Cancer Research The Future of Cancer Research: Science and Patient Impact  09 AM Call for Abstracts
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Krysan, K.
Right arrow Articles by Dubinett, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Krysan, K.
Right arrow Articles by Dubinett, S. M.
[Cancer Research 65, 6275-6281, July 15, 2005]
© 2005 American Association for Cancer Research


Cell and Tumor Biology

Prostaglandin E2 Activates Mitogen-Activated Protein Kinase/Erk Pathway Signaling and Cell Proliferation in Non–Small Cell Lung Cancer Cells in an Epidermal Growth Factor Receptor–Independent Manner

Kostyantyn Krysan1, Karen L. Reckamp1,3, Harnisha Dalwadi1, Sherven Sharma3, Enrique Rozengurt2, Mariam Dohadwala1 and Steven M. Dubinett1,3

1 UCLA Lung Cancer Research Program of the Jonsson Comprehensive Cancer Center, 2 UCLA-CURE Digestive Diseases Research Center and Molecular Biology Institute, David Geffen School of Medicine at UCLA; and 3 Veterans Affairs Greater Los Angeles Healthcare System, Los Angeles, California

Requests for reprints: Steven M. Dubinett, UCLA Lung Cancer Research Program of the Jonsson Comprehensive Cancer Center, David Geffen School of Medicine at UCLA, 37-131 CHS, 10833 Le Conte Avenue, Los Angeles, CA 90095-1690. Phone: 310-794-6566; Fax: 310-267-2829; E-mail: sdubinett{at}mednet.ucla.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cyclooxygenase 2 (COX-2) overexpression is found in a wide variety of human cancers and is linked to all stages of tumorigenesis. Elevated tumor COX-2 expression is associated with increased angiogenesis, tumor invasion, suppression of host immunity and promotes tumor cell resistance to apoptosis. Previous reports have linked the COX-2 product prostaglandin E2 (PGE2) to the abnormal activation of the mitogen-activated protein kinase/Erk kinase pathway. Here we show that PGE2 is able to rapidly stimulate Erk phosphorylation in a subset of non–small cell lung cancer (NSCLC) cell lines. This effect is not evident in bronchial epithelial cells. In contrast to previous reports in colon cancer, we found that Erk activation as well as cellular proliferation induced by PGE2 was not inhibited by pretreatment of the cells with epidermal growth factor receptor (EGFR) inhibitors. Activation of the Erk pathway by PGE2 was also resistant to src kinase inhibitors but sensitive to the protein kinase C inhibition. PGE2 effects are mediated through four G protein–coupled receptors. Selective inhibition of EP receptors revealed the possible involvement of Ca2+-dependent signaling in PGE2-mediated activation of Erk. Our data indicate the presence of an EGFR-independent activation of the mitogen-activated protein kinase/Erk pathway by PGE2 in NSCLC cells. These findings provide evidence for the possible link between tumor COX-2 overexpression and elevated Erk-mediated cancer cell proliferation and migration. Importantly, these findings suggest that COX-2 overexpression may contribute to EGFR inhibitor resistance in NSCLC.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cyclooxygenases (COX) are the rate-limiting enzymes in prostanoid synthesis, which convert arachidonic acid into prostaglandin H2, a substrate for specific prostaglandin synthases (1). Two isoforms of COX have been isolated and characterized—the ubiquitously expressed COX-1 and inducible COX-2 (2, 3).

Studies of human cancers have revealed frequent overexpression of COX-2 in a variety of different malignancies. High-level constitutive COX-2 expression has been detected in colorectal (4, 5), prostate (6), lung (79), breast (8, 10), and other cancers. Overexpression of COX-2 can stimulate epithelial cell growth and invasion (11, 12) and promote cellular survival (13, 14). Nonsteroidal antiinflammatory drugs as well as specific COX-2 inhibitors promote cancer cell apoptosis and are therefore being evaluated for cancer chemoprevention and therapy (15).

Prostaglandins serve as autocrine and paracrine mediators and are involved in a variety of biological processes. A COX-2 metabolite abundantly present in the lung cancer microenvironment, prostaglandin E2 (PGE2) is an important mediator of immunoregulation and epithelial survival. PGE2 exerts its multiple effects through four G protein–coupled receptors (GPCR; ref. 3). It has been shown previously that GPCRs are able to trans-activate the epidermal growth factor receptor (EGFR) pathway leading to the promotion of cancer cell growth and motility (16, 17).

In the present study, we investigated the mechanisms of PGE2-mediated mitogen-activated protein kinase (MAPK)/Erk activation in non–small cell lung cancer (NSCLC) cells. We report that PGE2 treatment rapidly induces Erk phosphorylation in a subset of NSCLC cell lines and that this induction is resistant to EGFR inhibitors. In this subset of NSCLC cell lines, we found that PGE2 treatment stimulated cell proliferation that was resistant to EGFR inhibitors. Our analysis of the possible cross-talk mechanisms between the GPCR and MAPK/Erk signal transduction pathways suggests the involvement of protein kinase C (PKC)-dependent signaling.

This is the first documentation of PGE2-mediated EGFR-independent activation of the MAPK/Erk pathway. These findings suggest that COX-2 overexpression may be an important contributor to EGFR inhibitor resistance in NSCLC. Our results provide a strong rationale for the pharmacologic inhibition of PGE2 synthesis in combination with EGFR inhibitors in NSCLC therapy.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents. 16,16-Dimethyl-PGE2 was purchased from Cayman Chemicals (Ann Arbor, MI). EGFR inhibitor Erlotinib (Tarceva; working concentration 2 µmol/L) was generously provided by OSI Pharmaceuticals (Farmingdale, NY). EGF, EGFR inhibitor PD153035 also known as AG 1517 (working concentration 1 µmol/L), PKC inhibitor Ro-31-8425 (1 µmol/L), protein kinase A (PKA) inhibitor KT5720 (10 µmol/L), MAP/ERK kinase inhibitor U0126 (10 µmol/L), src inhibitors PP2 (1 µmol/L) and SU6656 (2 µmol/L), EP1/2 receptor antagonist AH6809 (50 µmol/L), cyclic AMP (cAMP)-specific phosphodiesterase inhibitors Rolipram (10 µmol/L) and IBMX (0.5 mmol/L), adenylate cyclase activators Forskolin (20 µmol/L) and cholera toxin (2.5 µg/mL) and Gi protein inhibitor pertussis toxin (50 ng/mL) were purchased from Calbiochem (San Diego, CA). Other reagents were purchased from Sigma Chemicals (St. Louis, MO) unless otherwise specified.

Cell culture. Human squamous cell carcinoma NSCLC cell lines H157 (National Cancer Institute, Bethesda, MD), RH2 (previously established in our laboratory; ref. 18), and adenocarcinoma cell line H460 (American Type Culture Collection, Rockville, MD), were grown in RPMI supplemented with 10% fetal bovine serum (Gemini Biological Products, Calabasas, CA). NCI-H292, NCI-H1975, NCI-H226, NCI-H2122, NCI-H1703, H125, H358, SKLU-1, NCI-H1437, NCI-H441, NCI-H520, A427, NCI-H647, NCI-H522, NCI-H1650, NCI-H1299, SW 900, NCI-H661, NCI-H1975, and Calu-3 NSCLC cell lines were purchased from the American Type Culture Collection. H3255 cells were a generous gift from Bruce E. Johnson (Dana-Farber Cancer Institute, Boston, MA). For the experiments, cells were plated at 3.5 x 105 cells per well in six-well plates, incubated overnight in RPMI + 10% fetal bovine serum, serum-starved for 2 hours, and treated as indicated in a fresh serum-free medium. To study the effect of PGE2 on Erk activation, cells were treated with PGE2 (10 µg/mL) for 10 minutes with or without inhibitors and for the time course of PGE2 effects—for 5, 15, 30, 60 and 120 minutes. As a control of EGF pathway activation, cells were treated with EGF (50 ng/mL) alone or with EGFR tyrosine kinase inhibitors PD153035 (1 µmol/L) or Erlotinib (2 µmol/L). For inhibitor studies, cells were pretreated with the respective inhibitors at the working concentrations indicated above for 1 hour in serum-free medium prior to PGE2 addition.

Western blotting. Cells were washed with PBS and lysed with modified radioimmunoprecipitation assay buffer. Protein concentrations were measured using the bicinchoninic acid protein assay kit (Pierce, Rockford, IL). Western blotting was done as previously described (14). Briefly, proteins were separated in SDS-PAGE and transferred to the nitrocellulose membrane (Amersham Biosciences, Piscataway, NJ). Membranes were blocked in 5% Blotto (Santa Cruz Biotechnology, Santa Cruz, CA) in TBS + 0.1% Tween 20 and incubated with anti-phospho-Erk 1, 2 (p-Erk) mouse monoclonal antibodies (Cell Signaling, Beverly, MA) or anti-actin rabbit polyclonal antibodies (Sigma) diluted 1:1,000 or 1:5,000, respectively, in blocking solution. The membranes were then treated with horseradish peroxidase-conjugated secondary antibodies (Santa Cruz Biotechnology, 1:10,000) and developed using the SuperSignal West Pico kit (Pierce).

RT-PCR for EP receptors. RNA was isolated from NSCLC cell lines using the RNAEasy kit (Qiagen, Valencia, CA) and reverse-transcribed using the SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA). PCR was done using the Taq polymerase from New England Biolabs (Beverly, MA). The following primer pairs (F—forward, R—reverse primers 5'-3', amplicon sizes are in parentheses) were used for EP receptor and ß-actin amplification: EP1F GGTATCATGGTGGTGTCGTG, EP1R GGCCTCTGGTTGTGCTTAGA (324 bp); EP2F GCCACGATGCTCATGCTCTTCGCC, EP2R CTTGTGTTCTTAATGAAATCCGAC (655 bp); EP3F CGTGTCGCGCAGCTACCGGCG, EP3R CGGGCCACTGGACGGTGTACT (398 bp); EP4F GGGCTGGCTGTCACCGACCTG, EP4R GGTGCGGCGCATGAACTGGCG (485 bp); ß-actinF CCATCGAGCACGGCATCGTC, ß-actinR TCCAGACGCAGGATGGCATG (363 bp). PCR conditions were 3 minutes at 95°C followed by 35 cycles (25 for ß-actin): 1 minute at 95°C, 1 minute at 58°C, and 1 minute at 72°C.

Cell proliferation assay. Proliferation of NSCLC cells was studied using 3H-thymidine incorporation assay, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay (Promega Corp., Madison, WI) and colorimetric bromodeoxyuridine (BrdUrd) incorporation ELISA (Roche, Indianapolis, IN). Cells were plated in 96-well plates at 2 x 103 (H157 and H460) or 1.5 x 103 (RH2) cells per well in 96-well plates, incubated overnight in RPMI + 10% fetal bovine serum and treated with PGE2 (10 µg/mL) in fresh RPMI + 1% fetal bovine serum for 24, 48, or 72 hours. Where applicable, one of the EGFR inhibitors (1 µmol/L PD153035 or 2 µmol/L Erlotinib), specific COX-2 inhibitor sc58236 (5 µmol/L) or a combination of both were added to the cells. For PGE2 and EGFR inhibitors, combined treatment cells were pretreated with PD153035 or Erlotinib for 1 hour prior to PGE2 addition. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assays and BrdUrd incorporation ELISA were done as recommended by the manufacturers. For 3H-thymidine incorporation assay, 3H-thymidine (Amersham Biosciences) was added at 1 µCi/mL for 4 hours on the last day of PGE2 treatment. After the medium was removed, cells were washed twice with cold PBS, treated with 5% trichloroacetic acid for 30 minutes at 5°C, solubilized with 0.5 N NaOH and assayed on ß scintillation counter for incorporation of 3H.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Prostaglandin E2 cross-activates the mitogen-activated protein kinase/Erk signal transduction pathway. To determine the effect of PGE2 on Erk activation, we screened a panel of 24 NSCLC cell lines. To exclude the input of EGFR signaling on Erk phosphorylation, cells were serum-deprived for 2 hours. After 2 hours of serum starvation, the phosphorylation of Erk in most NSCLC cell lines was virtually undetectable. Stimulation with PGE2 (10 µg/mL) strongly induced Erk phosphorylation in a time-dependent manner in a subset of NSCLC cells. In dose titration experiments, we observed similar phosphorylation of Erk in response to PGE2 concentration as low as 0.1 µg/mL (data not shown). We selected three cell lines with a strong Erk phosphorylation response (H157, H460, and RH2) and used them for further studies. Hereafter, these cell lines are referred to as "PGE2-responsive." Mutational analysis of EGFR tyrosine kinase domains (exons 18-21) of these cell lines revealed no mutations. In six other NSCLC cell lines, Erk was phosphorylated to a lesser extent in response to PGE2 treatment (data not shown). The panel of cell lines that were analyzed for PGE2 response, included three cell lines that have mutated EGFR tyrosine kinase domains-H3255 and H1975 (both – 2573T -> G substitution in exon 21) and H1650 (15 bp in-frame deletion in exon 19). We observed no Erk phosphorylation following PGE2 treatment in H3255 and H1650, and moderate phosphorylation in H1975 (data not shown).

Notable increase of phospho-Erk in PGE2-responsive cells was detected 5 minutes following PGE2 treatment, reached its maximum at ~15 minutes and returned to the basal level at ~30 minutes after the treatment (Fig. 1). Whereas this effect was observed in the PGE2-responsive subset of NSCLC cells (8 out of 23), it was not evident in BEAS-2B bronchial epithelial cells (Fig. 2). Both EGF- and PGE2-driven Erk phosphorylation was completely abolished by the MAP/ERK kinase inhibitor U0126 (data not shown). The time-dependent pattern of Erk phosphorylation by PGE2 was similar to that seen following EGF exposure (50 ng/mL; data not shown), suggesting that PGE2 cross-activates the MAPK/Erk signal transduction cascade rather than modulating the activity of the Erk negative regulator, MAPK phosphatase or stimulating the proteolytic release of EGFR ligands in the medium by proteinases (19). These results indicate that PGE2-dependent signaling can cross-talk with the MAPK/Erk pathway and induce the activation of the downstream effector kinase Erk that is responsible for modulation of various cellular processes.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 1. Time course of PGE2-dependent Erk 1, 2 phosphorylation in NSCLC. H157, RH2, and H460 NSCLC cells were serum-starved and treated with PGE2 (10 µg/mL) in serum-free medium for the indicated periods of time (in minutes). Phosphorylation of Erk-1, 2 (p-Erk) was assessed by Western blotting (top). The blot was washed and reprobed with anti-actin antibodies to ensure equal loading (bottom).

 


View larger version (28K):
[in this window]
[in a new window]
 
Figure 2. PGE2-induced Erk phosphorylation is not inhibited by EGFR inhibitors Erlotinib and PD153035 in NSCLC cells. PGE2-induced Erk phosphorylation is not evident in bronchial epithelial cells. BEAS-2B human bronchial epithelial cells and H157, RH2, and H460 NSCLC cells were serum-starved and treated with PGE2 (10 µg/mL) or EGF (50 ng/mL) in serum-free medium for 10 minutes. Where applicable, cells were pretreated with PD153035 (1 µmol/L; A) or Erlotinib (2 µmol/L; B) for 1 hour prior to PGE2 or EGF stimulation. Blots were probed for p-Erk-1, 2 (top) and actin or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (bottom).

 
Prostaglandin E2-mediated Erk phosphorylation is resistant to epidermal growth factor receptor inhibitors. We investigated the effect of highly specific EGFR inhibitors PD153035 (IC50 = 25 pmol/L) and Erlotinib (IC50 = 2 nmol/L) that rapidly suppress EGFR autophosphorylation. Stimulation of bronchial epithelial or NSCLC cells with EGF (50 ng/mL) induced rapid Erk phosphorylation that was completely blocked by pretreatment of the cells with the EGFR inhibitors (Fig. 2). However, in PGE2-responsive NSCLC cell lines, PGE2-induced Erk phosphorylation was resistant to EGFR inhibition. Combined stimulation of these NSCLC cells with EGF and PGE2 did not produce a significant difference in Erk phosphorylation (Fig. 2).

Prostaglandin E2-mediated Erk phosphorylation is cyclic AMP-independent and resistant to src inhibition. In order to elucidate the mechanisms of PGE2-mediated MAPK/Erk pathway activation, we studied the effect of elevated cAMP production and PKA activation on Erk phosphorylation. Pretreatment of the NSCLC cells with the potent specific (Ki = 56 nmol/L) PKA inhibitor KT5720 did not prevent PGE2-dependent Erk phosphorylation (Fig. 3A). Similarly, treatment of the cells with cAMP level–modulating agents Rolipram (inhibitor of cAMP-specific phosphodiesterase) and Forskolin (activator of adenylate cyclase) alone or in combination with PGE2 did not affect Erk phosphorylation (Fig. 3B). There was also no change in Erk phosphorylation observed with other cAMP-elevating agents, such as cholera toxin (activates Gs proteins), IBMX (phosphodiesterase inhibitor) and pertussis toxin (EP3 antagonist, Gi protein suppressor; data not shown). To clarify the role of src tyrosine kinase on PGE2-mediated Erk phosphorylation, the NSCLC cells were pretreated with potent inhibitors of src family kinases SU6656 and PP2 prior to PGE2 stimulation. Neither of the src inhibitors blocked the PGE2-induced Erk phosphorylation (Fig. 4).



View larger version (40K):
[in this window]
[in a new window]
 
Figure 3. PGE2-induced Erk phosphorylation in NSCLC cells is cAMP-independent. H157, RH2, and H460 NSCLC cells were serum-starved and treated with PGE2 (10 µg/mL) in serum-free medium for 10 minutes. Where applicable, cells were pretreated with PKA inhibitor KT5720 (10 µmol/L; A), cAMP-specific phosphodiesterase inhibitor Rolipram (10 µmol/L) or adenylate cyclase activator Forskolin (20 µmol/L; B) for 1 hour prior to PGE2 exposure. Neither of the PKA-modulating agents, either alone or in combination with PGE2, affected Erk phosphorylation as assessed by Western blot (top, A and B). Blots were reprobed with anti-actin antibody (bottom).

 


View larger version (18K):
[in this window]
[in a new window]
 
Figure 4. PGE2-induced Erk phosphorylation is resistant to src kinase inhibitors. H157, RH2, and H460 NSCLC cells were serum-starved and treated with PGE2 (10 µg/mL) in serum-free medium for 10 minutes. Where applicable, cells were pretreated with src inhibitors SU6656 (2 µmol/L) or PP2 (1 µmol/L) for 1 hour prior to PGE2 induction. Blots were probed for p-Erk (top) or actin (bottom).

 
Prostaglandin E2-mediated Erk phosphorylation is inhibited by protein kinase C inhibition. We next analyzed the role of PKC in PGE2-dependent Erk phosphorylation. NSCLC cells were pretreated with the selective and potent (IC50 = 15 nmol/L) PKC inhibitor Ro-31-8425 prior to PGE2 stimulation. We found that inhibition of PKC significantly blocks PGE2-dependent Erk phosphorylation in NSCLC cells (Fig. 5A). In agreement with this finding, desensitization of PKC by treatment with 200 nmol/L phorbol-12,13-dibutyrate for 24 hours, completely inhibited PGE2-dependent Erk phosphorylation (data not shown). To corroborate the involvement of PKC in MAPK/Erk pathway cross-activation by PGE2, we used the EP1/EP2 receptor antagonist AH6809. The NSCLC cells used in this study express the EP1, EP3, and EP4 receptors but do not express the EP2 receptor (Fig. 5C). Therefore, in our model, AH6809 blocked only EP1 receptors, which are responsible for cellular calcium influx (3) and activation of Ca2+-dependent PKC isoforms. Consistent with our findings using PKC inhibition by Ro-31-8425, blocking the EP1 receptors by AH6809 notably suppressed the PGE2-dependent Erk phosphorylation (Fig. 5B).



View larger version (44K):
[in this window]
[in a new window]
 
Figure 5. PGE2-induced Erk phosphorylation is PKC-dependent and mediated by EP1 receptors. H157, RH2, and H460 NSCLC cells were serum-starved and treated with PGE2 (10 µg/mL) in serum-free medium for 10 minutes. Where applicable, cells were pretreated with PKC inhibitor Ro-31-8425 (1 µmol/L; A) or EP1/2 receptor antagonist AH6809 (50 µmol/L; B) for 1 hour prior to PGE2 induction. Blots were probed for p-Erk (top, A and B) or actin (bottom). C, EP receptor expression in different NSCLC cell lines by RT-PCR.

 
Prostaglandin E2 induces epidermal growth factor receptor inhibitor-resistant cell proliferation in non–small cell lung cancer cells. To further investigate the physiologic effects of PGE2-dependent Erk phosphorylation, we studied the proliferation dynamics of NSCLC cells treated with PGE2, EGFR inhibitors and a COX-2 inhibitor. To determine the capacity of EGFR inhibition to block PGE2-dependent cell proliferation, cells were pretreated with Erlotinib or PD153035 prior to PGE2 stimulation. We observed a significant increase of NSCLC cell proliferation in response to PGE2 treatment that was resistant to EGFR inhibition (Fig. 6). Treatment with EGFR inhibitors or sc58236 alone had only a modest effect on cell proliferation. However, treatment with the combination of both drugs significantly decreased proliferation of NSCLC cells compared with either drug alone or nontreated control cells.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 6. Combination treatment of PGE2-responsive NSCLC cells with COX-2 and EGFR inhibitors significantly reduces cell proliferation compared with either drug alone. H157, RH2, and H460 NSCLC cells were treated with PGE2 (10 µg/mL), EGFR inhibitor Erlotinib (2 µmol/L), COX-2 inhibitor sc58236 (5 µmol/L), PGE2 + Erlotinib, or Erlotinib + sc58236. For PGE2 + Erlotinib treatment, cells were pretreated with Erlotinib for 1 hour prior to addition of PGE2. Cell proliferation was assessed after 72 hours using the BrdUrd incorporation ELISA kit according to the manufacturer's protocol (Roche). Columns, mean; bars, ±SD.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
EGFR is frequently overexpressed in a variety of malignancies and plays an important role in tumor cell growth, proliferation, and metastasis (2023). Because of its important role in tumor progression, EGFR is also a promising target for cancer therapy (2426). However, only a limited population of cancer patients responds to EGFR inhibitor therapy. Recent studies indicate that sensitivity to EGFR tyrosine kinase inhibitors is due to activating somatic mutations in the tyrosine kinase domain (2729). Whereas the identification of these activating EGFR mutations is important, they are apparently present in a minority of lung cancer patients. Thus, the definition of resistance pathways in tumors expressing wild-type EGFR is of paramount importance. Investigation of the cross-talk between EGFR and other signal transduction pathways that can overcome pharmacologic inhibition of EGFR by cross-activation of its downstream effectors could identify additional targets for combination therapies. GPCRs belong to the largest and most ubiquitous superfamily of membrane receptors that signal by activating heterotrimeric G proteins, thus controlling a broad range of physiologic functions (30). Here we studied the PGE2, GPCR-dependent signaling that can overcome EGFR TK inhibition in NSCLC.

It is well-established that human malignancies frequently overexpress COX-2 and produce high levels of the COX-2 metabolite PGE2 (410). PGE2 exerts its multiple actions through four GPCRs designated EP1, EP2, EP3, and EP4 (3) that can stimulate epithelial cell growth and invasion (11) and promote cellular survival (13). Studies of the receptor subtypes have shown that the EP2 and EP4 receptor signaling is mediated by Gs G proteins and leads to activation of adenylate cyclase and elevated cAMP synthesis. In contrast, EP3 signaling through Gi, inhibits adenylate cyclase and cAMP synthesis. The EP1 receptor acts via Gq protein and upon activation, increases cellular Ca2+ level that in turn leads to PKC activation (31). GPCRs can cross-activate the MAPK/Erk pathway through different cross-talk points (32). Recent reports suggest that GPCR-dependent MAPK/Erk pathway cross-activation may be mediated by either intracellular cross-talk (16, 17, 33, 34) or proteolytic release of EGFR agonists (19).

Here, we report that in NSCLC cells, PGE2 induced EGFR-independent Erk phosphorylation within minutes of treatment and stimulated increased cellular proliferation in a longer term assays. The EGFR inhibitors Erlotinib and PD153035 completely abolished the EGF-induced MAPK/Erk pathway activation but were unable to suppress PGE2-mediated Erk phosphorylation (Fig. 2) in a subset of NSCLC cells. The rapid phosphorylation of Erk suggests that it is executed via intracellular activation of kinase cascades rather than proteolytic release of EGFR ligands as has been previously described (35). The time-dependent pattern of Erk phosphorylation by PGE2 (Fig. 1) was similar to the pattern of Erk phosphorylation after EGF treatment. This suggests the presence of de novo phosphorylation of Erk rather than modulation of another locus in the pathway such as Erk phosphatase activity (36). To investigate the molecular mechanisms of this MAPK/Erk pathway activation by PGE2 in NSCLC, we analyzed several possible cross-talk points. Previous reports suggested that activation of EP2 and EP4 receptors and the subsequent increase of cAMP synthesis and PKA activity was operative in cancer progression, modulating either Raf or src activities (11, 37, 38). However, in our experiments, inhibition of PKA by the specific inhibitor KT5720 did not prevent Erk activation by PGE2 in PGE2-responsive NSCLC cells (Fig. 3A). Similarly, modulation of cAMP levels in NSCLC cells by an inhibitor of cAMP-dependent phosphodiesterase or an activator of adenylate cyclase, did not have any effect on PGE2-dependent Erk phosphorylation (Fig. 3B) arguing against possible PKA-independent effects of cAMP or involvement of EP2 or EP4 receptor activation. Other reagents that continuously elevate cAMP levels, such as Gs proteins stimulating cholera toxin, phosphodiesterase inhibitor IBMX and EP3 antagonist, Gi protein suppressor pertussis toxin, did not alter phosphorylation of Erk by PGE2 (data not shown). These data indicate that PGE2-dependent activation of the MAPK/Erk pathway is not predominantly mediated by cAMP in PGE2-responsive NSCLC cells.

Several reports have suggested involvement of src tyrosine kinase, induced by Gq- or Gi-coupled GPCRs, in MAPK/Erk pathway activation (16, 17, 33). We therefore analyzed the contribution of src in PGE2-dependent Erk phosphorylation using two potent inhibitors of src kinase, PP2 and SU6656. We found that in contrast to these previous reports, activation of the MAPK/Erk pathway by PGE2 in NSCLC cells was resistant to src inhibitors (Fig. 4). These observations indicate that the analyzed pathway cross-activation in NSCLC cells is not src-dependent.

Given that activation of EP1 receptors initiates Ca2+ influx and increase in Ca2+-dependent PKC activity, we determined the effect of PKC inhibition on PGE2-mediated Erk phosphorylation. Previous studies have shown that activated PKC can phosphorylate Raf-1 either directly or by activation of small GTPase Ras, which in turn activates the MAPK/Erk cascade and supports cell growth (3941). In our experiments, pretreatment with the PKC inhibitor Ro-31-8425 abrogates the PGE2-dependent Erk phosphorylation (Fig. 5A). In accord with this data, the use of EP1/EP2 receptor inhibitor, AH6809, significantly suppressed PGE2-dependent Erk phosphorylation in NSCLC cell lines (Fig. 5B). RT-PCR analysis revealed that the NSCLC cell lines used in our study did not express the EP2 receptor (Fig. 5C). Thus, this narrows the effect of AH6809 to EP1 receptor inhibition, which is therefore responsible for PKC activation by PGE2. These results are consistent with the data of Watanabe et al. who have shown the importance of EP1 receptor in colon carcinogenesis (42). Incomplete inhibition of PGE2-dependent Erk phosphorylation by AH6809 may indicate the low potency of the inhibitor in suppression of EP1 receptor activation. Alternatively, this could imply activation of other EP receptors. However, our findings seem to implicate EP1 receptor signaling in these events. For example, agents that mimic EP4 stimulation did not induce Erk activation and EP2 receptor expression was not evident in tested cell lines. Some reports indicate that PKC, upon activation by 12-O-tetradecanoylphorbol-13-acetate, is able to phosphorylate Thr654 in the juxtamembrane domain of EGFR exon 17, thus modulating the receptor signaling (43). As EGFR mutations have recently been found critical for modulation of receptor activation (2729), we searched for mutations in exon 17 in cell lines responsive and nonresponsive to PGE2 stimulation and found that all of them had a wild-type exon 17 (data not shown). Taken together, our results suggest that activation of the MAPK/Erk pathway by PGE2 in NSCLC cells depends on EP1 receptor activation and is mediated by PKC at the post-receptor level. However, the exact mechanism of the initiation of MAPK/Erk pathway activation at the EP receptor level including the possible role of GPCR Gß{gamma} subunits (30, 32) in PGE2 signal transmission will require further investigation.

The MAPK/Erk signal transduction pathway controls a number of vital cellular processes, such as proliferation, migration, survival and angiogenesis (44, 45). To investigate the physiologic effects of PGE2-driven Erk phosphorylation, we studied the effect of PGE2 treatment on proliferation of NSCLC cells. Consistent with the previous reports (11, 16) that showed the proliferative effect of PGE2, we were able to stimulate cell proliferation by PGE2 treatment in PGE2-responsive NSCLC cell lines (Fig. 6). This PGE2-dependent stimulation was resistant to EGFR inhibitor treatment. Treatment of the cells with the EGFR or COX-2 inhibitors alone had only minimal effect on cell proliferation. Strikingly, the combination of these drugs reduced cell proliferation significantly, suggesting that COX-2 overexpression may be an important contributor to EGFR inhibitor resistance in NSCLC. These results provide evidence of functional significance of PGE2-dependent activation of MAPK/Erk pathway in NSCLC cells.

Finally, our data highlight the complex network of cross-signaling between the GPCR and MAPK/Erk pathways (4648). This PGE2-mediated cross-talk can shift the balance between the stimulatory and inhibitory responses in NSCLC toward pro-survival and proliferative phenotypes that ultimately may determine the cancer cell resistance to pharmacologic EGFR inhibition. This is the first indication of an EGFR inhibitor–resistant MAPK/Erk pathway activation by PGE2 in NSCLC. The functional manifestation of this activation was an enhanced cellular proliferative response to PGE2 that was resistant to EGFR inhibition. Here we also describe a novel EP1/PKC-mediated mechanism of PGE2-dependent Erk cascade activation in NSCLC. Collectively, these findings suggest that overproduction of PGE2 in the tumor environment may lead to EGFR inhibitor resistance in NSCLC. Thus, COX-2 inhibitors may play a role in augmenting the efficacy of EGFR tyrosine kinase inhibitor therapy in patients with NSCLC. Based on our current findings, clinical evaluation of this combination therapy is in progress (49).


    Acknowledgments
 
Grant support: UCLA Specialized Programs of Research Excellence In Lung Cancer NIH P50 CA90388 (to S.M. Dubinett), Tobacco-Related Disease Research Program grant #12FT-0061 (to K. Krysan), and VA Career Development Award, American Society of Clinical Oncology Young Investigator Award, STOP Cancer Memorial Award (to K.L. Reckamp).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 1/24/05. Revised 4/18/05. Accepted 5/ 3/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Herschman HR. Prostaglandin synthase 2. Biochim Biophys Acta 1996;1299:125–40.[Medline]
  2. Smith WL, Garavito RM, DeWitt DL. Prostaglandin endoperoxide H synthases (cyclooxygenases)-1 and -2. J Biol Chem 1996;271:33157–60.[Free Full Text]
  3. Dubois RN, Abramson SB, Crofford L, et al. Cyclooxygenase in biology and disease. FASEB J 1998;12:1063–73.[Abstract/Free Full Text]
  4. Kutchera W, Jones DA, Matsunami N, et al. Prostaglandin H synthase 2 is expressed abnormally in human colon cancer: evidence for a transcriptional effect. Proc Natl Acad Sci U S A 1996;93:4816–20.[Abstract/Free Full Text]
  5. Fujita T, Matsui M, Takaku K, et al. Size- and invasion-dependent increase in cyclooxygenase 2 levels in human colorectal carcinomas. Cancer Res 1998;58:4823–6.[Abstract/Free Full Text]
  6. Kirschenbaum A, Liu X, Yao S, Levine AC. The role of cyclooxygenase-2 in prostate cancer. Urology 2001;58:127–31.[CrossRef][Medline]
  7. Huang M, Stolina M, Sharma S, et al. Non-small cell lung cancer cyclooxygenase-2-dependent regulation of cytokine balance in lymphocytes and macrophages: up-regulation of interleukin 10 and down-regulation of interleukin 12 production. Cancer Res 1998;58:1208–16.[Abstract/Free Full Text]
  8. Soslow RA, Dannenberg AJ, Rush D, et al. COX-2 is expressed in human pulmonary, colonic, and mammary tumors. Cancer 2000;89:2637–45.[CrossRef][Medline]
  9. Wolff H, Saukkonen K, Anttila S, Karjalainen A, Vainio H, Ristimaki A. Expression of cyclooxygenase-2 in human lung carcinoma. Cancer Res 1998;58:4997–5001.[Abstract/Free Full Text]
  10. Subbaramaiah K, Norton L, Gerald W, Dannenberg AJ. Cyclooxygenase-2 is overexpressed in HER-2/neu-positive breast cancer: evidence for involvement of AP-1 and PEA3. J Biol Chem 2002;277:18649–57.[Abstract/Free Full Text]
  11. Sheng H, Shao J, Washington MK, DuBois RN. Prostaglandin E2 increases growth and motility of colorectal carcinoma cells. J Biol Chem 2001;276:18075–81.[Abstract/Free Full Text]
  12. Dohadwala M, Luo J, Zhu L, et al. Non-small cell lung cancer cyclooxygenase-2-dependent invasion is mediated by CD44. J Biol Chem 2001;276:20809–12.[Abstract/Free Full Text]
  13. Tsujii M, DuBois RN. Alterations in cellular adhesion and apoptosis in epithelial cells overexpressing prostaglandin endoperoxide synthase 2. Cell 1995;83:493–501.[CrossRef][Medline]
  14. Krysan K, Merchant FH, Zhu L, et al. COX-2-dependent stabilization of survivin in non-small cell lung cancer. FASEB J 2004;18:206–8.[Abstract/Free Full Text]
  15. Dannenberg AJ, Subbaramaiah K. Targeting cyclooxygenase-2 in human neoplasia: rationale and promise. Cancer Cell 2003;4:431–6.[CrossRef][Medline]
  16. Pai R, Soreghan B, Szabo IL, Pavelka M, Baatar D, Tarnawski AS. Prostaglandin E2 transactivates EGF receptor: a novel mechanism for promoting colon cancer growth and gastrointestinal hypertrophy. Nat Med 2002;8:289–93.[CrossRef][Medline]
  17. Buchanan FG, Wang D, Bargiacchi F, DuBois RN. Prostaglandin E2 regulates cell migration via the intracellular activation of the epidermal growth factor receptor. J Biol Chem 2003;278:35451–7.[Abstract/Free Full Text]
  18. Huang M, Sharma S, Mao JT, Dubinett SM. Non-small cell lung cancer-derived soluble mediators and prostaglandin E2 enhance peripheral blood lymphocyte IL-10 transcription and protein production. J Immunol 1996;157:5512–20.[Abstract]
  19. Carpenter G. EGF receptor transactivation mediated by the proteolytic production of EGF-like agonists. Sci STKE 2000;18PE1.
  20. Ullrich A, Coussens L, Hayflick JS, et al. Human epidermal growth factor receptor cDNA sequence and aberrant expression of the amplified gene in A431 epidermoid carcinoma cells. Nature 1984;309:418–25.[CrossRef][Medline]
  21. Plowman GD, Green JM, Culouscou JM, Carlton GW, Rothwell VM, Buckley S. Heregulin induces tyrosine phosphorylation of HER4/p180erbB4. Nature 1993;366:473–5.[CrossRef][Medline]
  22. Bargmann CI, Hung MC, Weinberg RA. The neu oncogene encodes an epidermal growth factor receptor-related protein. Nature 1986;319:226–30.[CrossRef][Medline]
  23. Alroy I, Yarden Y. The ErbB signaling network in embryogenesis and oncogenesis: signal diversification through combinatorial ligand-receptor interactions. FEBS Lett 1997;410:83–6.[CrossRef][Medline]
  24. Woodburn JR. The epidermal growth factor receptor and its inhibition in cancer therapy. Pharmacol Ther 1999;82:241–50.[CrossRef][Medline]
  25. Ciardiello F, Tortora G. A novel approach in the treatment of cancer: targeting the epidermal growth factor receptor. Clin Cancer Res 2001;7:2958–70.[Abstract/Free Full Text]
  26. Arteaga CL. ErbB-targeted therapeutic approaches in human cancer. Exp Cell Res 2003;284:122–30.[CrossRef][Medline]
  27. Paez JG, Janne PA, Lee JC, et al. EGFR mutations in lung cancer: correlation with clinical response to Gefitinib therapy. Science 2004;304:1497–500.[Abstract/Free Full Text]
  28. Pao W, Miller V, Zakowski M, et al. EGF receptor gene mutations are common in lung cancers from "never smokers" and are associated with sensitivity of tumors to gefitinib and erlotinib. Proc Natl Acad Sci U S A 2004;101:13306–11.[Abstract/Free Full Text]
  29. Lynch TJ, Bell DW, Sordella R, et al. Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med 2004;350:2129–39.[Abstract/Free Full Text]
  30. Pierce KL, Premont RT, Lefkowitz RJ. Seven-transmembrane receptors. Nat Rev Mol Cell Biol 2002;3:639–50.[CrossRef][Medline]
  31. Breyer RM, Kennedy CR, Zhang Y, Breyer MD. Structure-function analyses of eicosanoid receptors. Physiologic and therapeutic implications. Ann N Y Acad Sci 2000;905:221–31.[Abstract/Free Full Text]
  32. Gutkind JS. Regulation of mitogen-activated protein kinase signaling networks by G protein-coupled receptors. Sci STKE 2000;2000:RE1.
  33. Daub H, Wallasch C, Lankenau A, Herrlich A, Ullrich A. Signal characteristics of G protein-transactivated EGF receptor. EMBO J 1997;16:7032–44.[CrossRef][Medline]
  34. Gutkind JS. The pathways connecting G protein-coupled receptors to the nucleus through divergent mitogen-activated protein kinase cascades. J Biol Chem 1998;273:1839–42.[Free Full Text]
  35. Prenzel N, Zwick E, Daub H, et al. EGF receptor transactivation by G-protein-coupled receptors requires metalloproteinase cleavage of proHB-EGF. Nature 1999;402:884–8.[Medline]
  36. Bhalla US, Ram PT, Iyengar R. MAP kinase phosphatase as a locus of flexibility in a mitogen-activated protein kinase signaling network. Science 2002;297:1018–23.[Abstract/Free Full Text]
  37. Stork PJ, Schmitt JM. Crosstalk between cAMP and MAP kinase signaling in the regulation of cell proliferation. Trends Cell Biol 2002;12:258–66.[CrossRef][Medline]
  38. Abrahamsen H, Vang T, Tasken K. Protein kinase A intersects SRC signaling in membrane microdomains. J Biol Chem 2003;278:17170–7.[Abstract/Free Full Text]
  39. Kolch W, Heidecker G, Kochs G, et al. Protein kinase C{alpha} activates RAF-1 by direct phosphorylation. Nature 1993;364:249–52.[CrossRef][Medline]
  40. Schonwasser DC, Marais RM, Marshall CJ, Parker PJ. Activation of the mitogen-activated protein kinase/extracellular signal-regulated kinase pathway by conventional, novel, and atypical protein kinase C isotypes. Mol Cell Biol 1998;18:790–8.[Abstract/Free Full Text]
  41. Bhalla US, Iyengar R. Emergent properties of networks of biological signaling pathways. Science 1999;283:381–7.[Abstract/Free Full Text]
  42. Watanabe K, Kawamori T, Nakatsugi S, et al. Role of the prostaglandin E receptor subtype EP1 in colon carcinogenesis. Cancer Res 1999;59:5093–6.[Abstract/Free Full Text]
  43. Hunter T, Ling N, Cooper JA. Protein kinase C phosphorylation of the EGF receptor at a threonine residue close to the cytoplasmic face of the plasma membrane. Nature 1984;311:480–3.[CrossRef][Medline]
  44. Hazzalin CA, Mahadevan LC. MAPK-regulated transcription: a continuously variable gene switch? Nat Rev Mol Cell Biol 2002;3:30–40.[CrossRef][Medline]
  45. Schulze A, Lehmann K, Jefferies HB, McMahon M, Downward J. Analysis of the transcriptional program induced by Raf in epithelial cells. Genes Dev 2001;15:981–94.[Abstract/Free Full Text]
  46. Gschwind A, Fischer OM, Ullrich A. The discovery of receptor tyrosine kinases: targets for cancer therapy. Nat Rev Cancer 2004;4:361–70.[CrossRef][Medline]
  47. Gschwind A, Zwick E, Prenzel N, Leserer M, Ullrich A. Cell communication networks: epidermal growth factor receptor transactivation as the paradigm for interreceptor signal transmission. Oncogene 2001;20:1594–600.[CrossRef][Medline]
  48. Neaud V, Duplantier JG, Mazzocco C, Kisiel W, Rosenbaum J. Thrombin up-regulates tissue factor pathway inhibitor-2 synthesis through a cyclooxygenase-2-dependent, epidermal growth factor receptor-independent mechanism. J Biol Chem 2004;279:5200–6.[Abstract/Free Full Text]
  49. Reckamp K, Dubinett SM, Krysan K, Figlin R. A phase I trial of targeted COX-2 and EGFR TK inhibition in advanced NSCLC. ASCO 2005; Abstract 7112.



This article has been cited by other articles:


Home page
J. Pharmacol. Exp. Ther.Home page
L. Yu, W. K. K. Wu, Z. J. Li, H. P. S. Wong, E. K. K. Tai, H. T. Li, Y. C. Wu, and C. H. Cho
E Series of Prostaglandin Receptor 2-Mediated Activation of Extracellular Signal-Regulated Kinase/Activator Protein-1 Signaling Is Required for the Mitogenic Action of Prostaglandin E2 in Esophageal Squamous-Cell Carcinoma
J. Pharmacol. Exp. Ther., October 1, 2008; 327(1): 258 - 267.
[Abstract] [Full Text] [PDF]


Home page
Cancer Prevention ResearchHome page
S. M. Dubinett,, J. T. Mao, and S. Hazra
Focusing Downstream in Lung Cancer Prevention: 15-Hydroxyprostaglandin Dehydrogenase
Cancer Prevention Research, September 1, 2008; 1(4): 223 - 225.
[Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. J. Fidler, A. Argiris, J. D. Patel, D. H. Johnson, A. Sandler, V. M. Villaflor, J. Coon IV, L. Buckingham, K. Kaiser, S. Basu, et al.
The Potential Predictive Value of Cyclooxygenase-2 Expression and Increased Risk of Gastrointestinal Hemorrhage in Advanced Non-Small Cell Lung Cancer Patients Treated with Erlotinib and Celecoxib
Clin. Cancer Res., April 1, 2008; 14(7): 2088 - 2094.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
R. Hatazawa, A. Tanaka, M. Tanigami, K. Amagase, S. Kato, Y. Ashida, and K. Takeuchi
Cyclooxygenase-2/prostaglandin E2 accelerates the healing of gastric ulcers via EP4 receptors
Am J Physiol Gastrointest Liver Physiol, October 1, 2007; 293(4): G788 - G797.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
K. Meisdalen, O. F. Dajani, T. Christoffersen, and D. Sandnes
Prostaglandins Enhance Epidermal Growth Factor-Induced DNA Synthesis in Hepatocytes by Stimulation of E Prostanoid 3 and F Prostanoid Receptors
J. Pharmacol. Exp. Ther., September 1, 2007; 322(3): 1044 - 1050.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
J. M. Siegfried, C. T. Gubish, M. E. Rothstein, P. E. Q. de Oliveira, and L. P. Stabile
Signaling Pathways Involved in Cyclooxygenase-2 Induction by Hepatocyte Growth Factor in Non Small-Cell Lung Cancer
Mol. Pharmacol., September 1, 2007; 72(3): 769 - 779.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
S. Donnini, F. Finetti, R. Solito, E. Terzuoli, A. Sacchetti, L. Morbidelli, P. Patrignani, and M. Ziche
EP2 prostanoid receptor promotes squamous cell carcinoma growth through epidermal growth factor receptor transactivation and iNOS and ERK1/2 pathways
FASEB J, August 1, 2007; 21(10): 2418 - 2430.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
I. Stasinopoulos, D. R. O'Brien, F. Wildes, K. Glunde, and Z. M. Bhujwalla
Silencing of Cyclooxygenase-2 Inhibits Metastasis and Delays Tumor Onset of Poorly Differentiated Metastatic Breast Cancer Cells
Mol. Cancer Res., May 1, 2007; 5(5): 435 - 442.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. M. Thomas, N. E. Bhola, Q. Zhang, S. C. Contrucci, A. L. Wentzel, M. L. Freilino, W. E. Gooding, J. M. Siegfried, D. C. Chan, and J. R. Grandis
Cross-talk between G Protein-Coupled Receptor and Epidermal Growth Factor Receptor Signaling Pathways Contributes to Growth and Invasion of Head and Neck Squamous Cell Carcinoma
Cancer Res., December 15, 2006; 66(24): 11831 - 11839.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
Y. Yan, J. Li, W. Ouyang, Q. Ma, Y. Hu, D. Zhang, J. Ding, Q. Qu, K. Subbaramaiah, and C. Huang
NFAT3 is specifically required for TNF-{alpha}-induced cyclooxygenase-2 (COX-2) expression and transformation of Cl41 cells
J. Cell Sci., July 15, 2006; 119(14): 2985 - 2994.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
G. J. Kelloff, S. M. Lippman, A. J. Dannenberg, C. C. Sigman, H. L. Pearce, B. J. Reid, E. Szabo, V. C. Jordan, M. R. Spitz, G. B. Mills, et al.
Progress in Chemoprevention Drug Development: The Promise of Molecular Biomarkers for Prevention of Intraepithelial Neoplasia and Cancer--A Plan to Move Forward
Clin. Cancer Res., June 15, 2006; 12(12): 3661 - 3697.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
S. Kalyankrishna and J. R. Grandis
Epidermal Growth Factor Receptor Biology in Head and Neck Cancer
J. Clin. Oncol., June 10, 2006; 24(17): 2666 - 2672.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
K. L. Reckamp, K. Krysan, J. D. Morrow, G. L. Milne, R. A. Newman, C. Tucker, R. M. Elashoff, S. M. Dubinett, and R. A. Figlin
A phase I trial to determine the optimal biological dose of celecoxib when combined with erlotinib in advanced non-small cell lung cancer.
Clin. Cancer Res., June 1, 2006; 12(11): 3381 - 3388.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. M. Lippman and J. J. Lee
Reducing the "Risk" of Chemoprevention: Defining and Targeting High Risk--2005 AACR Cancer Research and Prevention Foundation Award Lecture.
Cancer Res., March 15, 2006; 66(6): 2893 - 2903.
[Abstract] [Full Text] [PDF]


Home page
The OncologistHome page
P. Maione, C. Gridelli, T. Troiani, and F. Ciardiello
Combining Targeted Therapies and Drugs with Multiple Targets in the Treatment of NSCLC.
Oncologist, March 1, 2006; 11(3): 274 - 284.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Krysan, K.
Right arrow