| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology, Pathobiology, and Genetics |
1 Department of Pathology, University of Florida, Jacksonville, Florida; 2 Department of Pathology and 3 Rebecca and John Moores Cancer Center, University of California, San Diego, La Jolla, California; 4 Fred Hutchinson Cancer Research Center, Seattle, Washington; 5 Department of Biostatistics, Harvard School of Public Health, Boston, Massachusetts; and 6 Laboratory of Experimental Carcinogenesis, Center for Cancer Research, National Cancer Institute, Bethesda, Maryland
Requests for reprints: Steve Goodison, Department of Pathology, University of Florida Health Science Center, Shands Hospital, 655 West 8th Street, Jacksonville, FL 32209-6511. Phone: 904-244-4220; Fax: 904-244-4290; E-mail: steve.goodison{at}jax.ufl.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
We have previously identified a number of molecular differences between the two cell lines through molecular cytogenetic evaluation (5) and comparative transcriptional (1, 6, 7) and proteomic analyses (8). To further elucidate the extent of the molecular changes associated with acquisition of the metastatic phenotype, we have now used a genome-wide expression profiling approach. Oligonucleotide microarray technology (Affymetrix U95A GeneChips) was used to create a gene expression database of over 12,000 genes containing profiles of the nonmetastatic NM2C5 and the metastatic M4A4 cells. Our dChip intensity modeling approach was used to compute the gene expression values and confidence interval for the fold change of each gene in the expression profile (9). Hierarchical clustering analysis revealed a subset of 171 genes whose expression was statistically correlated with cellular phenotype. Some genes in this group have previously been implicated in invasion, tumor cell proliferation, and/or metastasis, but many have not. Differentially expressed genes belonged to various functional groups, but GTPase signaling components were one of the most well represented. These factors regulate multiple functions, many of which may impact the ability of a transformed cell to achieve metastatic efficiency. The most differentially expressed of the GTPase signaling components, deleted in liver cancer 1 (DLC-1), was chosen to test the utility of the molecular profiling approach to identify genes involved in metastatic efficiency.
The human DLC-1 gene encodes a 1,091 amino acid protein that is highly homologous to the rat p122-RhoGAP (10, 11). Rho-GTPaseactivating proteins (RhoGAP) are important regulators in the switching between the active GTP-bound state and the inactive GDP-bound state of Rho proteins. RhoGAPs catalyze the conversion of the active GTP-bound Rho proteins to the inactive state, thereby attenuating their signal transduction activities. Thus, RhoGAPs act as negative modulators (12). The Rho proteins are members of the Ras superfamily and are involved in a variety of cellular functions, including the regulation of cell proliferation and actin cytoskeleton organization (13, 14), and have been implicated in oncogenic transformation and cancer progression (15, 16). The study of DLC-1 in cancer has shown that it meets several criteria of a tumor suppressor gene. It is frequently inactivated due to genomic deletion or promoter hypermethylation in transformed cells, and its overexpression can result in the inhibition of in vitro colony formation, cell migration, and the suppression of tumor formation in immunocompromised mice (1719). In the present study, restoration of the DLC-1 gene in M4A4 cells by cDNA transduction proved to inhibit invasion and migration in vitro and to reduce the ability of these cells to form metastases in vivo. Further study of the function of DLC-1 and other candidate genes in this model will aid the elucidation of the molecular networks involved in the acquisition of metastatic sufficiency.
| Materials and Methods |
|---|
|
|
|---|
75% confluence by direct application of RNeasy lysis buffer (Qiagen, Valencia, CA) and homogenized by needle shearing. Frozen xenograft tissues were mechanically homogenized directly in the same chaotropic lysis buffer. After RNeasy kit purification, total RNA was incubated with 0.08 unit/µL of RNase-free DNase (Promega, Madison, WI) for 40 minutes at 37°C. RNA samples were quantitated by spectrophotometry, checked for quality by agarose gel electrophoresis, and stored at 80°C. Xenograft inoculation and recovery. Female athymic mice (BALB/c nu/nu; B&K Universal, Fremont, CA), ages 8 to 10 weeks, were housed in an isolation suite for the duration of the experiments and cared for in accordance with the standards of University of California, San Diego, under an approved protocol of the University of California. The tumorigenicity and spontaneous metastatic capability of the cell lines were determined by orthotopic inoculation into the mammary fat pad of six to nine animals per cell line. One million cells in 0.05 mL of a 1:1 mixture of RPMI 1640 and Matrigel (BD Biosciences, San Jose, CA) were inoculated into the right flank mammary fat pad of an anesthetized mouse. The rate of primary tumor growth was determined by plotting the means of two orthogonal diameters of the tumors, and animals were euthanized and autopsied at 3 to 5 months postinoculation when a primary tumor reached a diameter of 2 cm. Primary xenograft tissues were snap-frozen and stored under liquid nitrogen until used for DNA or RNA extraction, or formalin-fixed for histologic preparations following standard protocols.
Affymetrix GeneChip array analyses. Oligonucleotide microarray experiments were done as previously described (20). Briefly, total RNA was extracted from cell pellets using the RNeasy kit (Qiagen, Chatsworth, CA). Sample biochemistry (reverse transcription, second-strand synthesis, and probe generation) was done according to the Affymetrix Expression Analysis Technical Manual (Affymetrix, Santa Clara, CA). Labeled cRNA (20 µg) was hybridized for 18 hours at 45°C to Affymetrix Human Genome arrays (U95A). The arrays were washed and RNA was fluorescently labeled by incubation in streptavidinR-phycoerythrin conjugate staining buffer at 40°C for 15 minutes, then washed at 22°C. A GeneChip array scanner detected the presence, location, and amount of bound target on the probe array. Raw data were collected using Affymetrix Microarray Suite (MAS 5.0) software. Replicate experiments were done using RNA samples extracted from independent cell line cultures.
Microarray data analysis. The dChip intensity modeling approach was used to compute the gene expression values and confidence interval for the fold change of each gene in the expression profile (9). A paired two-group comparison for each probe set was done, considering both measurement error and variation among individual samples (21). Paired analyses within each batch were necessary because the RNA chips were processed at different times and the possible batch effects were noted. Genes were determined to have altered expression levels in the metastatic versus the nonmetastatic group based on the following criteria: (a) lower bound fold change of two groups >1.3 in either direction in all pairs; (b) the difference between the mean expression levels of two groups >100 in either direction in all pairs. Such criteria were selected to have zero false positives when permuting the group labels. Classification of metastasis-related genes by functional grouping was based on annotation terms of Gene Ontology, protein domain, chromosome location, and pathway information from NetAffx (www.affymetrix.com/index.affx).
Hierarchical clustering. The metastasis-related genes were clustered and ordered by a hierarchical clustering algorithm using a centroid-linkage method (21). Briefly, the expression values for a gene across the eight samples were standardized to have mean 0 and SD 1 by linear transformation, and the distance between two genes was defined as 1 r, where r is the standard correlation coefficient between the eight standardized values of two genes. Two genes with the closest distance were first merged into a supergene and connected by branches with length representing their distance, and were then deleted for future merging. The expression level of the newly formed supergene is the average of standardized expression levels of the two genes (centroid linkage) for each sample. Then, the next pair of genes (supergenes) with the smallest distance were merged, and the process was repeated n times to merge all n genes. The software (dChip 1.3) used to implement model-based expression calculations, two-group comparison, and clustering is available at www.dChip.org.
Evaluation of candidate gene proximity. The list of genes generated by dChip analysis were mapped according to chromosomal location using Genome View (21). Genes on each chromosome were placed on a map proportionally from chromosomal position 0 to the gene with the maximal chromosomal position. Transcription start site was used for relative gene position mapping. P values were calculated for gene stretches
20 selected genes to assess the significance (P < 0.01) of gene proximity (www.dChip.org). Normalized rank distances were reduced to the order statistics of uniform distributions and P values were ascertained. In effect, the tightness of a stretch of n genes against that of n genes randomly put on the chromosome is assessed for significant clustering of genes on a chromosome.
Real-time, quantitative PCR analysis of RNA. DNase-treated RNA was reverse transcribed using Moloney murine leukemia virus reverse transcriptase with a combination of oligo (dT) and random primers (Ambion, Austin, TX). The resulting cDNA was used as a template for quantitative PCR (qPCR) using gene-specific primers. Real-time, quantitative PCR was done on an Applied Biosystem PRISM 7700 Sequence Detection System using SYBR Green I chemistry (PE Applied Biosystems, Foster City, CA) as described previously (22, 23). Briefly, PCR was done using the SYBR Green PCR Master Mix kit containing SYBR green I dye, AmpliTaq Gold DNA Polymerase, deoxynucleotide triphosphates with dUTP, passive reference, and optimized buffer components (PE Applied Biosystems). PCR primers were designed against the 3' untranslated region of the human target genes using MacVector software (Oxford Molecular, Beaverton, OR) and designed to avoid potential binding to mouse homologue sequences. Fifty nanograms of cDNA template were added to a reaction volume of 25 µL and all primers were used at a final concentration of 100 nmol/L. No-template controls were included for each target. Thermocycling was initiated with a 10-minute, 95°C enzyme activation step followed by 40 cycles of 95°C for 15 seconds, 60°C for 1 minute, and 72°C for 1 minute. All reactions were done in triplicate, and each reaction was gel-verified to contain a single product of the correct size. Data analysis was done using the relative standard curve method as outlined by the manufacturer (PE Applied Biosystems) and as described previously (23). The mean glyceraldehyde-3-phosphate dehydrogenase (GAPDH) concentration (primer set supplied by PE Applied Biosystems) was determined for each cDNA sample and used to normalize expression of other genes tested in the same sample. The relative difference in expression was recorded as the ratio of normalized target concentrations for the same cDNA dilution. Gene-specific primer sequences are available on request.
Generation of M4A4-DLC1 cell lines. Full-length human DLC-1 cDNA was subcloned into the pLNCX expression vector (18) and used to transduce M4A4 cells as previously described (6). G418-resistant clones were propagated and screened for DLC-1 expression. Real-time qPCR using cDNA from the M4A4-DLC1 clones and primers DLC1 2845-5' CGAGGAAATGAGCCGATGTCG and DLC1 3542-3' TGTTCTGGTTACTGAAGGAATCCCG was applied to evaluate the transcript levels of DLC-1 in the monoclonal lines relative to GAPDH mRNA expression. M4A4-neo control cells were generated by transduction with the retroviral vector pLNCX alone (Clontech, Palo Alto, CA).
In vitro invasion and migration assays. Rates of migration and invasion of cells were evaluated using the modified Boyden chamber assay as previously described (6). Briefly, cells were plated in triplicate at 5 x 105/3 cells per well in serum-free medium on 8 µm pore polycarbonate membranes of transwell chambers precoated with Matrigel (BD Biosciences). Control inserts (migration only) contained no Matrigel coating. The lower chambers of the transwells contained RPMI 1640 with 10% fetal bovine serum as chemoattractant. Cells were incubated for 72 hours at 37°C in a 5% CO2 atmosphere. The total number of cells in the upper and lower compartments of the transwell chambers was determined after detachment by trypsin treatment using a hemocytometer. The number of cells that had migrated/invaded through the membranes was adjusted for cell growth. Comparisons between group means were assessed using a one-way ANOVA with the Newman-Keuls posttest (GraphPad Software, Inc., San Diego, CA). Values were expressed as the mean ± SE. P < 0.05 were considered significant.
Quantitative detection of human Alu sequences in mice lungs. The detection of human tumor cells present in the lungs of experimental mice was achieved by the quantitative detection of human Alu sequences present in total lung genomic DNA preparations. Our approach was based on the method used by Schneider et al. (24). Whole lungs from untreated control mice and from mice inoculated with M4A4-neo and M4A4-DLC1 cells were dissected at autopsy and homogenized in PBS. Genomic DNA was isolated with the DNeasy Tissue kit (Qiagen, Valencia, CA). Human Alu sequences were PCR-amplified on an ABI Prism 7700 sequence detection system (PE Applied Biosystems) in a 25 µL reaction mixture using 12 µL of 2x SYBR Green PCR master mix, 500 nmol/L of Alu sequence primers, and 60 ng of template DNA. The primer sequences used were as follows: Alu sense, 5'-CACCTGTAATCCCAGCACTTT-3'; Alu antisense, 5'-CCCAGGCTGGAGTGCAGT-3'. These primers are complementary to the longer right monomer of the Alu repeat consensus sequences (25, 26). PCR reaction conditions were as follows: 95°C for 10 minutes followed by 40 cycles of 95°C for 30 seconds; 65°C for 5 seconds and 72°C for 10 seconds. All reactions were done in triplicate and each assay included control murine lung DNA and a no-template control. A dissociation curve analysis was done for each reaction. Quantification of human DNA in murine tissue was based on a standard curve prepared with serial dilutions (0.5 pg-2 ng) of human genomic DNA (Promega) mixed with 60 ng of mouse DNA (extracted from untreated athymic mice lung tissue) in a 25 µL reaction. To approximate the actual number of tumor cells present in each tissue sample, the amount of human genomic DNA per cell (
7.5 pg) was calculated via a standard curve constructed after measuring the amount of DNA extracted from serial dilutions of 2.5 x 106 to 104 cells. This is in agreement with the calculation of the size of the human genome (3.3 x 109 bp/haploid nucleus) which is
7.2 pg/cell. The amount of mouse DNA per cell can then be estimated by the mouse genome (2.7 x 109 bp/haploid nucleus) to be
5.9 pg/cell. Sixty nanograms of mouse DNA would then be
10,000 cells. Data processing and statistical analysis were done using Microsoft Excel (Microsoft Corporation, Redmond, WA) and GraphPad Prism (GraphPad Software). Comparative statistical significance was calculated a one-way ANOVA with the Newman-Keuls posttest (GraphPad Software).
| Results |
|---|
|
|
|---|
12,600 genes. Hybridization signal intensities derived from >200,000 measurements per chip were normalized using algorithms in which individual sample expression is compared with the mean of all samples. The dChip model-based approach was used to compute the gene expression values and confidence interval for the fold change of each gene in the profiled cell lines samples (9). Classification of genes having altered expression levels in the metastatic M4A4 cell line relative to nonmetastatic NM2C5 cells was based on a number of criteria, including (a) a lower bound fold change of the mean expression of the two groups >1.3 in either direction and (b) the difference between the mean expression levels of two groups was >100 in either direction (see Microarray data analysis in Materials and Methods). An initial subset of genes that maximally varied between experimental groups was selected for hierarchical clustering and grouping by biological function. Using a centroid-linkage hierarchical clustering algorithm, genes were ordered and visualized in a heatmap diagram in which the pattern and length of the branches reflect the relatedness of the samples (see Supplemental Data for raw data and figures at http://biowww.dfci.harvard.edu/
rskim/goodison/?). A total of 171 genes were identified as either significantly up-regulated or down-regulated with respect to the metastatic phenotype. In line with our previous studies of this metastasis model (1, 6, 8), genes identified as down-regulated (112 genes) in the metastatic cell line were considerably more numerous than those that were elevated (59 genes). The identities of all 171 genes are available in the Supplemental Data, but the 85 most highly ranked differentially expressed genes (>2-fold change) are listed in Table 1. Among the top-ranked genes were some that we had previously identified using alternative molecular screening approaches, including osteopontin and tyrosinase-related protein 1 (1, 6, 8). The differentially expressed genes were then clustered into groups according to biological function. Analysis revealed a decreased expression of genes belonging to the classes of GTPases (deleted in liver cancer 1, Rac/Cdc42 guanine nucleotide exchange factor 6, G protein
11, Rho-related gene 3), and the epidermal growth factorlike domain genes (fibronectin, integrins, thrombospondin 1) in metastatic M4A4 cells. A high number of transcription factor genes also had increased expression in M4A4 cells, including v-maf, MAX interactor 1, aryl-hydrocarbon receptor nuclear translocator 2 and the cAMP responsive element modulator.
|
Array data validation. The aim of the expression profiling done in this study was to identify genes that play a potential role in the induction or inhibition of the metastatic phenotype and that warrant functional in vivo investigation. Whereas there are advantages to comparing the profiles of "pure" human cell line populations, we have previously observed considerable differences in specific gene expression between cells grown in culture and those growing in primary tumors in the murine host (7). This is entirely expected because of the influence the microenvironment has on tumor cell gene expression patterns. Therefore, we needed to validate that the differential expression of the genes of interest to us was retained in the cells comprising the in vivo primary tumor mass. The drawback of analyzing xenograft material is the prevalence of murine signal cross-hybridization or amplification, but this can be avoided by qPCR analysis using primers that are specific to human mRNA sequences. We selected 10 genes of interest and analyzed expression levels in triplicate RNA samples extracted from cultured cells and from xenograft material. Of the genes selected from the microarray data, all were validated as being differentially expressed in the cultured cell line RNA samples (Table 2). The high validation rate is likely due to the use of replicate array data and the use of evolving bioinformatics programs, such as dChip, that rank differentially expressed genes using P values rather than fold change (20, 21). Due to the more selective and specific analysis of a single gene when using qPCR, the level of differential expression was expectedly higher than estimated by microarray analysis in most cases (Table 2). Measurements of in vivo expression levels were more in line with microarray data. Of the 10 genes tested, the observed in vitro difference of one gene (RAB27A) was not maintained in vivo (Table 2).
|
To evaluate a possible functional role for DLC-1 in the phenotype of the MDA-MB-435 metastasis model, M4A4 cells were transduced with the full-length human DLC-1 cDNA to increase its expression. Single-cell clones of stably transduced cells were selected and propagated, and analyzed individually for the expression level of DLC-1 using quantitative PCR. Microarray and quantitative PCR analyses revealed that NM2C5 cells express DLC-1 transcripts at levels
3-fold greater than M4A4 cells (Tables 1 and 2). To make a fair comparison of subsequent phenotype, we deliberately intended to select a clonal M4A4-DLC1 cell line that had DLC-1 expression levels equivalent to nonmetastatic NM2C5 cells. However, it is interesting to note that among 11 M4A4-DLC1 clonal cell lines tested, we could not find any that had DLC-1 expressed at >3.4-fold the level of M4A4 cells and, therefore, never significantly greater than that observed in NM2C5 cells. No significant difference in DLC-1 levels between M4A4 and M4A4-neo cells was observed nor were any clear differences in cellular morphology between the M4A4-DLC1 clones and the unmanipulated, or vector-only transduced M4A4 populations evident. Although the in vitro proliferation rate of the M4A4-DLC1 clone was reduced relative to parental M4A4 and vector-only transduced M4A4-neo cells, the growth rate remained higher than the NM2C5 cell population (data not shown).
Tumorigenicity and metastatic propensity of M4A4-DLC1 cells. To assess the effects of DLC-1 on phenotype in vivo, we injected equivalent numbers of NM2C5, M4A4, M4A4-DLC1, and M4A4-neo cells into the mammary fat pad of BALB/c athymic nude mice. All cell lines tested were tumorigenic in all cases and formed palpable tumors within 2 weeks. The M4A4-DLC1 primary tumor growth rate was not significantly different from the other M4A4-inoculated groups. As previously described, we evaluated metastatic capability under equivalent primary tumor loads by sacrifice at an end-point dependant on primary tumor size rather than a defined postinoculation period (1).
The accurate measurement of metastatic efficiency in mouse models is problematic. In the majority of previously reported studies, macroscopically detectable surface lesions have been used as a measure of the degree of metastasis. For monitoring potentially subtle changes in metastatic burden, such measurements are insufficient because surface examination does not take into consideration intraorgan metastasis, they assume equal distribution of tumor cells within an organ, and they do not enable the detection of small tumor cell populations. Additionally, the manipulation of the test cell line may change the metastatic pattern as well as the overall metastatic efficiency so surface evaluation alone may miss important changes. Classic histologic evaluation of host organs provides an improved, albeit nonquantitative estimation, but for practical reasons such analyses are most often done in only a few sections of the relevant organs. More comprehensive and more quantitative methods of analysis are essential for the accurate evaluation of metastasis in experimental models. In this study, we utilized the ability to detect human specific Alu DNA sequences in a nonhuman genetic background. Procedures used to detect Alu sequences have improved with evolving technological advances (27, 28); moreover, with the advent of accessible quantitative PCR methodology, the detection of Alu sequences now offers the most accurate analysis of metastasis in secondary organs (24, 29).
Quantification of human DNA in murine tissue was based on a standard curve prepared with serial dilutions of human genomic DNA (0.5 pg-2 ng) mixed with 60 ng of mouse genomic DNA. The detection limit of the assay was 2 pg of human DNA in a 20 µL reaction (100 pg/mL), which equates to 0.27 cell equivalents, or 27 human cells in a background of 1 x 106 mouse cells (see Materials and Methods). Monitoring the amplification of a 4-fold serial dilution of human DNA, curves shifted to increasingly higher cycle numbers as template copy numbers decreased (Fig. 1A). An excellent relationship (r2 = 0.996) between the Alu signal and the amount of human DNA present in the reaction was evident (Fig. 1B). The presence of a single amplification product was confirmed by melting curve analysis (Fig. 1C) and the specificity of the product was proven by the absence of a PCR product when using only murine DNA as template (data not shown). Thus, this rapid assay was sensitive, reliable, and specific for human Alu sequences.
|
25% of M4A4. Qualitative histologic examination of additional host mice showed that M4A4-DLC1 cells were still capable of forming metastases and that the actual metastases formed by M4A4-DLC1 cells were similar in structure to those formed by M4A4 cells (Fig. 3), but were generally smaller and less abundant. Alu-PCR analysis also detected a low steady-state level of NM2C5 cells in host lung tissue extracts. This was expected as we have previously shown that NM2C5 cells can reach the host lung and remain dormant in this secondary organ for up to 6 months (2).
|
|
4-fold relative to M4A4 cells (P = 0.0006) and to M4A4-neo cells (P = 0.0175; Fig. 4B). However, the migratory activity of M4A4-DLC1 cells was also perturbed; M4A4-DLC1 cells were significantly (P < 0.001) less motile than the M4A4, M4A4-neo, or NM2C5 cell lines (Fig. 4A).
|
| Discussion |
|---|
|
|
|---|
This study shows that the metastatic phenotype of the M4A4 cell line is accompanied by profound changes in gene expression. According to the microarray hybridization data, those genes identified as being significantly differentially expressed in M4A4 cells represent
2.5% of all genes expressed. Functional assignment based on literature review revealed that many of the differentially expressed genes belong to gene families or pathways previously implicated in tumor progression and metastasis (39, 40). Included were cell cycle regulators and DNA-binding factors that may drive or facilitate cell proliferation; specific and generic transcriptional regulators; and proteins that play a role in signal transduction, cell structure, and motility. GTPase signaling component genes, which regulate proliferation and cytoskeletal organization in response to extracellular factors (41), were well represented in the most highly ranked differentially expressed genes. Because GTPase signaling pathways have been implicated in tumor growth and progression, we chose to genetically manipulate a differentially expressed RhoGAP gene, DLC-1, in the model.
We aimed to derive M4A4 transductants that had DLC-1 restored to levels similar to those observed in the nonmetastatic NM2C5 clone. This is an important consideration when comparing related studies (42) where levels of ectopic expression are often considerably higher than those expected in physiologic conditions. Interestingly, of the surviving antibiotic-selected, transduced M4A4 monoclonal lines, none had a significantly higher level of DLC-1 than that found in NM2C5 cells. In line with reports of a tumor cell inhibitory function (1719), this suggests that there is a threshold at which DLC-1 expression levels completely inhibit the growth of MDA-MB-435 cells. As we wanted to test the metastatic capability of M4A4 transductants in a spontaneous metastasis assay, we selected only those that grew robustly in culture and were therefore less likely to compromise primary tumor growth. The restoration of DLC-1 significantly reduced the ability of M4A4 cells to colonize murine lungs in spontaneous metastasis assays, but did not alter tumorigenic ability at the primary site. Thus, DLC-1 can function as a metastasis-suppressor gene. Of several metastasis-suppressor genes identified to date, the majority affect the final outgrowth of tumor cells after they have arrived at a distant site, and all affect important signaling cascades (43, 44).
The influence of DLC-1 in M4A4 cells is consistent with previous observations in breast cancer. DLC-1 is often down-regulated or inactivated in breast primary tumors and breast tumor cell lines, and the restoration of its expression has been shown to significantly inhibit growth and tumorigenicity of cells derived from metastatic breast cancer (18, 45). Furthermore, DLC-1 has recently been confirmed as a highly significant breast cancer susceptibility gene in a large-scale human genomic screening (46). In a clonal model of experimental organ-specific metastasis, DLC-1 was found to be down-regulated in breast cell populations that were highly metastatic to bone (47). Moreover, DLC-2, a recently described isoform of DLC-1, is located on chromosome 13q12, a region of recurrent deletion and loss of heterozygosity in breast tumors, and this gene is also capable of inhibiting the proliferation of breast tumor cells in vitro (48, 49). However, this is the first time that DLC-1 has been shown to have an effect specifically on the growth of secondary, metastatic tumors.
Tumor cell growth at a metastatic site differs from that in the primary location through altered responsiveness to a new local microenvironment and stresses (37, 38). Thus, DLC-1 may play a role in sensing inhibitory signals present in the secondary organ that are not a factor in the primary site. A DLC-1mediated negative regulatory effect on tumor cell proliferation is likely due to its ability to inactivate Rho-GTPase proteins that regulate many cellular functions in response to extracellular factors (41). DLC-1 has specific GTPase-activating protein functions for RhoA and Cdc42 (50), members of the Rho family that are consistently overexpressed in breast tumors (51). Evidence for the influence of GTPase signaling in tumor metastasis is growing. The expression of the RhoC molecule was identified as being correlated with metastatic propensity in an increasingly metastatic series of the melanoma A375 cell line derived by reculturing of metastatic deposits (42). Subsequent 20-fold overexpression of RhoC increased the metastatic efficiency of recipient cells in an experimental metastasis assay. Any perturbation of the regulatory cycle of GTPase activity regulation will have profound effects on cellular behavior. Seraj et al. (52) showed that there is an inverse relationship between the aggressiveness of bladder cancer cells and RhoGDI2 expression levels. RhoGDI2 is a Rho GTPase regulatory protein that binds and holds GDP bound Rho proteins in an inactive nonmembrane localized, cytoplasmic compartment. Hence, the inferred effect of decreased expression of a Rho GDI would be to provide increased access of Rho GEFs to the Rho GTPases and thus membrane localization, GTP loading, and activation (52), allowing the cells to become more invasive and/or metastatic. Furthermore, several guanine nucleotide exchange factors (GEF) have been identified as oncogenes because of their ability to up-regulate Rho GTPase activity during malignant transformation (15). Overexpression of the GEF Tiam1 (T-lymphoma invasion and metastasis 1) protein in SP-1 mouse breast adenocarcinoma cells induces Tiam1-ankyrin association in the cell membrane, Rac1 signaling, and metastatic phenotypes (53).
Our data indicate that DLC-1 has the capacity to function as a metastasis-suppressor gene. Further investigation of the pathways through which DLC-1 regulates signaling and subsequent phenotypic effects is required to identify subsets of genes that comprise the link between the sensing of the tissue microenvironment and proliferative regulation. The identification of the genes and biological pathways that contribute to metastatic efficiency will be of significant benefit for tumor classification and therapy.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| Footnotes |
|---|
7 B. Nicholson, S. Goodison, and V. Urquidi, unpublished data. ![]()
Received 8/23/04. Revised 4/12/05. Accepted 5/ 5/05.
| References |
|---|
|
|
|---|
stimulating activities. EMBO J 1995;14:28691.[Medline]
This article has been cited by other articles:
![]() |
J.-Z. Pang, L.-X. Qin, N. Ren, Z.-Y. Hei, Q.-H. Ye, W.-D. Jia, B.-S. Sun, G.-L. Lin, D.-Y. Liu, Y.-K. Liu, et al. Loss of Heterozygosity at D8S298 Is a Predictor for Long-term Survival of Patients with Tumor-Node-Metastasis Stage I of Hepatocellular Carcinoma Clin. Cancer Res., December 15, 2007; 13(24): 7363 - 7369. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Shutes, C. Onesto, V. Picard, B. Leblond, F. Schweighoffer, and C. J. Der Specificity and Mechanism of Action of EHT 1864, a Novel Small Molecule Inhibitor of Rac Family Small GTPases J. Biol. Chem., December 7, 2007; 282(49): 35666 - 35678. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Qian, G. Li, H. K. Asmussen, L. Asnaghi, W. C. Vass, R. Braverman, K. M. Yamada, N. C. Popescu, A. G. Papageorge, and D. R. Lowy Oncogenic inhibition by a deleted in liver cancer gene requires cooperation between tensin binding and Rho-specific GTPase-activating protein activities PNAS, May 22, 2007; 104(21): 9012 - 9017. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-C. Liao, L. Si, R. W. deVere White, and S. H. Lo The phosphotyrosine-independent interaction of DLC-1 and the SH2 domain of cten regulates focal adhesion localization and growth suppression activity of DLC-1 J. Cell Biol., January 1, 2007; 176(1): 43 - 49. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Sun, S. Goodison, J. Li, L. Liu, and W. Farmerie Improved breast cancer prognosis through the combination of clinical and genetic markers Bioinformatics, January 1, 2007; 23(1): 30 - 37. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. P. Yam, F. C. F. Ko, C.-Y. Chan, D.-Y. Jin, and I. O.-L. Ng Interaction of Deleted in Liver Cancer 1 with Tensin2 in Caveolae and Implications in Tumor Suppression. Cancer Res., September 1, 2006; 66(17): 8367 - 8372. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Guan, X. Zhou, N. Soulitzis, D. A. Spandidos, and N. C. Popescu Aberrant Methylation and Deacetylation of Deleted in Liver Cancer-1 Gene in Prostate Cancer: Potential Clinical Applications Clin. Cancer Res., March 1, 2006; 12(5): 1412 - 1419. [Abstract] [Full Text] [PDF] |
||||
| |||||||