| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell and Tumor Biology |
1 UCLA Lung Cancer Research Program of the Jonsson Comprehensive Cancer Center, 2 UCLA-CURE Digestive Diseases Research Center and Molecular Biology Institute, David Geffen School of Medicine at UCLA; and 3 Veterans Affairs Greater Los Angeles Healthcare System, Los Angeles, California
Requests for reprints: Steven M. Dubinett, UCLA Lung Cancer Research Program of the Jonsson Comprehensive Cancer Center, David Geffen School of Medicine at UCLA, 37-131 CHS, 10833 Le Conte Avenue, Los Angeles, CA 90095-1690. Phone: 310-794-6566; Fax: 310-267-2829; E-mail: sdubinett{at}mednet.ucla.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Studies of human cancers have revealed frequent overexpression of COX-2 in a variety of different malignancies. High-level constitutive COX-2 expression has been detected in colorectal (4, 5), prostate (6), lung (79), breast (8, 10), and other cancers. Overexpression of COX-2 can stimulate epithelial cell growth and invasion (11, 12) and promote cellular survival (13, 14). Nonsteroidal antiinflammatory drugs as well as specific COX-2 inhibitors promote cancer cell apoptosis and are therefore being evaluated for cancer chemoprevention and therapy (15).
Prostaglandins serve as autocrine and paracrine mediators and are involved in a variety of biological processes. A COX-2 metabolite abundantly present in the lung cancer microenvironment, prostaglandin E2 (PGE2) is an important mediator of immunoregulation and epithelial survival. PGE2 exerts its multiple effects through four G proteincoupled receptors (GPCR; ref. 3). It has been shown previously that GPCRs are able to trans-activate the epidermal growth factor receptor (EGFR) pathway leading to the promotion of cancer cell growth and motility (16, 17).
In the present study, we investigated the mechanisms of PGE2-mediated mitogen-activated protein kinase (MAPK)/Erk activation in nonsmall cell lung cancer (NSCLC) cells. We report that PGE2 treatment rapidly induces Erk phosphorylation in a subset of NSCLC cell lines and that this induction is resistant to EGFR inhibitors. In this subset of NSCLC cell lines, we found that PGE2 treatment stimulated cell proliferation that was resistant to EGFR inhibitors. Our analysis of the possible cross-talk mechanisms between the GPCR and MAPK/Erk signal transduction pathways suggests the involvement of protein kinase C (PKC)-dependent signaling.
This is the first documentation of PGE2-mediated EGFR-independent activation of the MAPK/Erk pathway. These findings suggest that COX-2 overexpression may be an important contributor to EGFR inhibitor resistance in NSCLC. Our results provide a strong rationale for the pharmacologic inhibition of PGE2 synthesis in combination with EGFR inhibitors in NSCLC therapy.
| Materials and Methods |
|---|
|
|
|---|
Cell culture. Human squamous cell carcinoma NSCLC cell lines H157 (National Cancer Institute, Bethesda, MD), RH2 (previously established in our laboratory; ref. 18), and adenocarcinoma cell line H460 (American Type Culture Collection, Rockville, MD), were grown in RPMI supplemented with 10% fetal bovine serum (Gemini Biological Products, Calabasas, CA). NCI-H292, NCI-H1975, NCI-H226, NCI-H2122, NCI-H1703, H125, H358, SKLU-1, NCI-H1437, NCI-H441, NCI-H520, A427, NCI-H647, NCI-H522, NCI-H1650, NCI-H1299, SW 900, NCI-H661, NCI-H1975, and Calu-3 NSCLC cell lines were purchased from the American Type Culture Collection. H3255 cells were a generous gift from Bruce E. Johnson (Dana-Farber Cancer Institute, Boston, MA). For the experiments, cells were plated at 3.5 x 105 cells per well in six-well plates, incubated overnight in RPMI + 10% fetal bovine serum, serum-starved for 2 hours, and treated as indicated in a fresh serum-free medium. To study the effect of PGE2 on Erk activation, cells were treated with PGE2 (10 µg/mL) for 10 minutes with or without inhibitors and for the time course of PGE2 effectsfor 5, 15, 30, 60 and 120 minutes. As a control of EGF pathway activation, cells were treated with EGF (50 ng/mL) alone or with EGFR tyrosine kinase inhibitors PD153035 (1 µmol/L) or Erlotinib (2 µmol/L). For inhibitor studies, cells were pretreated with the respective inhibitors at the working concentrations indicated above for 1 hour in serum-free medium prior to PGE2 addition.
Western blotting. Cells were washed with PBS and lysed with modified radioimmunoprecipitation assay buffer. Protein concentrations were measured using the bicinchoninic acid protein assay kit (Pierce, Rockford, IL). Western blotting was done as previously described (14). Briefly, proteins were separated in SDS-PAGE and transferred to the nitrocellulose membrane (Amersham Biosciences, Piscataway, NJ). Membranes were blocked in 5% Blotto (Santa Cruz Biotechnology, Santa Cruz, CA) in TBS + 0.1% Tween 20 and incubated with anti-phospho-Erk 1, 2 (p-Erk) mouse monoclonal antibodies (Cell Signaling, Beverly, MA) or anti-actin rabbit polyclonal antibodies (Sigma) diluted 1:1,000 or 1:5,000, respectively, in blocking solution. The membranes were then treated with horseradish peroxidase-conjugated secondary antibodies (Santa Cruz Biotechnology, 1:10,000) and developed using the SuperSignal West Pico kit (Pierce).
RT-PCR for EP receptors. RNA was isolated from NSCLC cell lines using the RNAEasy kit (Qiagen, Valencia, CA) and reverse-transcribed using the SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA). PCR was done using the Taq polymerase from New England Biolabs (Beverly, MA). The following primer pairs (Fforward, Rreverse primers 5'-3', amplicon sizes are in parentheses) were used for EP receptor and ß-actin amplification: EP1F GGTATCATGGTGGTGTCGTG, EP1R GGCCTCTGGTTGTGCTTAGA (324 bp); EP2F GCCACGATGCTCATGCTCTTCGCC, EP2R CTTGTGTTCTTAATGAAATCCGAC (655 bp); EP3F CGTGTCGCGCAGCTACCGGCG, EP3R CGGGCCACTGGACGGTGTACT (398 bp); EP4F GGGCTGGCTGTCACCGACCTG, EP4R GGTGCGGCGCATGAACTGGCG (485 bp); ß-actinF CCATCGAGCACGGCATCGTC, ß-actinR TCCAGACGCAGGATGGCATG (363 bp). PCR conditions were 3 minutes at 95°C followed by 35 cycles (25 for ß-actin): 1 minute at 95°C, 1 minute at 58°C, and 1 minute at 72°C.
Cell proliferation assay. Proliferation of NSCLC cells was studied using 3H-thymidine incorporation assay, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay (Promega Corp., Madison, WI) and colorimetric bromodeoxyuridine (BrdUrd) incorporation ELISA (Roche, Indianapolis, IN). Cells were plated in 96-well plates at 2 x 103 (H157 and H460) or 1.5 x 103 (RH2) cells per well in 96-well plates, incubated overnight in RPMI + 10% fetal bovine serum and treated with PGE2 (10 µg/mL) in fresh RPMI + 1% fetal bovine serum for 24, 48, or 72 hours. Where applicable, one of the EGFR inhibitors (1 µmol/L PD153035 or 2 µmol/L Erlotinib), specific COX-2 inhibitor sc58236 (5 µmol/L) or a combination of both were added to the cells. For PGE2 and EGFR inhibitors, combined treatment cells were pretreated with PD153035 or Erlotinib for 1 hour prior to PGE2 addition. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assays and BrdUrd incorporation ELISA were done as recommended by the manufacturers. For 3H-thymidine incorporation assay, 3H-thymidine (Amersham Biosciences) was added at 1 µCi/mL for 4 hours on the last day of PGE2 treatment. After the medium was removed, cells were washed twice with cold PBS, treated with 5% trichloroacetic acid for 30 minutes at 5°C, solubilized with 0.5 N NaOH and assayed on ß scintillation counter for incorporation of 3H.
| Results |
|---|
|
|
|---|
G substitution in exon 21) and H1650 (15 bp in-frame deletion in exon 19). We observed no Erk phosphorylation following PGE2 treatment in H3255 and H1650, and moderate phosphorylation in H1975 (data not shown).
Notable increase of phospho-Erk in PGE2-responsive cells was detected 5 minutes following PGE2 treatment, reached its maximum at
15 minutes and returned to the basal level at
30 minutes after the treatment (Fig. 1). Whereas this effect was observed in the PGE2-responsive subset of NSCLC cells (8 out of 23), it was not evident in BEAS-2B bronchial epithelial cells (Fig. 2). Both EGF- and PGE2-driven Erk phosphorylation was completely abolished by the MAP/ERK kinase inhibitor U0126 (data not shown). The time-dependent pattern of Erk phosphorylation by PGE2 was similar to that seen following EGF exposure (50 ng/mL; data not shown), suggesting that PGE2 cross-activates the MAPK/Erk signal transduction cascade rather than modulating the activity of the Erk negative regulator, MAPK phosphatase or stimulating the proteolytic release of EGFR ligands in the medium by proteinases (19). These results indicate that PGE2-dependent signaling can cross-talk with the MAPK/Erk pathway and induce the activation of the downstream effector kinase Erk that is responsible for modulation of various cellular processes.
|
|
Prostaglandin E2-mediated Erk phosphorylation is cyclic AMP-independent and resistant to src inhibition. In order to elucidate the mechanisms of PGE2-mediated MAPK/Erk pathway activation, we studied the effect of elevated cAMP production and PKA activation on Erk phosphorylation. Pretreatment of the NSCLC cells with the potent specific (Ki = 56 nmol/L) PKA inhibitor KT5720 did not prevent PGE2-dependent Erk phosphorylation (Fig. 3A). Similarly, treatment of the cells with cAMP levelmodulating agents Rolipram (inhibitor of cAMP-specific phosphodiesterase) and Forskolin (activator of adenylate cyclase) alone or in combination with PGE2 did not affect Erk phosphorylation (Fig. 3B). There was also no change in Erk phosphorylation observed with other cAMP-elevating agents, such as cholera toxin (activates Gs proteins), IBMX (phosphodiesterase inhibitor) and pertussis toxin (EP3 antagonist, Gi protein suppressor; data not shown). To clarify the role of src tyrosine kinase on PGE2-mediated Erk phosphorylation, the NSCLC cells were pretreated with potent inhibitors of src family kinases SU6656 and PP2 prior to PGE2 stimulation. Neither of the src inhibitors blocked the PGE2-induced Erk phosphorylation (Fig. 4).
|
|
|
|
| Discussion |
|---|
|
|
|---|
It is well-established that human malignancies frequently overexpress COX-2 and produce high levels of the COX-2 metabolite PGE2 (410). PGE2 exerts its multiple actions through four GPCRs designated EP1, EP2, EP3, and EP4 (3) that can stimulate epithelial cell growth and invasion (11) and promote cellular survival (13). Studies of the receptor subtypes have shown that the EP2 and EP4 receptor signaling is mediated by Gs G proteins and leads to activation of adenylate cyclase and elevated cAMP synthesis. In contrast, EP3 signaling through Gi, inhibits adenylate cyclase and cAMP synthesis. The EP1 receptor acts via Gq protein and upon activation, increases cellular Ca2+ level that in turn leads to PKC activation (31). GPCRs can cross-activate the MAPK/Erk pathway through different cross-talk points (32). Recent reports suggest that GPCR-dependent MAPK/Erk pathway cross-activation may be mediated by either intracellular cross-talk (16, 17, 33, 34) or proteolytic release of EGFR agonists (19).
Here, we report that in NSCLC cells, PGE2 induced EGFR-independent Erk phosphorylation within minutes of treatment and stimulated increased cellular proliferation in a longer term assays. The EGFR inhibitors Erlotinib and PD153035 completely abolished the EGF-induced MAPK/Erk pathway activation but were unable to suppress PGE2-mediated Erk phosphorylation (Fig. 2) in a subset of NSCLC cells. The rapid phosphorylation of Erk suggests that it is executed via intracellular activation of kinase cascades rather than proteolytic release of EGFR ligands as has been previously described (35). The time-dependent pattern of Erk phosphorylation by PGE2 (Fig. 1) was similar to the pattern of Erk phosphorylation after EGF treatment. This suggests the presence of de novo phosphorylation of Erk rather than modulation of another locus in the pathway such as Erk phosphatase activity (36). To investigate the molecular mechanisms of this MAPK/Erk pathway activation by PGE2 in NSCLC, we analyzed several possible cross-talk points. Previous reports suggested that activation of EP2 and EP4 receptors and the subsequent increase of cAMP synthesis and PKA activity was operative in cancer progression, modulating either Raf or src activities (11, 37, 38). However, in our experiments, inhibition of PKA by the specific inhibitor KT5720 did not prevent Erk activation by PGE2 in PGE2-responsive NSCLC cells (Fig. 3A). Similarly, modulation of cAMP levels in NSCLC cells by an inhibitor of cAMP-dependent phosphodiesterase or an activator of adenylate cyclase, did not have any effect on PGE2-dependent Erk phosphorylation (Fig. 3B) arguing against possible PKA-independent effects of cAMP or involvement of EP2 or EP4 receptor activation. Other reagents that continuously elevate cAMP levels, such as Gs proteins stimulating cholera toxin, phosphodiesterase inhibitor IBMX and EP3 antagonist, Gi protein suppressor pertussis toxin, did not alter phosphorylation of Erk by PGE2 (data not shown). These data indicate that PGE2-dependent activation of the MAPK/Erk pathway is not predominantly mediated by cAMP in PGE2-responsive NSCLC cells.
Several reports have suggested involvement of src tyrosine kinase, induced by Gq- or Gi-coupled GPCRs, in MAPK/Erk pathway activation (16, 17, 33). We therefore analyzed the contribution of src in PGE2-dependent Erk phosphorylation using two potent inhibitors of src kinase, PP2 and SU6656. We found that in contrast to these previous reports, activation of the MAPK/Erk pathway by PGE2 in NSCLC cells was resistant to src inhibitors (Fig. 4). These observations indicate that the analyzed pathway cross-activation in NSCLC cells is not src-dependent.
Given that activation of EP1 receptors initiates Ca2+ influx and increase in Ca2+-dependent PKC activity, we determined the effect of PKC inhibition on PGE2-mediated Erk phosphorylation. Previous studies have shown that activated PKC can phosphorylate Raf-1 either directly or by activation of small GTPase Ras, which in turn activates the MAPK/Erk cascade and supports cell growth (3941). In our experiments, pretreatment with the PKC inhibitor Ro-31-8425 abrogates the PGE2-dependent Erk phosphorylation (Fig. 5A). In accord with this data, the use of EP1/EP2 receptor inhibitor, AH6809, significantly suppressed PGE2-dependent Erk phosphorylation in NSCLC cell lines (Fig. 5B). RT-PCR analysis revealed that the NSCLC cell lines used in our study did not express the EP2 receptor (Fig. 5C). Thus, this narrows the effect of AH6809 to EP1 receptor inhibition, which is therefore responsible for PKC activation by PGE2. These results are consistent with the data of Watanabe et al. who have shown the importance of EP1 receptor in colon carcinogenesis (42). Incomplete inhibition of PGE2-dependent Erk phosphorylation by AH6809 may indicate the low potency of the inhibitor in suppression of EP1 receptor activation. Alternatively, this could imply activation of other EP receptors. However, our findings seem to implicate EP1 receptor signaling in these events. For example, agents that mimic EP4 stimulation did not induce Erk activation and EP2 receptor expression was not evident in tested cell lines. Some reports indicate that PKC, upon activation by 12-O-tetradecanoylphorbol-13-acetate, is able to phosphorylate Thr654 in the juxtamembrane domain of EGFR exon 17, thus modulating the receptor signaling (43). As EGFR mutations have recently been found critical for modulation of receptor activation (2729), we searched for mutations in exon 17 in cell lines responsive and nonresponsive to PGE2 stimulation and found that all of them had a wild-type exon 17 (data not shown). Taken together, our results suggest that activation of the MAPK/Erk pathway by PGE2 in NSCLC cells depends on EP1 receptor activation and is mediated by PKC at the post-receptor level. However, the exact mechanism of the initiation of MAPK/Erk pathway activation at the EP receptor level including the possible role of GPCR Gß
subunits (30, 32) in PGE2 signal transmission will require further investigation.
The MAPK/Erk signal transduction pathway controls a number of vital cellular processes, such as proliferation, migration, survival and angiogenesis (44, 45). To investigate the physiologic effects of PGE2-driven Erk phosphorylation, we studied the effect of PGE2 treatment on proliferation of NSCLC cells. Consistent with the previous reports (11, 16) that showed the proliferative effect of PGE2, we were able to stimulate cell proliferation by PGE2 treatment in PGE2-responsive NSCLC cell lines (Fig. 6). This PGE2-dependent stimulation was resistant to EGFR inhibitor treatment. Treatment of the cells with the EGFR or COX-2 inhibitors alone had only minimal effect on cell proliferation. Strikingly, the combination of these drugs reduced cell proliferation significantly, suggesting that COX-2 overexpression may be an important contributor to EGFR inhibitor resistance in NSCLC. These results provide evidence of functional significance of PGE2-dependent activation of MAPK/Erk pathway in NSCLC cells.
Finally, our data highlight the complex network of cross-signaling between the GPCR and MAPK/Erk pathways (4648). This PGE2-mediated cross-talk can shift the balance between the stimulatory and inhibitory responses in NSCLC toward pro-survival and proliferative phenotypes that ultimately may determine the cancer cell resistance to pharmacologic EGFR inhibition. This is the first indication of an EGFR inhibitorresistant MAPK/Erk pathway activation by PGE2 in NSCLC. The functional manifestation of this activation was an enhanced cellular proliferative response to PGE2 that was resistant to EGFR inhibition. Here we also describe a novel EP1/PKC-mediated mechanism of PGE2-dependent Erk cascade activation in NSCLC. Collectively, these findings suggest that overproduction of PGE2 in the tumor environment may lead to EGFR inhibitor resistance in NSCLC. Thus, COX-2 inhibitors may play a role in augmenting the efficacy of EGFR tyrosine kinase inhibitor therapy in patients with NSCLC. Based on our current findings, clinical evaluation of this combination therapy is in progress (49).
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 1/24/05. Revised 4/18/05. Accepted 5/ 3/05.
| References |
|---|
|
|
|---|
activates RAF-1 by direct phosphorylation. Nature 1993;364:24952.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
A. Limsukon, I. Susanto, G. W. S. Hoo, S. M. Dubinett, and R. K. Batra Regression of Recurrent Respiratory Papillomatosis With Celecoxib and Erlotinib Combination Therapy Chest, September 1, 2009; 136(3): 924 - 926. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Li and H.-H. Tai Activation of thromboxane A2 receptors induces orphan nuclear receptor Nurr1 expression and stimulates cell proliferation in human lung cancer cells Carcinogenesis, September 1, 2009; 30(9): 1606 - 1613. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. M. Kim, S.-Y. Park, and H. Pyo Cyclooxygenase-2 (COX-2) Negatively Regulates Expression of Epidermal Growth Factor Receptor and Causes Resistance to Gefitinib in COX-2-Overexpressing Cancer Cells Mol. Cancer Res., August 1, 2009; 7(8): 1367 - 1377. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. M. Kim, E. J. Lee, S.-Y. Park, K. H. Cho, J. Y. Kim, and H. Pyo Cyclooxygenase-2 Up-Regulates Ataxia Telangiectasia and Rad3 Related through Extracellular Signal-Regulated Kinase Activation Mol. Cancer Res., July 1, 2009; 7(7): 1158 - 1168. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zou, S. M. Thomas, Z.-W. Yan, J. R. Grandis, A. Vogt, and L.-Y. Li Human rhomboid family-1 gene RHBDF1 participates in GPCR-mediated transactivation of EGFR growth signals in head and neck squamous cancer cells FASEB J, February 1, 2009; 23(2): 425 - 432. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zheng, J. D. Ritzenthaler, X. Sun, J. Roman, and S. Han Prostaglandin E2 Stimulates Human Lung Carcinoma Cell Growth through Induction of Integrin-Linked Kinase: The Involvement of EP4 and Sp1 Cancer Res., February 1, 2009; 69(3): 896 - 904. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Zhang, N. Bhola, S. Kalyankrishna, W. Gooding, J. Hunt, R. Seethala, J. R. Grandis, and J. M. Siegfried Kinin B2 Receptor Mediates Induction of Cyclooxygenase-2 and Is Overexpressed in Head and Neck Squamous Cell Carcinomas Mol. Cancer Res., December 1, 2008; 6(12): 1946 - 1956. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Yu, W. K. K. Wu, Z. J. Li, H. P. S. Wong, E. K. K. Tai, H. T. Li, Y. C. Wu, and C. H. Cho E Series of Prostaglandin Receptor 2-Mediated Activation of Extracellular Signal-Regulated Kinase/Activator Protein-1 Signaling Is Required for the Mitogenic Action of Prostaglandin E2 in Esophageal Squamous-Cell Carcinoma J. Pharmacol. Exp. Ther., October 1, 2008; 327(1): 258 - 267. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Dubinett,, J. T. Mao, and S. Hazra Focusing Downstream in Lung Cancer Prevention: 15-Hydroxyprostaglandin Dehydrogenase Cancer Prevention Research, September 1, 2008; 1(4): 223 - 225. [Full Text] [PDF] |
||||
![]() |
M. J. Fidler, A. Argiris, J. D. Patel, D. H. Johnson, A. Sandler, V. M. Villaflor, J. Coon IV, L. Buckingham, K. Kaiser, S. Basu, et al. The Potential Predictive Value of Cyclooxygenase-2 Expression and Increased Risk of Gastrointestinal Hemorrhage in Advanced Non-Small Cell Lung Cancer Patients Treated with Erlotinib and Celecoxib Clin. Cancer Res., April 1, 2008; 14(7): 2088 - 2094. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Hatazawa, A. Tanaka, M. Tanigami, K. Amagase, S. Kato, Y. Ashida, and K. Takeuchi Cyclooxygenase-2/prostaglandin E2 accelerates the healing of gastric ulcers via EP4 receptors Am J Physiol Gastrointest Liver Physiol, October 1, 2007; 293(4): G788 - G797. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Meisdalen, O. F. Dajani, T. Christoffersen, and D. Sandnes Prostaglandins Enhance Epidermal Growth Factor-Induced DNA Synthesis in Hepatocytes by Stimulation of E Prostanoid 3 and F Prostanoid Receptors J. Pharmacol. Exp. Ther., September 1, 2007; 322(3): 1044 - 1050. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Siegfried, C. T. Gubish, M. E. Rothstein, P. E. Q. de Oliveira, and L. P. Stabile Signaling Pathways Involved in Cyclooxygenase-2 Induction by Hepatocyte Growth Factor in Non Small-Cell Lung Cancer Mol. Pharmacol., September 1, 2007; 72(3): 769 - 779. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Donnini, F. Finetti, R. Solito, E. Terzuoli, A. Sacchetti, L. Morbidelli, P. Patrignani, and M. Ziche EP2 prostanoid receptor promotes squamous cell carcinoma growth through epidermal growth factor receptor transactivation and iNOS and ERK1/2 pathways FASEB J, August 1, 2007; 21(10): 2418 - 2430. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Stasinopoulos, D. R. O'Brien, F. Wildes, K. Glunde, and Z. M. Bhujwalla Silencing of Cyclooxygenase-2 Inhibits Metastasis and Delays Tumor Onset of Poorly Differentiated Metastatic Breast Cancer Cells Mol. Cancer Res., May 1, 2007; 5(5): 435 - 442. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Thomas, N. E. Bhola, Q. Zhang, S. C. Contrucci, A. L. Wentzel, M. L. Freilino, W. E. Gooding, J. M. Siegfried, D. C. Chan, and J. R. Grandis Cross-talk between G Protein-Coupled Receptor and Epidermal Growth Factor Receptor Signaling Pathways Contributes to Growth and Invasion of Head and Neck Squamous Cell Carcinoma Cancer Res., December 15, 2006; 66(24): 11831 - 11839. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yan, J. Li, W. Ouyang, Q. Ma, Y. Hu, D. Zhang, J. Ding, Q. Qu, K. Subbaramaiah, and C. Huang NFAT3 is specifically required for TNF-{alpha}-induced cyclooxygenase-2 (COX-2) expression and transformation of Cl41 cells J. Cell Sci., July 15, 2006; 119(14): 2985 - 2994. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Kelloff, S. M. Lippman, A. J. Dannenberg, C. C. Sigman, H. L. Pearce, B. J. Reid, E. Szabo, V. C. Jordan, M. R. Spitz, G. B. Mills, et al. Progress in Chemoprevention Drug Development: The Promise of Molecular Biomarkers for Prevention of Intraepithelial Neoplasia and Cancer--A Plan to Move Forward Clin. Cancer Res., June 15, 2006; 12(12): 3661 - 3697. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kalyankrishna and J. R. Grandis Epidermal Growth Factor Receptor Biology in Head and Neck Cancer J. Clin. Oncol., June 10, 2006; 24(17): 2666 - 2672. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Reckamp, K. Krysan, J. D. Morrow, G. L. Milne, R. A. Newman, C. Tucker, R. M. Elashoff, S. M. Dubinett, and R. A. Figlin A phase I trial to determine the optimal biological dose of celecoxib when combined with erlotinib in advanced non-small cell lung cancer. Clin. Cancer Res., June 1, 2006; 12(11): 3381 - 3388. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Lippman and J. J. Lee Reducing the "Risk" of Chemoprevention: Defining and Targeting High Risk--2005 AACR Cancer Research and Prevention Foundation Award Lecture. Cancer Res., March 15, 2006; 66(6): 2893 - 2903. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Maione, C. Gridelli, T. Troiani, and F. Ciardiello Combining Targeted Therapies and Drugs with Multiple Targets in the Treatment of NSCLC. Oncologist, March 1, 2006; 11(3): 274 - 284. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |