Cancer Research Annual Meeting 2010  Jordan
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Farago, M.
Right arrow Articles by Seldin, D. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Farago, M.
Right arrow Articles by Seldin, D. C.
[Cancer Research 65, 5792-5801, July 1, 2005]
© 2005 American Association for Cancer Research


Cell and Tumor Biology

Kinase-Inactive Glycogen Synthase Kinase 3ß Promotes Wnt Signaling and Mammary Tumorigenesis

Marganit Farago1, Isabel Dominguez1, Esther Landesman-Bollag1, Xin Xu1, Andrea Rosner2, Robert D. Cardiff2 and David C. Seldin1

1 Molecular Medicine Program, Department of Medicine, Boston University Medical Center, Boston, Massachusetts and 2 Center for Comparative Medicine, University of California-Davis, Davis, California

Requests for reprints: David C. Seldin, 650 Albany Street, Boston, MA 02118. Phone: 617-638-7027; Fax: 617-638-7530; E-mail: dseldin{at}bumc.bu.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Recent studies have implicated ectopic activation of the Wnt pathway in many human cancers, including breast cancer. ß-catenin is a critical coactivator in this signaling pathway and is regulated in a complex fashion by phosphorylation, degradation, and nuclear translocation. Glycogen synthase kinase 3ß (GSK3ß) phosphorylation of the NH2-terminal domain of ß-catenin targets it for ubiquitination and proteosomal degradation. We hypothesized that expression of kinase-inactive GSK3ß (KI-GSK3ß) in mammary glands would function in a dominant-negative fashion by antagonizing the endogenous activity of GSK3ß and promoting breast cancer development. Consistent with this, we find that KI-GSK3ß stabilizes ß-catenin expression, catalyzes its localization to the nucleus, and up-regulates the downstream target gene, cyclin D1, in vitro. In vivo, transgenic mice overexpressing the KI-GSK3ß under the control of the mouse mammary tumor virus-long terminal repeat develop mammary tumors with overexpression of ß-catenin and cyclin D1. Thus, antagonism of GSK3ß activity is oncogenic in the mammary epithelium; mutation or pharmacologic down-regulation of GSK3ß could promote mammary tumors.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Glycogen synthase kinase 3ß (GSK3ß) is a serine/threonine kinase that was originally found to have a pivotal role in glycogen metabolism and insulin-mediated signaling but is now recognized to function in multiple biological pathways. More than 40 proteins have been reported to be phosphorylated by GSK3ß, including over a dozen transcription factors (1). Recently, attention has focused on the developmental role of GSK3ß. During fly development, the GSK3 homologue, zeste-white 3, is a negative regulator of wingless (wg) signaling, the agonist responsible for normal wing development. The vertebrate homologues of wg, the Wnts, are responsible for embryonic patterning beginning with the establishment of the embryonic axes (2). In Xenopus development, the dorsoventral axis is established by dorsal accumulation of ß-catenin, a critical coactivator in the Wnt signaling pathway (3). Positive elements of the Wnt canonical pathway (e.g., ß-catenin) produce ectopic axes when injected ventrally, whereas inhibitors or negative regulators of the pathway antagonize dorsalization. Rat, human, and Xenopus GSK3ß block dorsalization, whereas inactive mutants of GSK3ß act as dominant negatives of the normal enzyme function, inducing axis duplication when injected ventrally in the embryo (46).

Biochemical studies have elucidated the role of GSK3ß in the canonical Wnt signaling pathway. In the absence of Wnt signals, free cytoplasmic ß-catenin is incorporated into a cytoplasmic complex that includes Axin, GSK3ß, and adenomatous polyposis coli (APC). This enables casein kinase I to phosphorylate ß-catenin, creating a consensus site on ß-catenin for phosphorylation by GSK3ß. The phosphorylated ß-catenin is then targeted for ubiquitin-mediated proteasomal degradation (7). This process is opposed by casein kinase 2 (CK2), which phosphorylates ß-catenin in the armadillo repeat region, stabilizing it and promoting Wnt signaling and dorsal axis formation (810). Wnt signaling via Dishevelled (Dsh) inactivates GSK3ß and prevents it from phosphorylating ß-catenin, reducing its affinity for axin and APC and stabilizing it in the cytoplasm. As ß-catenin accumulates, it translocates into the nucleus, where it binds to T-cell factor (TCF) and lymphoid-enhancing factor (LEF) transcription factors and dramatically increases their transcriptional activity. Genes up-regulated by TCF/LEF include embryologic genes, such as siamois and engrailed (11), and adult proto-oncogenes, such as c-myc and cyclin D1 (1214).

In the mammary gland, canonical Wnt signaling seems to play a role in both development and cancer. Wnt 6 and Wnt 10b are expressed on the surface of the ectoderm in mammary placodes and buds beginning on embryonic day 11.25 and are essential for initiation of mammary morphogenesis (15, 16). LEF-1 is expressed in the mammary gland beginning at embryonic day 11.5, and in LEF-1 deficient mice, the gland fails to develop (17). {Delta}N89-ß-catenin, a mutant of ß-catenin that lacks the NH2-terminal GSK3ß phosphorylation sites and is thereby stabilized, promotes precocious alveolar development during puberty (18). Negative regulators of Wnt signaling block mammary gland development: ectopically expressed Dickkopf, a Wnt pathway inhibitor, blocks early mammary gland development (19); other negative regulators of ß-catenin inhibit alveolar development in pregnancy (20).

Although a role for the Wnt pathway is well recognized in colon cancer, where, for example, mutations of the APC and ß-catenin genes are found in both sporadic and inherited cancers, little is known about the Wnt pathway in human mammary tumorigenesis. Overexpression of several Wnts has been reported in breast cancer (2124) and amplification of the Dsh downstream messenger has been seen in 50% of primary breast tumors (25). Up-regulation of ß-catenin mRNA levels has been detected by microarray analysis in human breast cancer (26) and elevation of ß-catenin protein expression has been reported in 60% of human breast cancer tissues (27). Detection of ß-catenin by immunohistochemistry has been associated with poor outcome (28, 29). These events have been modeled in mice, as mammary gland tumors develop in transgenic mice overexpressing genes in the Wnt signaling pathway, including Wnt 1 (30), Wnt 10b (31), {Delta}N89-ß-catenin (18), and cyclin D1 (32). In contrast, in transgenic mice that overexpress Axin, the expression of cyclin D1 is attenuated and increased apoptosis occurs in the mammary epithelia (33). Overexpression of the regulator CK2{alpha} also promotes mammary tumorigenesis (34). In this regard, GSK3ß has not been studied. In this article, we use a novel mouse model to explore the effect of Wnt pathway deregulation on the development of breast cancer, with emphasis on GSK3ß as a pivotal kinase regulator in this pathway. Because inactive mutants of GSK3ß can activate canonical Wnt signaling, we hypothesized that overexpression of kinase-inactive GSK3ß (KI-GSK3ß) in mammary glands would work as a dominant negative, antagonizing the endogenous activity of GSK3ß. Consistent with this, we find that kinase-inactive murine GSK3ß (KI-mGSK3ß) stabilizes ß-catenin expression and catalyzes its localization to the nucleus and up-regulates the downstream target gene, cyclin D1, in vitro. In vivo, transgenic mice overexpressing the mutant form of GSK3ß under the control of the mouse mammary tumor virus (MMTV)-long terminal repeat (LTR) develop mammary tumors. Analyses of the tumors show overexpression of ß-catenin as well as cyclin D1. Thus, antagonism of GSK3ß activity is oncogenic in the mammary epithelium; mutation or pharmacologic down-regulation of GSK3ß could promote mammary tumors.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cloning of mouse glycogen synthase kinase 3ß and kinase-inactive murine glycogen synthase kinase 3ß. Based on the sequence of human GSK3ß, we synthesized a pair of primers and amplified a portion of the mGSK3ß cDNA. A randomly primed murine spleen Lambda ZAP II cDNA library (Stratagene, La Jolla, CA) was screened with the radiolabeled murine PCR product and a single clone was isolated that contained a full-length GSK3ß open reading frame (ORF) based on bidirectional sequencing (DNA/Protein Core Facility, Boston University School of Medicine, Boston, MA). Double-stranded site-directed mutagenesis was done on the mGSK3ß sequence to introduce a mutation into the ATP-binding site, changing KKV at amino acids 85 to 87 to MII with the expectation of creating an inactive enzyme, mGSK3ß-KI. This created an additional BclII site, so PCR was used to amplify the fragment containing the mutation and distinguish it by BclII digestion, and it was also confirmed by sequencing. For in vitro experiments, the KI-mGSK3ß cDNA was subcloned into pcDNA3.0 (Invitrogen, Carlsbad, CA). Using PCR, a hemagglutinin (HA) tag was added 5' to the KI-mGSK3ß coding sequence in this vector. The sense oligonucleotide primer contained HA tag and the KI-mGSK3ß sequence (5'-GGGGTACCACCACCATGGCCTACCCATACGACGTACCAGACTACGCATCGGGGCGACCGAGAACCACC-3') and an antisense oligonucleotide was from the end of the ORF (5'-GGTCTAGAGCTCCTGGGGGCTGTTCAGG-3'). Parallel experiments to those with the HA-KI-mGSK3ß were carried out with a myc-tagged kinase-inactive mutant of rat GSK3ß (rGSK3ß), myc-rGSK3ß(K85R).

Cell culture. C57MG normal mouse mammary epithelial cells were grown in DMEM supplemented with 10% fetal bovine serum, 4 mmol/L glutamine, 50 units/mL penicillin, and 50 mg/mL streptomycin (Cellgro, Mediatech, Inc., Herndon, VA) in a 5% CO2 incubator at 37°C. Transfections were done using LipofectAMINE 2000 (Invitrogen) or the Amaxa nucleofection system according to the manufacturer's instructions. The total amount of transfected DNA was kept constant by adding plasmid vector DNA when necessary. For small interfering RNA (siRNA) experiments, cells were transfected with SMARTpool mGSK3ß siRNA or siCONTROL (Dharmacon, Chicago, IL). Alternatively, cells were treated with the GSK3 inhibitors SB216763 (Sigma, St. Louis, MO) or TDZD-8 (Calbiochem, San Diego, CA).

Western blot analyses. Protein extracts were prepared by homogenizing frozen tumors or mammary gland specimens in lysis buffer as described (34). Primary antibodies were the following monoclonal antibodies: anti-ß-catenin (BD, Lexington, KY), anti-ß-actin (Sigma), anti–cyclin D1 (Calbiochem), anti-{alpha}-tubulin (Sigma), anti-HA.11 (Covance/Babco, Richmond, CA), anti-c-myc (Roche, Indianapolis, IN), and anti-SP1 (BD). For quantitative analysis of each band, integrated pixel density minus background density was determined using a Fluor-S MultiImager and analysis was done using Quantity One software (Bio-Rad, Hercules, CA).

For nuclear and cytoplasmic separations, cells were washed, harvested with ice-cold PBS, and centrifuged at 960 x g for 5 minutes at 4°C. The pellet was suspended in 2 volumes of ice-cold, low-salt buffer [10 mmol/L HEPES (pH 7.9), 1.5 mmol/L MgCl2, 10 mmol/L KCl, 0.05% NP40, 0.5 mmol/L DTT] supplemented with protease inhibitor cocktail (Sigma) and incubated on ice for 30 minutes. Following 15 minutes of centrifugation at 10,600 x g, the supernatants were frozen as cytoplasmic extracts. Nuclei were extracted with 2 volumes of ice-cold, high-salt buffer [20 mmol/L HEPES (pH 7.9), 1.5 mmol/L MgCl2, 0.42 mol/L NaCl, 0.2 mmol/L EDTA, 0.5 mmol/L DTT, 0.5 mmol/L phenylmethylsulfonyl fluoride, 25% (v/v) glycerol] and incubated at 4°C for 40 minutes. Nuclear extracts were cleared by centrifugation at 20,800 x g for 15 minutes.

Immunofluorescence microscopy. C57MG cells were transfected with HA-KI-GSK3ß using the Amaxa nucleofection system and plated on glass coverslips. Twenty-four hours later, the transfected cells were transferred into 1% fetal bovine serum in DMEM, starved overnight, and then stained. Cells were washed thrice with cold PBS and then fixed and permeabilized with 4% paraformaldehyde and 0.5% Triton X-100 for 10 minutes, blocked with 3% bovine serum albumin for 30 minutes, and subsequently incubated at 4°C with primary anti-ß-catenin antibody and secondary FITC-conjugated anti-mouse IgG (Sigma) for 60 minutes each. For nuclear staining, we used Hoechst dye by adding a 1:100 dilution of 100 µg/mL stock to the medium of the cells 20 minutes before the beginning of the experiment. Pictures were taken in a fluorescence microscope (Nikon, Japan) fitted with a digital camera (Diagnostic Instruments, Sterling Heights, MI). The software used was Spot Advance (Diagnostic Instruments).

ß-catenin protein stability. C57MG cells (0.5 x 106) were transiently transfected with different amounts of the HA-KI-GSK3ß construct. After 24 hours, the cells were starved in 1% fetal bovine serum and 16 hours later were treated with 50 µg/mL cycloheximide to block de novo protein synthesis. Samples were taken at the beginning of the experiments and at 2-hour intervals. At each time point, the cells were washed in cold PBS and pelleted, proteins were extracted, and Western blotting was done for ß-catenin.

Quantitative real-time PCR and semiquantitative reverse transcription-PCR. Reactions (25 µL) were prepared by mixing 12.5 µL of Taqman Universal PCR Master Mix (Applied Biosystems, Foster City, CA), 5 ng of the relevant cDNA, and 1.25 µL of an Assay-on-Demand gene expression product for cyclin D1 (CCND1) or ß-glucuronidase (GUSB) as an endogenous control. Quantitative real-time PCR (qPCR) was done in an ABI Prism 7000 Sequence Detection System (Applied Biosystems). The initial step was for 10 minutes at 95°C and then 40 cycles of denaturation at 95°C for 15 seconds and annealing/extending at 60°C for 1 minute. Background signal was eliminated and Ct values were determined using the SDS version 1.1 analysis software (Applied Biosystems). Standard curves for CCND1 and GUSB were done to confirm that the sample Ct values were within the range. For reverse transcription-PCR (RT-PCR), total RNA (1 µg) was reverse transcribed using the ProSTAR First-Strand RT-PCR kit (Stratagene). PCR with specific primers for cyclin D1 (sense 5'-CCCTCCGTATCTTACTTCAA-3' and antisense 5'-GATGGTCTGCTTGTTCTCAT-3') was done in a thermal cycler (MJ Research, Watertown, MA) by denaturing at 95°C for 3 minutes and then 30 cycles of denaturing at 95°C for 30 seconds, annealing at 53°C for 30 seconds, and extending at 72°C for 30 seconds.

Transgenic animals. The KI-mGSK3ß cDNA was subcloned into a vector in which the MMTV-LTR directs expression to the mammary epithelium, with ras 5' untranslated sequences provided upstream of the cDNA and a SV40 intron and polyadenylation signal downstream (35). Plasmid sequences were removed by restriction digestion at the SalI and SpeI sites, and the excised transgene construct was gel purified and microinjected into pronuclei of fertilized one-cell zygotes of FVB/N mice in the Transgenic Core Laboratory at Boston University School of Medicine. Three independent transgenic lines were obtained, and female transgenic mice were continuously bred to induce transgene expression through activation of the hormone-dependent MMTV-LTR. Mice were monitored weekly for the appearance of tumors. Mice (n = 117) were sacrificed and tissues were collected for histopathological analysis, cell culture, and RNA and/or protein analyses. To assess expression levels of the transgene in the mouse organs, tissues were collected from 6- to 8-week-old females that were pregnant and from females that developed mammary tumors.

Expression analyses. For expression analysis, total RNA was extracted from mouse tissues. After DNase treatment (Roche), RNA was reextracted and ethanol precipitated. RNA (5-10 µg) was then reverse transcribed using the ProSTAR First-Strand RT-PCR kit. PCR was done with sense GSK3ß (CGAGACACACCTGCACTCTT) and SV40 primers described above, for 35 cycles, to detect the transgene. Both spliced and unspliced transgene mRNA could be amplified (614 and 547 bp), as there is a splice donor and acceptor in the amplified region of the SV40 poly(A) tail. The quality of first-strand synthesis was verified with HPRT amplification (36).

Histology. On necropsy, tumors and organs were removed and immediately fixed in Optimal Fix (American Histology Reagent Co., Inc., Lodi, CA). The tissues were processed, embedded in paraffin, and sectioned at 7 µm. The sections were mounted on glass slides and stained with H&E using routine laboratory procedures in the Transgenic Core Pathology Laboratory at the University of California-Davis (Davis, CA). Immunohistochemistry for cytokeratins, smooth muscle actin, hair keratin, and estrogen and progesterone receptors were done as described previously (37). Images were captured with x10, x20, and x40 objectives using a Carl Zeiss (Thornwood, NY) Axiocam camera and processed using Adobe Photoshop (Adobe Systems, Inc., San Jose, CA) software. Sections were compared with other specimens in the extensive mouse mammary tumor database. 3


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of myc-rGSK3ß(K85R) up-regulates ß-catenin in mammary epithelial cells. As a first step to determine whether dysregulation of GSK3ß could play a role in mammary carcinogenesis, we manipulated its levels in cells in vitro and assessed the expression of ß-catenin as an indicator of Wnt signaling. Initial experiments were carried out with a previously described rat construct (4). C57MG cells, a nonmalignant cell line derived from murine breast epithelial cells, were transiently transfected by nucleofection with increasing amounts of myc-tagged kinase-inactive mutant form of rGSK3ß, myc-rGSK3ß(K85R), construct. pEGFP-C1 was cotransfected; the transfection efficiency using this method was 75% (data not shown). After 48 hours, protein extracts were analyzed for ß-catenin expression. ß-catenin protein levels were up-regulated with increasing expression of the myc-rGSK3ß(K85R) (Fig. 1A), consistent with increasing activation of the Wnt pathway.



View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Expression of myc-rGSK3ß(K85R) up-regulates ß-catenin expression in mammary epithelial cells. A, expression of myc-rGSK3ß(K85R) up-regulates ß-catenin expression in C57MG cells. Increasing amounts of myc-rGSK3ß(K85R) plasmid (in µg) were transiently transfected into C57MG cells. Protein (5 µg) extracted from the cell was subjected to immunoblotting for ß-catenin; myc-rGSK3ß(K85R) was detected using an anti-myc antibody; ß-actin was used as a loading control. B, transfection with myc-rGSK3ß(K85R) plasmid (1-6 µg) increases the half-life of ß-catenin protein. Cells were treated with 50 µg/mL cycloheximide 48 hours after transfection. Top, two representative blots; bottom, relative percentage of protein compared with time 0, normalized to ß-actin. C, cyclin D1 expression is up-regulated in C57MG cells overexpressing myc-rGSK3ß(K85R). Top, protein (10 µg) extracted from the cells expressing increasing amounts of myc-rGSK3ß(K85R) plasmid (0-4 µg) was subjected to immunoblotting for cyclin D1 and for the myc tag; ß-actin was used as a loading control. Bottom, RNA was prepared from the same cells and subjected to RT-PCR for cyclin D1; hypoxanthine phosphoribosyltransferase (HPRT) was used as a control.

 
myc-rGSK3ß(K85R) stabilizes endogenous ß-catenin protein. In the absence of Wnt signals, ß-catenin is incorporated into a cytoplasmic complex, including GSK3ß, which targets it for degradation. To validate that the changes in ß-catenin expression are due to ability of the myc-rGSK3ß(K85R) to stabilize ß-catenin protein, we studied the half-life of ß-catenin. C57MG cells were transiently transfected with increasing amounts of the myc-rGSK3ß(K85R) construct. Forty-eight hours after transfection, the cells were treated with cycloheximide to block de novo synthesis of ß-catenin, and periodically, cells were harvested and proteins were subjected to immunoblotting to assess ß-catenin stability. The half-life of ß-catenin was increased, being 1.5, 5.4, 26, and 11 hours in the cell lines expressing 0, 2, 4, or 6 µg of the myc-rGSK3ß(K85R), respectively (Fig. 1B).

ß-catenin is localized to the nucleus in mammary cells expressing myc-rGSK3ß(K85R). When Wnt signaling is activated, free ß-catenin is translocated into the nucleus to stimulate transcription of proto-oncogenes, such as cyclin D1 and c-myc. To investigate if myc-rGSK3ß(K85R) can influence the translocation of ß-catenin from the cytoplasm to the nucleus, cytoplasmic and nuclear extracts were prepared from the transfected C57MG cells. In the control cells transfected with the empty vector alone, the levels of ß-catenin protein in the cytoplasm were higher than in the nucleus. In contrast, in the presence of increasing amounts of myc-rGSK3ß(K85R), the levels of ß-catenin in the nucleus were significantly higher than in the cytoplasm (Fig. 2A). Quantification showed a ratio of nuclear-to-cytoplasmic expression of 0.3, 1.9, 3.9, 3.5, 9.8, and 14.8 in cells transfected with 0, 1, 2, 4, or 6 µg of the myc-rGSK3ß(K85R), respectively (Fig. 2A).



View larger version (36K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. ß-catenin is localized to the nucleus in mammary cells overexpressing HA-KI-mGSK3ß and myc-rGSK3ß(K85R). A, 48 hours after transient transfection of increasing amounts of myc-rGSK3ß(K85R) plasmid (0-6 µg), nuclear (N) and cytoplasmic (C) extracts were prepared from C57MG cells. Immunoblotting for ß-catenin was done; {alpha}-tubulin was used as a cytoplasmic control and SP1 as a nuclear control. Bottom, ratio of the amount of protein in the nucleus to that in the cytoplasm. B, cells were subjected to immunofluorescence using a monoclonal antibody against ß-catenin and the nuclei were stained with Hoechst dye: (a) empty vector (FITC alone) and (d) merged with the Hoechst staining, (b) 4 µg HA-KI-mGSK3ß and (e) merged with Hoechst, and (c) FITC secondary antibody control and (f) merged with Hoechst.

 
A murine kinase-inactive form of glycogen synthase kinase 3ß. We cloned the full-length ORF of mGSK3ß from a phage library; its sequence was identical to the sequence in Genbank (gi:7025914). To create an inactive enzyme that might function as a dominant negative for signaling in the Wnt pathway, we mutated the ATP-binding site, similar to what was done for the human GSK3ß (5). In vitro translated wild-type (WT) and mutant GSK3ß constructs were subjected to a kinase assay using a GSK3ß substrate peptide derived from cyclic AMP–responsive element-binding protein (38). The activity of the mutant was <20% of that of the WT enzyme, consistent with its design as a kinase-inactive mutant (data not shown). Moreover, to further confirm the ability of the KI-mGSK3ß construct to act as a dominant negative, we tested its ability to produce axis duplication in Xenopus embryos as has been reported for the mutated inactive human GSK3ß (5). RNA for KI-mGSK3ß was transcribed in vitro and injected ventroequatorially into Xenopus embryos, and these embryos developed ectopic axes consistent with activation of the Wnt pathway (data not shown).

Wnt pathway activation in cells in vitro by HA-KI-mGSK3ß. We confirmed that HA-KI-mGSK3ß acts in the same fashion as myc-rGSK3ß(K85R). Steady-state elevation of ß-catenin expression was detected in C57MG cells transiently transfected with increasing expression of HA-KI-mGSK3ß (Fig. 3A). The half-life of ß-catenin in the transfected cells was as long as 26.6 hours (4 µg plasmid) compared with only 2.2 hours in untransfected cells (Fig. 3B). Immunofluorescence was used to confirm nuclear translocation of the up-regulated ß-catenin. C57MG cells transfected with 4 µg of the HA-KI-mGSK3ß construct or empty vector were fixed and stained with a primary monoclonal antibody against ß-catenin and a secondary antibody conjugated with FITC along with Hoechst dye to identify the nuclei. In the control cells (Fig. 2B, a and d), most of the ß-catenin is located in the cytoplasm and in the plasma membrane. In contrast, the cells transfected with the HA-KI-mGSK3ß plasmid exhibited strong nuclear staining (Fig. 2B, b and e). As a control for nonspecific fluorescence, the FITC secondary antibody was used alone on the same transiently transfected cells (Fig. 2B, c and f). Thus, the mutant HA-KI-mGSK3ß acts similarly to the myc-rGSK3ß(K85R) in promoting ß-catenin stabilization and nuclear translocation, consistent with canonical Wnt pathway activation.



View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Overexpression of HA-KI-mGSK3ß up-regulates ß-catenin and cyclin D1 expression in mammary cells. A, to confirm that the HA-tagged mGSK3ß also regulates ß-catenin, increasing amounts (0-6 µg) were transiently transfected into C57MG cells and expression of ß-catenin and cyclin D1 was determined. B, half-life of ß-catenin protein was measured. C, amount of cyclin D1 mRNA was quantitated using real-time PCR and compared with GUSB as a control; the ratios of the two are plotted based on Ct values. HA-KI-GSK3ß plasmid (0, 1, 4, and 6 µg) was transfected.

 
Inhibition of murine glycogen synthase kinase 3ß using small interfering RNA or pharmacologic inhibitors up-regulates ß-catenin expression. We compared our in vitro results with the HA-KI-mGSK3ß construct to other methods of inhibiting GSK3ß. C57MG cells were transiently transfected by nucleofection with SMARTpool siRNA, a pool of four specific siRNAs for mGSK3ß, or siCONTROL. GSK3ß proteins levels were reduced significantly in cells transfected with the siRNAs for mGSK3ß compared with siRNA control or untransfected cells (Fig. 4A). There was an inverse correlation between the expression of GSK3ß and ß-catenin, which was up-regulated in cells transfected with GSK3ß siRNA. Alternatively, C57MG cells were treated with the GSK3 inhibitors SB216763 or TDZD-8 at 20 and 5 µmol/L, respectively. As expected, the kinase inhibitors did not alter the levels of GSK3ß but up-regulated ß-catenin expression, consistent with inhibition of GSK activity (Fig. 4B and C). Thus, in vitro, the mutant HA-KI-mGSK3ß construct acts similarly to specific GSK3ß siRNA and pharmacologic inhibitors.



View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. Inhibition of mGSK3ß using siRNA or pharmacologic inhibitors up-regulates ß-catenin expression. A, inhibition of GSK3ß by siRNA up-regulates ß-catenin. C57MG cells were transiently transfected with siRNAs for mGSK3ß or siCONTROL. Twenty-four hours later, protein (10 µg) extracted from the cells was subjected to immunoblotting for GSK3ß and ß-catenin; ß-actin was used as a loading control. B and C, pharmacologic inhibitors of GSK3ß up-regulate ß-catenin expression. C57MG cells were treated with DMSO vehicle control (0), SB216763 (20 µmol/L), or TDZD-8 (5 µmol/L) for 30 or 90 minutes. Protein extracted from the cells was subjected to immunoblotting for GSK3ß and ß-catenin; ß-actin was used as a loading control.

 
Cyclin D1 is up-regulated in mammary cell lines transfected with HA-KI-mGSK3ß. When ß-catenin translocates into the nucleus during canonical Wnt signaling, it binds the factors of the TCF/LEF family and dramatically increases their transcriptional activity, stimulating the expression of proto-oncogenes, such as cyclin D1 (13, 14). In a preliminary experiment, we used the TOPFLASH/FOPFLASH TCF/LEF luciferase reporter system (39) and showed that cotransfection of the reporter along with HA-KI-mGSK3ß resulted in a 10-fold increase in luciferase activity compared with controls (data not shown). To show this for an endogenous biologically relevant gene, we measured levels of cyclin D1 in transiently transfected C57MG cells. Semiquantitative PCR with specific primers for cyclin D1 suggested that there was an increased amount of cyclin D1 mRNA in cells expressing the HA-KI-mGSK3ß (data not shown). These results were confirmed using qPCR, where an increase in cyclin D1 mRNA of up to ~7-fold was seen (Fig. 3C). Consistent with these results, the levels of cyclin D1 protein were higher in cells expressing HA-KI-mGSK3ß compared with vector-transfected cells (Fig. 3A, bottom). Similar results were obtained with the myc-rGSK3ß(K85R) construct (Fig. 1C), suggesting that kinase-inactive forms of GSK3ß are able to promote complete and functional Wnt signaling, including up-regulation of target genes.

Transgenic expression of kinase-inactive murine glycogen synthase kinase 3ß in the mouse mammary gland. The KI-mGSK3ß construct was subcloned into a MMTV-LTR vector (40), designed for hormone-dependent transgene expression in the adult mammary gland, and microinjected into fertilized FVB/N mouse oocytes. Three founders were identified by Southern blotting; their offspring had similar expression and phenotypes, so the data were pooled for all three lines. To verify the expression of the transgene mRNA, a transgene-specific RT-PCR assay was employed. During pregnancy, which activates transgene expression, the mammary glands and other epithelial tissues, including kidney, small intestine, salivary gland, and spleen, expressed transgene-specific transcripts (data not shown), a pattern of expression has been seen with other MMTV transgenes (35). To determine whether the transgene protein is functional in vivo as a Wnt pathway activator, we assayed for expression of GSK3ß and ß-catenin protein in the mammary gland. Although the untagged kinase-inactive protein could not be distinguished from the WT kinase by immunoblot, we found an increase in total GSK3ß protein in the mammary gland of the transgenic compared with WT mice along with a significant increase in ß-catenin protein, consistent with Wnt pathway activation by the transgene (Fig. 5A).



View larger version (37K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Transgene expression of MMTV-KI-mGSK3ß in vivo. A, expression of GSK3ß and ß-catenin protein in the mammary glands. Protein (15 µg) extracted from mammary glands (MG) of transgenic (TG) or WT female mice was subjected to immunoblotting for GSK3ß and ß-catenin proteins; ß-actin was used as a loading control. B, RT-PCR analysis of MMTV-KI-mGSK3ß transgene expression in a mouse with a mammary tumor. Total RNA (10 µg) derived from the indicated organs was subjected to RT-PCR with a GSK3ß forward primer and a SV40 reverse primer that encompass a 67-bp splicing region in the SV40 poly(A) tail, yielding a 614-bp unspliced mRNA band or the mature 547-bp mRNA; HPRT amplification confirmed the integrity of the reverse transcription reaction. C, Kaplan-Meier plot of incidence of mammary tumors in three lines of MMTV-KI-GSK3ß transgenic female mice, continuously mated to induce transgene expression.

 
Mammary tumors in MMTV-KI-mGSK3ß transgenic mice. MMTV-KI-mGSK3ß mice develop and breed normally. To promote transgene expression from the hormone-dependent MMTV-LTR, female mice were continuously bred and pups were removed after 7 days of lactation. A cohort of 117 transgenic female mice derived from the three independent transgenic lines was observed for 2 years. Sixty-two percent of the mice developed mammary tumors at a median age of 22 months, with no significant difference in incidence among the lines. Although they occur long after pregnancy, the tumors continue to express the transgene (Fig. 5B). The pooled mammary tumor incidence is illustrated in a Kaplan-Meier plot (Fig. 5C). The tumors and other mammary glands and organs were harvested for histologic and molecular analyses.

Detailed histopathological analyses were done on 54 of the female transgenic mice that had evidence of mammary tumors (Table 1; Fig. 6). Most of the tumors were adenocarcinomas (Fig. 6A), including variants such as papillary carcinomas (Fig. 6B), and the tumors were frequently associated with invasive growth (Fig. 6C). The most common histologic subtypes were pilar (squamous) tumors (n = 13), papillary tumors (n = 12) typically with micropapillary components, glandular tumors (n = 8), and myoepithelial tumors (n = 8 spindle cell tumors and n = 1 adenomyoepithelioma). The tumors tended to be stroma rich, to contain inflammatory infiltrates, and to keratinize. Immunohistochemistry was negative for estrogen and progesterone receptors, except in the spindle cell tumors, which had perinuclear estrogen receptor staining and were also positive for smooth muscle actin (data not shown). Immunofluorescence for cytokeratin 1 (Fig. 6E), cytokeratin 5, cytokeratin 6, and hair keratin (not shown) confirmed transdifferentiation into epidermal and pilar structures. Other mice had hyperplastic and dysplastic mammary lesions without tumors. Twenty-one mice had other malignancies, including lymphomas (n = 8), leukemias (n = 6), bronchoalveolar lung tumors (n = 5), and hepatoma (n = 2). The incidence of nonmammary neoplasms was very similar to that reported for WT mice of the same FVB/N strain (41) and thus most likely does not result from an effect of the transgene.


View this table:
[in this window]
[in a new window]

 
Table 1. Histologic classification of mammary tumors in KI-GSK3ß mice

 


View larger version (125K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. Histology of MMTV-KI-mGSK3ß transgenic mouse mammary tumors. Staining with H&E, except E. A, typical adenocarcinoma with focal squamous metaplasia; B, papillary tumor with micropapillary component; C, squamous cell carcinoma; D, invasion into chest wall; E, immunofluorescence for cytokeratin 1 of squamous nodule confirms epidermal transdifferentiation; F, spindle cell tumor.

 
Transgenic expression of kinase-inactive murine glycogen synthase kinase 3ß up-regulates ß-catenin expression and cyclin D1 in vivo. To confirm that tumorigenesis in the MMTV-KI-mGSK3ß was occurring in association with activation of Wnt signaling, we assayed the expression levels of ß-catenin in mammary glands and tumor tissues from the transgenic mice. ß-catenin protein was up-regulated in the tumor samples in six of seven transgenic mice (Fig. 7A, quantification in Fig. 7B). In these tumors, cyclin D1 was also up-regulated (Fig. 7A).



View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 7. Expression of ß-catenin and cyclin D1 protein in transgenic MMTV-KI-mGSK3ß breast tumors. A, protein (15 µg) extracted from paired normal mammary glands (N) and mammary tumors (Tu) from MMTV-KI-mGSK3ß transgenic mice were subjected to immunoblotting for ß-catenin and cyclin D1 and for ß-actin as a loading control. B, ratio of ß-catenin protein expression in tumor versus normal glands. C, mRNA levels of cyclin D1 are up-regulated in premalignant mammary gland and tumors. qPCR was used to compare the expression of cyclin D1 and ß-catenin mRNA in the mammary glands of MMTV-KI-mGSK3ß transgenics to that in nontransgenic controls. mRNA was extracted from breast tumors from transgenic mice 587 and 3382 and from premalignant mammary gland from mouse 3325. Results are expressed as ratios of ß-catenin mRNA (gray columns) or cyclin D1 mRNA (black columns) compared with mRNA expression in WT FVB/N female mammary gland.

 
Using qPCR, we compared expression of ß-catenin and cyclin D1 in the mammary glands of WT female FVB/N mice and MMTV-KI-mGSK3ß transgenics. We found that the presence of the transgene resulted in a detectable increase in cyclin D1 mRNA (Fig. 7C, black columns) but not ß-catenin mRNA (Fig. 7C, gray columns) in the premalignant mammary gland as well as in malignant mammary gland.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have engineered a murine KI-GSK3ß by altering three residues (85-87) in the ATP-binding site of mGSK3ß, similar to what was done for the human GSK3ß (5). We compared it to a previously described GSK3ß(K85R) construct that has been shown to activate Wnt signaling in rat-1 fibroblasts and PC12 cells (42). The construct had minimal kinase activity against a peptide substrate, consistent with its design as a kinase-inactive mutant. To confirm its ability to act as a dominant negative and stimulate Wnt signaling in the mammary epithelium, we tested the construct both in vitro and in vivo. In vitro, we used C57MG cells, a nonmalignant cell line derived from murine breast epithelial cells. These cells are responsive to Wnt signaling; expression of Wnt in C57MG cells causes morphologic transformation and apparent loss of contact inhibition of cell growth (43). We studied the expression, half life, and subcellular localization of ß-catenin and other target proteins and genes in C57MG cells transfected with increasing amounts of HA-KI-mGSK3ß. We found that KI-mGSK3ß stabilizes ß-catenin expression and promotes its translocalization to the nucleus. We also detected morphologic differences in C57MG cells transfected with HA-KI-mGSK3ß; the cells were less spread out and there was a reduction in membrane staining of ß-catenin probably because of diminished interaction between ß-catenin and E-cadherin in those cells. The previously reported myc-rGSK3ß(K85R) was used in the same assays and gave similar results (4). We compared these findings to other known methods for inhibiting GSK3ß, such as siRNA and pharmacologic inhibitors, and obtained similar results. The key role of GSK3ß as a negative regulator of Wnt signaling has also been shown using siRNA in mouse P19 cells (44).

In vitro, the HA-KI-mGSK3ß promoted Wnt-dependent transcription based on its ability to activate a TCF/LEF-dependent reporter and to up-regulate cyclin D1 mRNA and protein. Cyclin D1 overexpression has been found in 50% of patients with breast cancer, but only 15% to 20% of these cases show gene amplification of cyclin D1 (4547). Other mechanisms, such as up-regulation of gene transcription and translation, also play roles in overexpression of cyclin D1 in breast cancer; in fact, GSK3ß has been shown to directly regulate cyclin D1 turnover in vitro (48). ß-catenin transactivation is correlated significantly with cyclin D1 overexpression in both 8 breast cancer cell lines and 123 primary breast cancer specimens (27).

In vivo, KI-mGSK3ß caused dorsal axis duplication in Xenopus embryos as shown previously for inactive Xenopus, rat, and human GSK3ß (46). Based on these promising results, we then established transgenic mice overexpressing KI-mGSK3ß under the control of the MMTV-LTR. Other investigators have developed transgenic models using the WT enzyme to study its role in phosphorylation of tau in the brain (49, 50), regulation of glucose metabolism in muscle (51), and its role in cardiac development (52, 53).

Using the MMTV promoter, KI-mGSK3ß was expressed in the adult mammary gland in response to steroid hormones and in some other epithelial tissues and T lymphocytes of pregnant mice. This pattern of expression fits with what has been seen with other MMTV transgenes (35). However, in spite of its expression in several epithelial tissues, it causes primarily mammary tumors in FVB/N mice. More than 60% of the female KI-mGSK3ß mice developed mammary tumors at a median age of 22 months. The histology and pattern of cytokeratin expression of these tumors has been compared with other murine mammary tumors and is similar to that of tumors due to other mutations in the Wnt signaling pathway, including mice with Wnt 1, Wnt 10b, and ß-catenin transgenes and APC gene mutations (37, 54). Characteristic for these Wnt pathway-induced mammary tumors are ductular architecture, well-developed stroma, myoepithelial, acinar, or glandular differentiation, and squamous metaplasia (37). As in other mouse models with Wnt pathway activation, some KI-GSK3ß transgenic tumors showed transdifferentiation into epidermal and pilar structures accompanied by typical cytokeratin and hair keratin expression (54). This histologic determination is supported by our molecular results, as expression of KI-mGSK3ß leads to up-regulation of ß-catenin and cyclin D1.

Although tumors developing in the KI-mGSK3ß mice could theoretically result from activation of pathways other than the canonical Wnt pathway, the demonstration of up-regulation of ß-catenin and the transcriptional up-regulation of the Wnt target cyclin D1 in the transgenic tumors is a strong evidence that Wnt pathway activation is a major effect of the transgene, consistent with its ability to mediate this in cells in vitro. Moreover, constitutive expression of Akt, in another signaling pathway that is inhibited by GSK3ß, causes delayed mammary involution but not mammary tumors when it is expressed in the mammary gland using the MMTV promoter (55, 56). This supports our contention that KI-mGSK3ß is acting through the Wnt pathway.

Thus, our experiments show that the KI-GSK3ß can promote mammary tumorigenesis. Other mutant Wnt genes, now well accepted to be important in human tumorigenesis, were first identified in animal models. Wnt-1 itself was cloned as a common insertion site for MMTV in murine mammary tumors (57); mutation of APC in intestinal polyps and cancers was first found as an ethylnitrosourea-induced mutation in APCmin mice (58). The current study suggests that GSK3ß has the capability to be a tumor suppressor, and mutations could be sought in human specimens from breast and other cancers. In addition, as inhibitors of GSK3ß enter clinical trials for treatment of diabetes, consideration should be given to the possibility that such drugs might up-regulate Wnt signaling and promote mammary or other tumors.


    Acknowledgments
 
Grant support: National Institute of Environmental Health Sciences grant P01 ES11624 (D.C. Seldin); U.S. Army Medical Research and Materiel Command predoctoral award W8IXWH-04-1-0375 and Norman G. Levinsky Memorial Fellowship program (M. Farago); Department of Medicine, Boston University School of Medicine pilot research grant and American Cancer Society institutional training grant (I. Dominguez); and Deutsche Forschungsgemeinschaft grant BA 1433/4-1 (A. Rosner).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Sandip Patel for technical assistance with the development of the KI-mGSK3ß transgenic mice, Jessica Murray for assistance in statistical analyses, Patrick Hogan for animal care, Diane Song for providing plasmids and for help with the reporter assay, J.E. Walls for assistance with the immunohistochemistry, Dr. K. Miyoshi for carrying out the cytokeratin immunofluorescence, Drs. G. Shyamala and T-T. Sun for kindly providing the antibodies, and the members of the laboratory for helpful discussions and review of the article.


    Footnotes
 
Note: A. Rosner is currently at the Experimental Center, Department of Radiotherapy and Radiation Oncology, Medical Faculty Carl Gustav Carus, University of Technology Dresden, Dresden, Germany.

3 http://tgmouse.compmed.ucdavis.edu. Back

Received 12/13/04. Revised 3/28/05. Accepted 4/ 6/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Jope RS, Johnson GV. The glamour and gloom of glycogen synthase kinase-3. Trends Biochem Sci 2004;29:95–102.[CrossRef][Medline]
  2. Wang J, Wynshaw-Boris A. The canonical Wnt pathway in early mammalian embryogenesis and stem cell maintenance/differentiation. Curr Opin Genet Dev 2004;14:533–9.[CrossRef][Medline]
  3. Weaver C, Kimelman D. Move it or lose it: axis specification in Xenopus. Development 2004;131:3491–9.[Abstract/Free Full Text]
  4. Dominguez I, Itoh K, Sokol SY. Role of glycogen synthase kinase 3ß as a negative regulator of dorsoventral axis formation in Xenopus embryos. Proc Natl Acad Sci U S A 1995;92:8498–502.[Abstract/Free Full Text]
  5. He X, Saint-Jeannet JP, Woodgett JR, Varmus HE, Dawid IB. Glycogen synthase kinase-3 and dorsoventral patterning in Xenopus embryos. Nature 1995;374:617–22.[CrossRef][Medline]
  6. Pierce SB, Kimelman D. Regulation of Spemann organizer formation by the intracellular kinase Xgsk-3. Development 1995;121:755–65.[Abstract]
  7. Dale TC. Signal transduction by the Wnt family of ligands. Biochem J 1998;329:209–23.
  8. Song DH, Dominguez I, Mizuno J, Kaut M, Mohr SC, Seldin DC. CK2 phosphorylation of the armadillo repeat region of ß-catenin potentiates Wnt signaling. J Biol Chem 2003;278:24018–25.[Abstract/Free Full Text]
  9. Song DH, Sussman DJ, Seldin DC. Endogenous protein kinase CK2 participates in Wnt signaling in mammary epithelial cells. J Biol Chem 2000;275:23790–7.[Abstract/Free Full Text]
  10. Dominguez I, Mizuno J, Wu H, Song DH, Symes K, Seldin DC. Protein kinase CK2 is required for dorsal axis formation in Xenopus embryos. Dev Biol 2004;274:110–24.[CrossRef][Medline]
  11. Sokol SY. Wnt signaling and dorso-ventral axis specification in vertebrates. Curr Opin Genet Dev 1999;9:405–10.[CrossRef][Medline]
  12. He TC, Sparks AB, Rago C, et al. Identification of c-MYC as a target of the APC pathway. Science 1998;281:1509–12.[Abstract/Free Full Text]
  13. Shtutman M, Zhurinsky J, Simcha I, et al. The cyclin D1 gene is a target of the ß-catenin/LEF-1 pathway. Proc Natl Acad Sci U S A 1999;96:5522–7.[Abstract/Free Full Text]
  14. Tetsu O, McCormick F. ß-Catenin regulates expression of cyclin D1 in colon carcinoma cells. Nature 1999;398:422–6.[CrossRef][Medline]
  15. Veltmaat JM, Van Veelen W, Thiery JP, Bellusci S. Identification of the mammary line in mouse by Wnt10b expression. Dev Dyn 2004;229:349–56.[CrossRef][Medline]
  16. Chu EY, Hens J, Andl T, et al. Canonical WNT signaling promotes mammary placode development and is essential for initiation of mammary gland morphogenesis. Development 2004;131:4819–29.[Abstract/Free Full Text]
  17. van Genderen C, Okamura RM, Farinas I, et al. Development of several organs that require inductive epithelial-mesenchymal interactions is impaired in LEF-1-deficient mice. Genes Dev 1994;8:2691–703.[Abstract/Free Full Text]
  18. Imbert A, Eelkema R, Jordan S, Feiner H, Cowin P. {Delta}N89ß-catenin induces precocious development, differentiation, and neoplasia in mammary gland. J Cell Biol 2001;153:555–68.[Abstract/Free Full Text]
  19. Andl T, Reddy ST, Gaddapara T, Millar SE. WNT signals are required for the initiation of hair follicle development. Dev Cell 2002;2:643–53.[CrossRef][Medline]
  20. Hatsell S, Rowlands T, Hiremath M, Cowin P. ß-Catenin and Tcfs in mammary development and cancer. J Mammary Gland Biol Neoplasia 2003;8:145–58.[CrossRef][Medline]
  21. Dale TC, Weber-Hall SJ, Smith K, et al. Compartment switching of WNT-2 expression in human breast tumors. Cancer Res 1996;56:4320–3.[Abstract/Free Full Text]
  22. Iozzo RV, Eichstetter I, Danielson KG. Aberrant expression of the growth factor Wnt-5A in human malignancy. Cancer Res 1995;55:3495–9.[Abstract/Free Full Text]
  23. Huguet EL, McMahon JA, McMahon AP, Bicknell R, Harris AL. Differential expression of human Wnt genes 2, 3, 4, and 7B in human breast cell lines and normal and disease states of human breast tissue. Cancer Res 1994;54:2615–21.[Abstract/Free Full Text]
  24. Bui TD, Zhang L, Rees MC, Bicknell R, Harris AL. Expression and hormone regulation of Wnt2, 3, 4, 5a, 7a, 7b and 10b in normal human endometrium and endometrial carcinoma. Br J Cancer 1997;75:1131–6.[Medline]
  25. Nagahata T, Shimada T, Harada A, et al. Amplification, up-regulation and over-expression of DVL-1, the human counterpart of the Drosophila disheveled gene, in primary breast cancers. Cancer Sci 2003;94:515–8.[CrossRef][Medline]
  26. Roh MS, Hong SH, Jeong JS, et al. Gene expression profiling of breast cancers with emphasis of ß-catenin regulation. J Korean Med Sci 2004;19:275–82.[Medline]
  27. Lin SY, Xia W, Wang JC, et al. ß-Catenin, a novel prognostic marker for breast cancer: its roles in cyclin D1 expression and cancer progression. Proc Natl Acad Sci U S A 2000;97:4262–6.[Abstract/Free Full Text]
  28. Lim SC, Lee MS. Significance of E-cadherin/ß-catenin complex and cyclin D1 in breast cancer. Oncol Rep 2002;9:915–28.[Medline]
  29. Chung GG, Zerkowski MP, Ocal IT, et al. ß-Catenin and p53 analyses of a breast carcinoma tissue microarray. Cancer 2004;100:2084–92.[CrossRef][Medline]
  30. Tsukamoto AS, Grosschedl R, Guzman RC, Parslow T, Varmus HE. Expression of the int-1 gene in transgenic mice is associated with mammary gland hyperplasia and adenocarcinomas in male and female mice. Cell 1988;55:619–25.[CrossRef][Medline]
  31. Lane TF, Leder P. Wnt-10b directs hypermorphic development and transformation in mammary glands of male and female mice. Oncogene 1997;15:2133–44.[CrossRef][Medline]
  32. Wang TC, Cardiff RD, Zukerberg L, Lees E, Arnold A, Schmidt EV. Mammary hyperplasia and carcinoma in MMTV-cyclin D1 transgenic mice. Nature 1994;369:669–71.[CrossRef][Medline]
  33. Hsu W, Shakya R, Costantini F. Impaired mammary gland and lymphoid development caused by inducible expression of Axin in transgenic mice. J Cell Biol 2001;155:1055–64.[Abstract/Free Full Text]
  34. Landesman-Bollag E, Romieu-Mourez R, Song DH, Sonenshein GE, Cardiff RD, Seldin DC. Protein kinase CK2 in mammary gland tumorigenesis. Oncogene 2001;20:3247–57.[CrossRef][Medline]
  35. Sinn E, Muller W, Pattengale P, Tepler I, Wallace R, Leder P. Coexpression of MMTV/v-Ha-ras and MMTV/c-myc genes in transgenic mice: synergistic action of oncogenes in vivo. Cell 1987;49:465–75.[CrossRef][Medline]
  36. Johnson GG, Kronert WA, Bernstein SI, Chapman VM, Smith KD. Altered turnover of allelic variants of hypoxanthine phosphoribosyltransferase is associated with N-terminal amino acid sequence variation. J Biol Chem 1988;263:9079–82.[Abstract/Free Full Text]
  37. Rosner A, Miyoshi K, Landesman-Bollag E, et al. Pathway pathology: histological differences between ErbB/Ras and Wnt pathway transgenic mammary tumors. Am J Pathol 2002;161:1087–97.[Abstract/Free Full Text]
  38. Wang QM, Park IK, Fiol CJ, Roach PJ, DePaoli-Roach AA. Isoform differences in substrate recognition by glycogen synthase kinases 3{alpha} and 3ß in the phosphorylation of phosphatase inhibitor 2. Biochemistry 1994;33:143–7.[CrossRef][Medline]
  39. Molenaar M, van de Wetering M, Oosterwegel M, et al. XTcf-3 transcription factor mediates ß-catenin-induced axis formation in Xenopus embryos. Cell 1996;86:391–9.[CrossRef][Medline]
  40. Stewart TA, Hollingshead PG, Pitts SL. Multiple regulatory domains in the mouse mammary tumor virus long terminal repeat revealed by analysis of fusion genes in transgenic mice. Mol Cell Biol 1988;8:473–9.[Abstract/Free Full Text]
  41. Mahler JF, Stokes W, Mann PC, Takaoka M, Maronpot RR. Spontaneous lesions in aging FVB/N mice. Toxicol Pathol 1996;24:710–6.[Abstract/Free Full Text]
  42. Pap M, Cooper GM. Role of glycogen synthase kinase-3 in the phosphatidylinositol 3-kinase/Akt cell survival pathway. J Biol Chem 1998;273:19929–32.[Abstract/Free Full Text]
  43. Brown AM, Wildin RS, Prendergast TJ, Varmus HE. A retrovirus vector expressing the putative mammary oncogene int-1 causes partial transformation of a mammary epithelial cell line. Cell 1986;46:1001–9.[CrossRef][Medline]
  44. Yu JY, Taylor J, DeRuiter SL, Vojtek AB, Turner DL. Simultaneous inhibition of GSK3{alpha} and GSK3ß using hairpin siRNA expression vectors. Mol Ther 2003;7:228–36.[CrossRef][Medline]
  45. Bartkova J, Lukas J, Muller H, Lutzhoft D, Strauss M, Bartek J. Cyclin D1 protein expression and function in human breast cancer. Int J Cancer 1994;57:353–61.[Medline]
  46. Gillett C, Fantl V, Smith R, et al. Amplification and overexpression of cyclin D1 in breast cancer detected by immunohistochemical staining. Cancer Res 1994;54:1812–7.[Abstract/Free Full Text]
  47. Fantl V, Smith R, Brookes S, Dickson C, Peters G. Chromosome 11q13 abnormalities in human breast cancer. Cancer Surv 1993;18:77–94.[Medline]
  48. Diehl JA, Cheng M, Roussel MF, Sherr CJ. Glycogen synthase kinase-3ß regulates cyclin D1 proteolysis and subcellular localization. Genes Dev 1998;12:3499–511.[Abstract/Free Full Text]
  49. Brownlees J, Irving NG, Brion JP, et al. Tau phosphorylation in transgenic mice expressing glycogen synthase kinase-3ß transgenes. Neuroreport 1997;8:3251–5.[Medline]
  50. Lucas JJ, Hernandez F, Gomez-Ramos P, Moran MA, Hen R, Avila J. Decreased nuclear ß-catenin, tau hyperphosphorylation and neurodegeneration in GSK-3ß conditional transgenic mice. EMBO J 2001;20:27–39.[CrossRef][Medline]
  51. Pearce NJ, Arch JR, Clapham JC, et al. Development of glucose intolerance in male transgenic mice overexpressing human glycogen synthase kinase-3ß on a muscle-specific promoter. Metabolism 2004;53:1322–30.[CrossRef][Medline]
  52. Antos CL, McKinsey TA, Frey N, et al. Activated glycogen synthase-3ß suppresses cardiac hypertrophy in vivo. Proc Natl Acad Sci U S A 2002;99:907–12.[Abstract/Free Full Text]
  53. Michael A, Haq S, Chen X, et al. Glycogen synthase kinase-3ß regulates growth, calcium homeostasis, and diastolic function in the heart. J Biol Chem 2004;279:21383–93.[Abstract/Free Full Text]
  54. Miyoshi K, Rosner A, Nozawa M, et al. Activation of different Wnt/ß-catenin signaling components in mammary epithelium induces transdifferentiation and the formation of pilar tumors. Oncogene 2002;21:5548–56.[CrossRef][Medline]
  55. Ackler S, Ahmad S, Tobias C, Johnson MD, Glazer RI. Delayed mammary gland involution in MMTV-AKT1 transgenic mice. Oncogene 2002;21:198–206.[CrossRef][Medline]
  56. Schwertfeger KL, Richert MM, Anderson SM. Mammary gland involution is delayed by activated Akt in transgenic mice. Mol Endocrinol 2001;15:867–81.[Abstract/Free Full Text]
  57. Nusse R, van Ooyen A, Cox D, Fung YK, Varmus H. Mode of proviral activation of a putative mammary oncogene (int-1) on mouse chromosome 15. Nature 1984;307:131–6.[CrossRef][Medline]
  58. Su LK, Kinzler KW, Vogelstein B, et al. Multiple intestinal neoplasia caused by a mutation in the murine homolog of the APC gene. Science 1992;256:668–70.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Am. Soc. Nephrol.Home page
Z. Wang, A. Havasi, J. M. Gall, H. Mao, J. H. Schwartz, and S. C. Borkan
{beta}-Catenin Promotes Survival of Renal Epithelial Cells by Inhibiting Bax
J. Am. Soc. Nephrol., September 1, 2009; 20(9): 1919 - 1928.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. K. Thotala, D. E. Hallahan, and E. M. Yazlovitskaya
Inhibition of Glycogen Synthase Kinase 3{beta} Attenuates Neurocognitive Dysfunction Resulting from Cranial Irradiation
Cancer Res., July 15, 2008; 68(14): 5859 - 5868.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C.-L. Lin, J.-Y. Wang, J.-Y. Ko, K. Surendran, Y.-T. Huang, Y.-H. Kuo, and F.-S. Wang
Superoxide Destabilization of {beta}-Catenin Augments Apoptosis of High-Glucose-Stressed Mesangial Cells
Endocrinology, June 1, 2008; 149(6): 2934 - 2942.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
S. R. Hammes and E. R. Levin
Extranuclear Steroid Receptors: Nature and Actions
Endocr. Rev., December 1, 2007; 28(7): 726 - 741.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. Ma, J. Wang, Y. Gao, T.-W. Gao, G. Chen, K. A. Bower, M. Odetallah, M. Ding, Z. Ke, and J. Luo
The Role of Glycogen Synthase Kinase 3{beta} in the Transformation of Epidermal Cells
Cancer Res., August 15, 2007; 67(16): 7756 - 7764.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Kuorelahti, S. Rulli, I. Huhtaniemi, and M. Poutanen
Human Chorionic Gonadotropin (hCG) Up-Regulates wnt5b and wnt7b in the Mammary Gland, and hCG{beta} Transgenic Female Mice Present with Mammary Gland Tumors Exhibiting Characteristics of the Wnt/{beta}-Catenin Pathway Activation
Endocrinology, August 1, 2007; 148(8): 3694 - 3703.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Grade, B. M. Ghadimi, S. Varma, R. Simon, D. Wangsa, L. Barenboim-Stapleton, T. Liersch, H. Becker, T. Ried, and M. J. Difilippantonio
Aneuploidy-Dependent Massive Deregulation of the Cellular Transcriptome and Apparent Divergence of the Wnt/{beta}-catenin Signaling Pathway in Human Rectal Carcinomas
Cancer Res., January 1, 2006; 66(1): 267 - 282.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Farago, M.
Right arrow Articles by Seldin, D. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Farago, M.
Right arrow Articles by Seldin, D. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online