SDS, 16.6% 2-mercaptoethanol, and 0.04% bromophenol blue]. Samples were boiled for 5 minutes and then frozen at 20°C.
Immunoblotting was done as previously described (16). Twenty micrograms of protein per sample were electrophoresed through SDS-PAGE gels and electrophoretically transferred to polyvinylidene fluoride membranes. Membranes were incubated overnight at 4°C in blocking buffer [25 mmol/L Tris (pH 8.0), 125 mmol/L sodium chloride, 0.1% Tween 20, 1% bovine serum albumin, and 0.1% sodium azide]. Membranes were then incubated for 2 hours with primary antibody diluted in blocking buffer (anti-CaM-KI, 1:1,000; anti-CaM-KII, 1:2,500; anti-CaM-KIV, 1:1,000; anti-CaM-KK, 1:1,000; anti-actin, 1:250; anti-cyclin D1, 1:2,000; anti-cyclin D3, 1:1,000; anti-cyclin E, 1:1,000; anti-cdk4, 1:2,000; anti-cdk6, 1:1,000; anti-pRb, 1:2,000; and anti-p27, 1:1000). The blots were washed twice in TBST [25 mmol/L Tris (pH 8.0), 125 mmol/L sodium chloride, and 0.025% Tween 20] and incubated with an alkaline phosphataseconjugated goat anti-rabbit immunoglobulin or goat anti-mouse immunoglobulin antibody (Promega; 1:10,000 in TBST) for 1 hour at room temperature. The blots were washed thrice in TBST and developed with the colorigenic substrates BCIP/NBT (Promega ProtoBlot II AP System).
Trypan blue exclusion assay. Cell numbers and viability were evaluated by assessing trypan blue exclusion of cells under light microscopy and scoring the percentage of cells that did not exhibit blue staining as previously described (17). Floating and attached cells were isolated by trypsinization, recovered by centrifugation, and resuspended in complete DMEM. The resuspension was mixed with PBS (1:5) and a serial dilution (1:1) with 0.2% trypan blue solution. Cells were counted using a hemocytometer.
Sulforhodamine B assay. Either MCF-7 or MCF-10A cells in exponential proliferation were trypsinized, counted, and seeded at 6,000 cells in 1 mL of complete DMEM per well in 24-well plates. Optimal seeding densities were determined to ensure exponential growth for 7 days (data not shown). The sulforhodamine B (SRB) assay was done as previously described (18). Briefly, all the culture medium was aspirated and the cells were fixed with cold trichloroacetic acid. Following incubation at 4°C, cells were washed with deionized water. The cells were stained with 0.1% SRB dissolved in 1% acetic acid for 30 minutes and subsequently washed with 1% acetic acid to remove unbound stain. The plates were then left to dry overnight at room temperature. The protein-bound stain was solubilized with 10 mmol/L unbuffered Tris base and transferred to 96-well plates for absorbance readings at 540 nm with background at 690 nm (Anthos Labtec Instruments, Anthos Reader 2001, Pasadena, CA).
Reverse transcription-PCR analysis of human CaM-KK
and CaM-KKß mRNAs. One microgram of total RNA per reaction was DNase I treated and converted to cDNA, which was used as a template for PCR. Thirty cycles (95°C for 1 minute, 51°C for 1 minute, and 72°C for 1 minute) were done with the following primers: for CaM-KK
sense primer, ACTCACTTGGAGGAGGCAGA and antisense primer, GCTGGGAGCAGTCTTGAAGT; for CaM-KKß, we used primers previously described (11). Reverse transcription-PCR (RT-PCR) reactions were done using Ready-To-Go RT-PCR Beads from Amersham Biosciences Co. (Piscataway, NJ).
RNA silencing. SMART pool interfering RNA (siRNA) to target human CaM-KI (Genbank accession no. NM_003656), CaM-KII
(Genbank accession nos. NM_001221, NM_172115, NM_172127, NM_172128), CaM-KII
(Genbank accession nos. NM_001222, NM_172169, NM_172170, NM_172171, NM_172172, NM_172173), CaM-KK
(Genbank accession nos. NM_032294, NM_172206, NM_172207), and CaM-KK ß (Genbank accession nos. NM_006549, NM_153499, NM_153500, NM_172214, NM_172215, NM_172216, NM_172226) were designed and synthesized by Dharmacon (Lafayette, CO). siRNA (100 nmol/L) was transfected into MCF-7 cells according to the manufacturer's instructions using LipofectAMINE 2000 in Opti-MEM I. A nonspecific RNA duplex was used in control experiments. Seventy-two hours post-transfection, cells were replated and allowed to grow for 48 hours. Cells were harvested for cell cycle and immunoblot analysis.
Cell cycle analysis by flow cytometry. Cells (0.5-1.0 x 106) were trypsinized, centrifuged, and resuspended in 1 mL PBS buffer (1x PBS and 2% FBS). Three milliliters of ethanol were added and cells were fixed at 20°C for a minimum of 1 hour. Cells were washed and resuspended in 1 mL of PBS buffer. DNA extraction buffer [200 mmol/L sodium phosphate, dibasic (pH 7.8) and 100 mmol/L citric acid] was added (500 µL) and cells were incubated for 5 minutes at room temperature. Cells were centrifuged and resuspended in 1 mL of propidium iodide (PI) solution (50 µg/mL), 50 µL of RNase A solution (10 mg/mL) was added to each tube, and cells were incubated for 30 minutes. DNA profiles of PI-stained cells were analyzed on a Becton Dickinson FACScan (San Jose, CA) and cell cycle plots generated by data analysis in ModFit LT 3.1 software.
DNA fragmentation assay. The DNA fragmentation assay was done as previously described (19). Cells were washed with 1x PBS, centrifuged, and resuspended in lysis buffer [50 mmol/L Tris-HCl (pH 7.5), 20 mmol/L EDTA, and 1% NP40]. DNA was extracted with isopropanol/ethanol. The degree of fragmentation was analyzed using 3% agarose gel electrophoresis followed by ethidium bromide staining.
| Results |
|---|
|
|
|---|
50 to 60,000/cm2 (day 8). However, the CaM-K inhibitor KN-93 significantly reduced cell proliferation in comparison with the controls (Fig. 1A). When cells were treated with KN-93, the number of cells in the culture did not increase at all over the 8 days of these studies. Cell viability was confirmed the same for all experimental groups by acridine orange/ethidium bromide staining and observation under fluorescence microscopy (data not shown). These outcomes show that specific inhibition of the CaM-Ks in breast cancer cells results in a decrease in cell proliferation and not in immediate cell death. As can be seen from the photographs of cells treated with DMSO, KN-92, or KN-93 (Fig. 1B), MCF-7 cells treated with either DMSO or the inactive analogue KN-92 formed visually similar colonies of cells by day eight of culture. However, the cells treated with the CaM-K inhibitor KN-93 failed to establish colonies 8 days after treatment. These results support our data in Fig. 1A that demonstrates that inhibition of the CaM-Ks results in a decrease in the proliferation of MCF-7 breast cancer cells.
|
|
and CaM-KII
isoforms were both expressed in MCF-7 and MCF-10A cells as it has been previously shown (12). The expression of these two isoforms seemed similar in both cell lines. CaM-KI expression was detected in MCF-7 cells but not in MCF-10A cells. It is possible that CaM-KI is being expressed in MCF-10A; however, it must be at a level below detection on our immunoblots. The expression of the CaM-KKs has not been characterized in breast cells. In other cell types, there are two reported isoforms for CaM-KK (CaM-KK
and CaM-KKß; ref. 20). In addition, some cells express multiple variants of CaM-KKß (21, 22). In our experiments, the antibody used recognized two bands of CaM-KK in MCF-7 cells and only one band in MCF-10A cells (Fig. 3A). To determine if the two bands seen in MCF-7 cells were either multiple isoforms of CaM-KKß or represented CaM-KK
and CaM-KKß, RNA was obtained and RT-PCR analysis was done. Three variants of human CaM-KK
mRNA have been identified (Genbank). All three mRNA variants result in the amplification of a 116-bp fragment using the CaM-KK
primers. MCF-7 cells express both
and ß1 mRNA isoforms of CaM-KK based on the primers used and the sizes of the fragments obtained (Fig. 3B). We do not know the identity of the slightly smaller fragment that is identified using the CaM-KK
primers. It may represent a spliced variant or a yet to be identified isoform. It is known that CaM-KK is alternatively spliced (11). The CaM-KKß2 isoform was not expressed at readily detectable levels in the MCF-7 cells. Furthermore, MCF-10A cells express only the CaM-KK
mRNA isoform (data not shown), suggesting that the unique band observed in the immunoblots for MCF-10A cells is likely the CaM-KK
isoform. Consequently, the higher molecular weight band observed in immunoblots for MCF-7 cells may be CaM-KKß1. CaM-KIV was not expressed in either of the breast cell lines but was seen in our positive control (Jurkat). These results would suggest that the specificity of the anti-proliferative effect of KN-93 on MCF-7 breast cancer cells may be due to the inhibition of CaM-KI.
|
|
Calcium/calmodulin-dependent kinase inhibitor KN-93 inhibits cyclin D1 expression. To examine the mechanisms by which KN-93 causes cell cycle arrest in breast cancer cells, exponentially growing MCF-7 cells were treated with KN-93 and cell lysates were obtained at 48 and 72 hours. As observed (Fig. 4D), cyclin D1 protein levels were moderately reduced at 48 hours and disappeared at 72 hours after treatment with KN-93. The levels of cyclin D1 were not affected in the cells treated with DMSO or mildly affected with the negative analogue KN-92. There was a slight decrease in cyclin D3 immunoreactivity in cells treated with KN-93 for 72 hours. A slower migrating band appeared above cyclin D3 in the same treatment group in comparison with controls. It is possible that cyclin D3 is phosphorylated, leading to a decreased cyclin D3 electrophoretic migration. Furthermore, Rb was found in its unphosphorylated form (110 kDa) in cells treated with KN-93. Cells treated with DMSO or KN-92 conserved the phosphorylated form of pRb that is characterized by slower migration (115 kDa). Cyclin E levels did not change in any case. It is possible that the lack of cyclin D1 results in nontitrated p21/p27. Consequently, these cyclin-dependent kinase (CDK) inhibitors may suppress the cyclin E/cdk2 complex kinase activity. This could explain the lack of pRb phosphorylation even in the presence of normal cyclin E levels. The levels of the CDK inhibitor p27 did not change in any case. CaM-K inhibition did not alter the levels of cdk4 and cdk6. Overall, these results indicate that treatment of breast cancer cells with the CaM-K inhibitor results in decreased levels of cyclin D1. This decrease would result in decreased pRb phosphorylation and the subsequent G0-G1 cell cycle arrest.
CaM-KI siRNA blocks cell cycle progress in the G0-G1 phase of the cell cycle. Because it has been shown that KN-93 can inhibit CaM-KI, CaM-KII, and CaM-KIV (5, 23); that MCF-7 cells are more sensitive than MCF-10A cells to the anti-proliferative effects of KN-93; and that MCF-7 cells, but not MCF-10A cells, express detectable levels of CaM-KI, we decided to determine if CaM-KI could be responsible for the disruption of the cell cycle progression. Cells were transfected with specific siRNA directed to silence the expression of CaM-KI, CaM-KII
, or CaM-KII
. Treatment of the cells with siRNA directed towards CaM-KII
resulted in a decrease of CaM-KII
protein but not CaM-KK
protein (Fig. 5A). Conversely, treatment of the cells with CaM-KII
siRNA resulted in the down-regulation of CaM-KII
protein but not CaM-KII
protein. When cells were treated with both CaM-KII
and CaM-KII
, siRNA suppression of both proteins could be noted. The suppression of CaM-KII
was not complete in this case; however, it should be noted that the cells in all of the experiments were transfected with a total of 100 nmol/L of siRNA (in this case, 50 nmol/L of each siRNA). When the MCF-7 cells were treated with siRNA directed to CaM-KI, suppression in the expression of CaM-KI protein could be noted. Suppression of any nonsilenced CaM-K or actin was not observed when the cells were transfected with any siRNA (Fig. 5A) indicating the specificity of the siRNA.
|
and CaM-KII
siRNA did not induce cell cycle arrest. These results suggest that it is CaM-KI and not CaM-KII that controls the G0-G1 phase progression of the cell cycle in MCF-7 human breast cancer cells and suggests a mechanism for the requirement of both calcium and calmodulin in cell proliferation.
Calcium/calmodulin-dependent kinase kinase siRNA causes cell cycle arrest of breast cancer cells in the G1 phase of the cell cycle. CaM-KK has a role in the phosphorylation and activation of CaM-KI (6). MCF-7 cell transfection with siRNA for either the CaM-KK
or CaM-KKß isoform down-regulates both bands of immunoreactivity (Fig. 6A). It is possible that the sequences of the siRNAs are targeted to a similar region in CaM-KK
and CaM-KKß RNA. Regardless, when MCF-7 cells were transfected with siRNA to either CaM-KK
or CaM-KKß, we observed cell arrest in the G1 phase of the cell cycle when compared with cells either untransfected or transfected with nonspecific siRNA (Fig. 6B). When 50 nmol/L siRNA to CaM-KKß was used in combination with 50 nmol/L siRNA to CaM-KI, a similar increase in the number of cells in G1 over those seen using siRNA to CaM-KKß alone was noted. These findings would suggest that CaM-KK is acting via CaM-KI.
|
| Discussion |
|---|
|
|
|---|
In the cell cycle G1 phase, the cells respond to extracellular cues to make the decision whether to replicate DNA and divide or to exit into a resting state (G0; ref. 13). The time point in G1 phase in which this decision is made is called the "restriction point" because after this point the cells are irreversibly committed to complete the cycle (24). This restriction point transition is controlled by CDKs (25, 26). These enzymes contain both regulatory (cyclin) and catalytic (cdk) subunits. Calcium and its intracellular receptor calmodulin are common to all regulatory transitions of the cell cycle (14). Mouse or human cells cultured in medium containing low concentrations of calcium cease cellular division and accumulate in G1 (27). The calmodulin inhibitors W-7 and W-13 prevent proliferation and colony formation in breast cancer cells and other cell lines (28). Traditionally, it has been thought that CaM-KII is controlling the G1 phase restriction point based on results obtained with KN-93 or KN-62. These inhibitors were once thought to be CaM-KII specific (2931). However, a recent article by Kahl and Means (15) found that overexpression of a kinase-deficient CaM-KI but not a kinase-deficient CaM-KII prevented G1 progression in normal fibroblasts. Although their research was done in nonimmortalized, nontransformed WI-38 fibroblasts and ours in a tumorigenic cell line, our results corroborate that it is CaM-KI and not CaM-KII that is involved in the regulation of the G1 phase of the cell cycle. Furthermore, our study defined that CaM-KK, an upstream activator of CaM-KI, is also participating in the control of the G1 restriction point of the cell cycle of MCF-7 breast cancer cells.
Cyclin D1 function is essential for regulation of the progression through the restriction point from G1 to S phase (32). Cyclin D1 binds cdk4/6, allowing the phosphorylation of pRb. pRb is the restriction point gate keeper as phosphorylated pRb is not able to repress E2F transcriptional activity (13). Consequently, cyclin D1 has been proposed to be a potential target for chemoprevention/treatment of cancer (33). The role of the CaM-Ks with regard to the G1 restriction point seems mediated in part by cyclin D1 accumulation. Cyclin D1 is one of the most commonly overexpressed oncogenes in breast cancer (3437). Forty-five percent to 50% of the primary ductal carcinomas overexpress this protein (38, 39). It was recently shown that cyclin D1 is essential for the development of mammary cancers induced by c-neu and v-Ha-ras (40). Cyclin D1 plays a major role in estrogen-induced mitogenesis in breast cancer cells (38, 4145). Our results suggest that inhibition of CaM-KK and CaM-KI induces a decrease in the levels of cyclin D1; consequently, pRb phosphorylation is reduced. Previous studies have also found a down-regulation of cyclin D1 in NIH-3T3 fibroblasts treated with KN-93 (31). Kahl and Means reported that CaM-KI inhibition causes down-regulation of the activity of the cyclin D1/cdk4 complex but not a reduction in cyclin D1 protein levels (15). In our studies, we observed a decrease in cyclin D1 levels following treatment with KN-93. This may reflect the tumorigenic nature of the cells, as the studies that showed a down-regulation of cyclin D1 by KN-93 used transformed cells, and those that did not used primary cells.
The mechanisms by which the inhibition of CaM-KI causes down-regulation of cyclin D1 protein levels in MCF-7 cells are not clear. Cyclin D1 expression can be regulated either by transcription, translation, or protein stability (32). We observed that cyclin D1 protein levels did not increase in serum-deprived growth-arrested cells released in complete medium in the presence of KN-93 (data not shown). This suggests that CaM-KI may be inducing cyclin D1 transcription and/or translation. CaM-KI is localized in the cytoplasm; however, whether it can translocate to the nucleus is not known (46). If CaM-KI remains in the cytoplasm, it must be regulating a substrate that can translocate to the nucleus and modulate transcription. Very little is known about physiologically relevant substrates for CaM-KI. It has been shown that CaM-KI can cause cyclic AMPresponsive element binding (CREB) protein phosphorylation in vitro. Although there is a CRE sequence on the cyclin D1 promoter, MCF-7 cells do not express detectable CREB (47). Recently, it has been shown that CaM-KI can participate in extracellular signal-regulated kinase (ERK) activation; thus, ERK may be a potential substrate in breast cancer cells (48). Joseph and Means have reported that CaM-KK and CaM-KI in Aspergillus nindulans are involved in the regulation of DNA synthesis (49). Whether CaM-KI is exclusively controlled by CaM-KK for G1-to-S phase transition remains to be elucidated.
The distribution of MCF-7 cells in the different phases of the cell cycle suggests that the cells are not cycling, as time-dependent cell accumulation in G1 phase is not happening. This would imply a block not only in G1 phase but also in S-G2 phases. A potential role was described for CaM-KII in regulating centrosome duplication in Xenopus eggs (50). However, the role of CaM-KII in regulating centrosome duplication in mammalian cells is unknown. In addition, it has been suggested that CaM-KII participates in the G2-M transition in HeLa cells controlling cdc25 phosphorylation (51). Furthermore, CaM-Ks involvement in the S phase is unknown (14). It is possible that when we treat the cells with KN-93, CaM-KI is inhibited, and this leads to a block in the G1 phase. In addition, KN-93 may inhibit CaM-KII and induce a block in G2. However, the percentages of distribution would suggest that the cells are also blocked in the S phase as the number of cells in G2 remains the same. Nevertheless, CaM-KII silencing with siRNA did not cause any apparent cell cycle arrest in S or G2 phase. Another potential explanation is that the lack of cycling cells is an artificial effect because G1-arrested cells are suffering apoptosis as shown. Thus, the distribution would remain similar with no more cell accumulation in G1.
Our laboratory has previously shown that CaM-KII and CaM-KIV can be activated by certain forms of oxidative stress (8, 9). We have observed that CaM-KII can be activated by oxidative stress in MCF-7 breast cancer cells. In the presence of KN-93, MCF-7 cells are more sensitive to the effects of oxidative stress-inducing treatments like radiotherapy and photodynamic therapy.3 Considering that one compound may inhibit CaM-KI and CaM-KII, causing proliferation arrest in addition to sensitization to oxidative stress-inducing treatments, the idea of treating breast cancer through CaM-K inhibition may be possible.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| Footnotes |
|---|
Received 1/26/05. Revised 3/14/05. Accepted 3/21/05.
| References |
|---|
|
|
|---|
B phosphorylation in human T lymphocytes. J Biol Chem 2002;277:3046976.This article has been cited by other articles:
![]() |
S. Gattenlohner, T. Stuhmer, E. Leich, M. Reinhard, B. Etschmann, H.-U. Volker, A. Rosenwald, E. Serfling, R. C. Bargou, G. Ertl, et al. Specific Detection of CD56 (NCAM) Isoforms for the Identification of Aggressive Malignant Neoplasms with Progressive Development Am. J. Pathol., April 1, 2009; 174(4): 1160 - 1171. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Monteiro, D. Gilot, E. Le Ferrec, C. Rauch, D. Lagadic-Gossmann, and O. Fardel Dioxin-Mediated Up-Regulation of Aryl Hydrocarbon Receptor Target Genes Is Dependent on the Calcium/Calmodulin/CaMKI{alpha} Pathway Mol. Pharmacol., March 1, 2008; 73(3): 769 - 777. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Minaguchi, K. A. Waite, and C. Eng Nuclear Localization of PTEN Is Regulated by Ca2+ through a Tyrosil Phosphorylation-Independent Conformational Modification in Major Vault Protein Cancer Res., December 15, 2006; 66(24): 11677 - 11682. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Fava, L. Marucci, S. Glaser, H. Francis, S. De Morrow, A. Benedetti, D. Alvaro, J. Venter, C. Meininger, T. Patel, et al. {gamma}-Aminobutyric Acid Inhibits Cholangiocarcinoma Growth by Cyclic AMP-Dependent Regulation of the Protein Kinase A/Extracellular Signal-Regulated Kinase 1/2 Pathway Cancer Res., December 15, 2005; 65(24): 11437 - 11446. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |