Cancer Research AACR Membership  Advances in Breast Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shimamura, T.
Right arrow Articles by Shapiro, G. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shimamura, T.
Right arrow Articles by Shapiro, G. I.
[Cancer Research 65, 6401-6408, July 15, 2005]
© 2005 American Association for Cancer Research


Experimental Therapeutics, Molecular Targets, and Chemical Biology

Epidermal Growth Factor Receptors Harboring Kinase Domain Mutations Associate with the Heat Shock Protein 90 Chaperone and Are Destabilized following Exposure to Geldanamycins

Takeshi Shimamura1,3, April M. Lowell1, Jeffrey A. Engelman1,2,3 and Geoffrey I. Shapiro1,3

1 Lowe Center for Thoracic Oncology and Department of Medical Oncology, Dana-Farber Cancer Institute; 2 Division of Signal Transduction, Beth Israel Deaconess Medical Center; and 3 Department of Medicine, Brigham and Women's Hospital and Harvard Medical School, Boston, Massachusetts

Requests for reprints: Geoffrey I. Shapiro, Dana-Farber Cancer Institute, Dana 810A, 44 Binney Street, Boston, MA 02115. Phone: 617-632-4942; Fax: 617-632-1977; E-mail: geoffrey_shapiro{at}dfci.harvard.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Somatic mutations in the kinase domain of the epidermal growth factor receptor (EGFR), including L858R and exon 19 deletions, underlie responsiveness to gefitinib and erlotinib in non–small cell lung cancer (NSCLC). Acquired resistance to these tyrosine kinase inhibitors is in some cases mediated by a second mutation, T790M. Ansamycin antibiotics, such as geldanamycin, potently inhibit heat shock protein 90 (Hsp90), promoting ubiquitin-mediated degradation of oncogenic kinases that require the chaperone for proper conformational folding. Here, we show that L858R and deletion mutant EGFR proteins found in NSCLC interact with the chaperone and are sensitive to degradation following Hsp90 inhibition. In NIH/3T3 cells expressing either wild-type or mutant EGFR, diminution of expression of both L858R and EGFR delL747-S752, P753S occurred following exposure to 50 nmol/L geldanamycin over 24 hours, whereas partial diminution of wild-type EGFR required a minimum of 200 nmol/L drug. In time course experiments, mutant EGFR expression was depleted after only 4 hours of exposure to 1 µmol/L geldanamycin, whereas diminution of wild-type EGFR was less substantial and seen only following 12 hours. Similarly, EGFR proteins in NSCLC cell lines harboring EGFR mutations, including NCI-H1650, NCI-H3255, and NCI-H1975, were also more sensitive to geldanamycin-induced degradation compared with the protein in wild-type cells. Exposure of EGFR-mutant cell lines to geldanamycin induced marked depletion of phospho-Akt and cyclin D1 as well as apoptosis. These data suggest mutational activation of EGFR is associated with dependence on Hsp90 for stability and that Hsp90 inhibition may represent a novel strategy for the treatment of EGFR-mutant NSCLC.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Activating mutations in the kinase domain of the epidermal growth factor receptor (EGFR) occur in ~10% of non–small cell lung cancers (NSCLC) from the United States and in a higher percentage of tumors isolated from Asian populations (13). These mutations are usually small exon 19 deletions, or point mutations, most commonly a replacement of leucine by arginine at codon 858 (L858R) in exon 21. Mutant EGFRs induce oncogenic effects by activating downstream signaling and antiapoptotic pathways, most notably those mediated by signal transducer and activator of transcription (STAT) proteins and Akt (4). Both types of mutation confer sensitivity to the anilinoquinazoline inhibitors of EGFR, gefitinib and erlotinib, likely by repositioning critical residues of the tyrosine kinase domain, stabilizing their interactions with ATP as well as with these ATP-competitive inhibitors (13).

Despite the initial dramatic responses of EGFR-mutant tumors to small-molecule tyrosine kinase inhibitors, resistance universally emerges over time. Acquired resistance has recently been shown to be associated with a second somatic mutation, resulting in a threonine-to-methionine amino acid substitution at position 790 (T790M) of EGFR (5, 6), analogous to the T315I mutation that confers resistance of BCR-ABL to imatinib (7, 8). Therefore, the investigation of second-generation targeted agents for this subset of lung cancers is warranted. This could involve the development of drugs capable of inhibiting EGFR despite the T790M mutation or of drugs targeting downstream phosphatidylinositol 3'-kinase (PI3K) or STAT5 pathways.

An alternative strategy, potentially relevant to NSCLCs harboring EGFR mutations both sensitive and resistant to anilinoquinazoline inhibitors, is to target mutant EGFR for degradation. Many kinases that contribute to deregulated signaling and proliferation in human cancers rely on the heat shock protein 90 (Hsp90) chaperone for conformational maturation (9). Hsp90 is a member of the heat shock protein/chaperone family, a family that assists in the folding of newly synthesized proteins in the cell as well as in protein refolding after environmental insults (10). Some of the kinases dependent on Hsp90 for maturation and stability include the HER2 (ErbB2) and c-met receptor tyrosine kinases, the v-Src family of non–receptor tyrosine kinases, and the serine/threonine kinases Raf1, Akt, and cyclin-dependent kinase 4 (cdk4; ref. 11). Benzoquinoid ansamycins, including herbimycin A and geldanamycin, bind to a conserved pocket in the Hsp90 chaperone (12) and prevent its association with client proteins, causing them to undergo ubiquitin-mediated proteasomal degradation (13). For example, in many NSCLCs as in other tumor types, we have shown that depletion of cdk4 by geldanamycin contributes to retinoblastoma (Rb)–dependent G1 arrest and cytostatic effects on tumor cell growth (1416). In BRAF, mutation confers greater dependence on the chaperone for proper folding, such that mutant proteins are more sensitive than wild-type to degradation following exposure to Hsp90 inhibitors (17). In addition, BCR-ABL is degraded after Hsp90 inhibition; importantly, imatinib-resistant BCR-ABL point mutants remain sensitive to Hsp90 inhibitors (18).

HER2 and wild-type EGFR respond very differently to geldanamycin. Hsp90 can be found in HER2 immunoprecipitates, indicating that HER2 is associated with the chaperone (19). Following exposure to geldanamycin, HER2 is depleted within 4 hours from SKBR3 HER2-overexpressing breast cancer cells. However, coprecipitation experiments have not revealed an association of EGFR with Hsp90. Exposure of EGFR-overexpressing A-431 cells to geldanamycin results in a much slower depletion of EGFR, requiring 16 to 20 hours, with a time course identical to that seen following treatment with cyclohexamide (19). These results suggest that the effects of geldanamycin on EGFR are mediated solely by its ability to destabilize newly synthesized protein; once nascent receptors are translocated into the endoplasmic reticulum membrane, addition of Hsp90 inhibitors does not compromise their stability (20). In contrast, the association of mature HER2 receptors with Hsp90, as well as exquisite sensitivity to geldanamycin, is maintained (19, 21). In addition, in contrast to wild-type EGFR, EGFRvIII has been found to associate with Hsp90 (22). This variant, found in glioblastomas (23) and also described in breast and lung carcinomas (24), carries a deletion of exons 2 to 7 causing amino acids 6 to 273 of the extracellular domain to be replaced by a single glycine residue and is relatively resistant to inhibition by gefitinib (25). Expression of EGFRvIII is compromised following exposure of glioblastoma cells to geldanamycin and the chemically unrelated radicicol, which also targets Hsp90 (22).

These observations prompted us to examine the sensitivity to geldanamycin of EGFRs harboring mutations in the kinase domain recently identified in NSCLC. Here, we show that receptors carrying the E746-A750 deletion or the L858R point mutation with or without the secondary T790M mutation associate with Hsp90 and are rapidly depleted from EGFR-mutant NSCLC cell lines, resulting in apoptosis. Because the mutational activation of EGFR is associated with dependence on Hsp90 for maintenance of stability, the use of geldanamycin derivatives may represent a promising strategy for the treatment of EGFR-mutant NSCLC.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Tumor cell lines. NCI-H1650, NCI-H1975, NCI-H1666, Calu-1, A549, NCI-H520, NCI-H441, and NCI-H358 NSCLC cell lines and A-431 epidermoid carcinoma cells were obtained from the American Type Culture Collection (Rockville, MD). All cell lines were maintained in the cell growth medium specified by American Type Culture Collection. NCI-H3255 cells (2, 26) were supplied by Drs. Bruce Johnson and Pasi Jänne (Dana-Farber Cancer Institute, Boston, MA) and grown in ACL-4 medium supplemented with 10% fetal bovine serum and penicillin-streptomycin.

Epidermal growth factor receptor constructs and NIH/3T3 cells. Human EGFR was cloned into pDNR-Dual (BD Biosciences, Mountain View, CA). Two mutants were constructed according to Quick Change Site-Directed Mutagenesis (Stratagene, La Jolla, CA). The L858R mutation was constructed using the following oligonucleotides: sense CACAGATTTTGGGCGGGCCAAACTGCTGGG and antisense CCCAGCAGTTTGGCCCGCCCAAAATCTGTG. The deletion mutant {Delta}L747-S752del, P753S was constructed using the following oligonucleotides: sense CCGTCGCTATCAAGGAATCGAAAGCCAACAAGGAAA and antisense TTTCCTTGTTGGCTTTCGATTCCTTGATAGCGACGG. The introduction of mutation was confirmed by DNA sequencing. All constructs [including green fluorescent protein (GFP)] were shuttled into the retroviral vector, JP1520, using the BD Creator System (BD Biosciences). NIH/3T3 cells were infected with retrovirus according to standard protocols as described previously (27, 28).

Drug treatment. Stock solutions of geldanamycin and 17-dimethylaminoethylamino-17-demethoxygeldanamycin (17DMAG) were prepared in DMSO at a concentration of 10 mmol/L and maintained at –20°C. Drugs were diluted to 1 mmol/L in DMSO for a working solution and used at concentrations ranging from 50 to 1,000 nmol/L. Geldanamycin was provided by the Drug Synthesis and Chemistry Branch, Developmental Therapeutics Program, Division of Cancer Treatment and Diagnosis, National Cancer Institute (Bethesda, MD). 17DMAG was obtained from Invivogen (San Diego, CA).

Western blot analysis. Whole-cell lysates were prepared in NP40 lysis buffer [50 mmol/L Tris-HCl (pH 7.4), 150 mmol/L NaCl, 1% NP40] supplemented with protease and phosphatase inhibitor I and II cocktails (Calbiochem, San Diego, CA) and clarified by centrifugation. Protein concentrations were determined using the Bicinchoninic Acid Protein Assay kit (Pierce, Rockford, IL) and equivalent amounts (40 µg) were subjected to SDS-PAGE on 12% gels, except where indicated. Western blotting was done as described previously (29). Anti-EGFR, phospho-EGFR (Tyr1068), Akt, extracellular signal-regulated kinase 1/2 (Erk1/2; p42/p44 mitogen-activated protein kinase), phospho-Akt (Ser473), and phospho-Erk (Thr202/Tyr204) antibodies were purchased from Cell Signaling Technology (Beverly, MA). Anti-c-Raf (C-12) and cdk4 (C-22) antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA). The anti–cyclin D1 antibody (DCS-6) was from EMD Biosciences (San Diego, CA). The anti-Hsp90 antibody was from Stressgen (Victoria, British Columbia, Canada). Anti-{alpha}-tubulin (clone DM 1A) and the anti-RasGAP antibodies, used as equal loading controls, were purchased from Sigma-Aldrich Co. (St. Louis, MO) and from Upstate Biotechnology (Lake Placid, NY), respectively.

Immunoprecipitation. For the detection of EGFR and Hsp90 complexes, whole-cell lysate (1 mg) in NP40 lysis buffer was incubated with Agarose A/G Plus preconjugated with anti-EGFR rabbit IgG (SC-3, Santa Cruz Biotechnology). Immunoprecipitates were washed in NP40 lysis buffer, boiled in sample buffer, and subjected to SDS-PAGE followed by Western blotting using an anti-Hsp90 antibody to detect complex formation. Recovery of EGFR was monitored by Western blotting.

Cell proliferation assay. Cells (5 x 103 per well) were seeded on 96-well plates and allowed to grow in appropriate growth medium in the presence or absence of drug for 72 hours. Cell metabolic activity was determined every 24 hours by using the CCK-8 (Dojindo, Gaithersburg, MD) colorimetric assay according to the manufacturer's instructions. Results directly correlated with viable cell number as determined by trypan blue exclusion. Error bars represent the SE generated over three experiments in which each condition was assayed in triplicate.

Fluorescence-activated cell sorting analysis. Cell cycle analysis was done as described previously (29). Nonadherent and adherent cells were combined. Following fixation and treatment in 500 µg/mL RNase A, cells were resuspended in 69 µmol/L propidium iodide (1 mL) in 30 mmol/L sodium citrate. Cells were analyzed for DNA content by flow cytometry using the ModFit program (Verity Software House, Topsham, ME).

Detection of apoptosis by flow cytometry. A fluorescein apoptosis detection kit was used (Promega, Madison, WI) as described previously (29). Nonadherent and adherent cells were combined. Following formaldehyde and ethanol fixation, cells were incubated with fluorescein-12 dUTP in the absence or presence of terminal deoxynucleotidyl transferase (TdT). Following washes prescribed in the manufacturer's instructions, cells were resuspended in PBS containing 5 µg/mL propidium iodide and 500 µg/mL RNase A. Cells were analyzed for DNA content and apoptosis using two-color flow cytometry. Apoptosis was quantitated as the percent of cells shifting to fluorescein positivity in the presence of TdT. Error bars represent the SE generated over a minimum of three independent experiments.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mutant epidermal growth factor receptors are more sensitive than wild-type to heat shock protein 90 inhibition mediated by geldanamycins. To determine whether mutant EGFR proteins are more sensitive than wild-type to Hsp90 inhibition, we used NIH/3T3 cells engineered to constitutively express wild-type EGFR, EGFR with the L858R point mutation, or EGFR harboring the L747-S752, P753S exon 19 deletion. As shown in Fig. 1A, similar levels of exogenous EGFR are expressed in these cell lines. In addition, levels of Hsp90 are comparable in cells expressing empty vector (GFP) and in those expressing either wild-type or mutant EGFR proteins. Known client proteins of Hsp90, including c-Raf and Akt, are similarly depleted in these cell lines in a concentration-dependent manner following 24-hour exposure to geldanamycin. However, wild-type and mutant EGFRs behave differently in response to geldanamycin. Although the expression of wild-type EGFR is compromised, its levels remain high even after exposure to 200 nmol/L drug. In contrast, substantial depletion of mutant EGFR expression is evident following treatment with 50 nmol/L geldanamycin and is undetectable after 24-hour exposure to 200 nmol/L drug. These results were confirmed with 17DMAG, a geldanamycin derivative suitable for clinical use (Fig. 1B).



View larger version (78K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Mutant EGFRs are more readily depleted than wild-type EGFR following Hsp90 inhibition by geldanamycins. A, control cells (JP1520) and NIH/3T3 cells constitutively expressing wild-type or mutant EGFR were treated with the indicated concentrations of geldanamycin for 24 hours. Lysates were subjected to Western blotting with the indicated antibodies, showing that mutant EGFRs are more sensitive to geldanamycin treatment than wild-type EGFR, whereas c-Raf and Akt respond similarly in these cell lines. B, similar experiment with 17DMAG, confirming the results with geldanamycin.

 
To further investigate the differences between mutant and wild-type EGFRs, time course experiments were done. In the experiment shown in Fig. 2, cells were exposed to 1 µmol/L geldanamycin for up to 12 hours, and levels of expression were determined at 2-hour intervals. Again, across these cell lines, known clients of Hsp90, including Akt and cdk4, were equally diminished in a time-dependent manner. Partial diminution of wild-type protein was evident by 10 hours, consistent with the slow depletion of wild-type protein described previously in A-431 cells exposed to geldanamycin. In contrast, expression of mutant EGFR proteins was decreased >50% by 4 hours and was nearly undetectable by 6 hours, consistent with greater sensitivity to the disruption of chaperone function.



View larger version (13K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Time course of mutant and wild-type EGFR depletion following geldanamycin-mediated Hsp90 inhibition in engineered NIH/3T3 cells. Control cells (JP1520) and NIH/3T3 cells expressing wild-type or mutant EGFR were treated with 1 µmol/L geldanamycin for the indicated times. Lysates were subjected to Western blotting with the indicated antibodies, showing the more abrupt depletion of mutant EGFR compared with wild-type EGFR or other Hsp90 client proteins in these cells.

 
Mutant epidermal growth factor receptors in non–small cell lung cancer cell lines are more sensitive to degradation than wild-type epidermal growth factor receptor following geldanamycin-mediated heat shock protein 90 inhibition. We next extended our results to NSCLC cell lines. In this analysis, we used NCI-H1650 (del E746-A750), NCI-H3255 (L858R), and NCI-H1975 (L858R + T790M), whereas other cell lines analyzed expressed wild-type EGFR. Cell lines expressed similar levels of Hsp90. At the concentrations of geldanamycin used, known Hsp90 client proteins, including c-Raf (Fig. 3), cdk4, and Akt (Fig. 4), were depleted similarly, with the exception of cdk4 in A549 cells (data not shown). These results suggest that drug uptake was similar among these cell lines. As was the case in engineered NIH/3T3 cells, mutant EGFR was depleted from NCI-H1650, NCI-H3255, and NCI-H1975 cells following exposure to 50 nmol/L geldanamycin, whereas wild-type EGFR expression persisted at concentrations as high as 500 nmol/L drug (Fig. 3A and B). As shown in Fig. 3C, phospho-EGFR was depleted in parallel with total EGFR in the cell lines examined. These data confirm that activating kinase domain mutation is associated with chaperone dependence; in NCI-H1975 cells, chaperone dependence is maintained in the presence of a second mutation conferring EGFR inhibitor resistance.



View larger version (59K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Mutant EGFRs in NSCLC cell lines are more sensitive to degradation than wild-type EGFR following geldanamycin-mediated Hsp90 inhibition. A and B, EGFR-mutant cell lines [NCI-H1650 (del E746-A750), NCI-H3255 (L858R with EGFR amplification), and NCI-H1975 (L858R + T790M)] and EGFR wild-type cell lines (Calu-1 and A549) were treated with the indicated concentrations of geldanamycin (GA) for 24 hours. Lysates were subjected to Western blotting with the indicated antibodies, showing the increased sensitivity of mutant EGFR compared with wild-type EGFR in these cell lines. c-Raf was depleted similarly across these cell lines, suggesting drug uptake did not account for differences in EGFR depletion. C, similar experiment showing the depletion of EGFR phosphorylated at Tyr1068 in parallel with total EGFR. SDS-PAGE was done on an 8% gel to show the phosphorylation of EGFR. NCI-H1666 cells express wild-type EGFR. D, mutant EGFR associates with the Hsp90 chaperone in NSCLC cell lines. Whole-cell extract (1 mg) from the indicated cell lines was incubated with Agarose A/G Plus beads conjugated with anti-EGFR antibody. Immunoprecipitates were subjected to Western blotting with anti-Hsp90 and anti-EGFR antibodies, showing the association of mutant EGFR in complex with Hsp90. A-431 epidermoid carcinoma cells have amplified wild-type EGFR; NCI-H520 cells express very low levels of wild-type EGFR and served as an additional negative control.

 


View larger version (48K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. Rapid depletion of phospho-Akt, phospho-Erk1/2, and cyclin D1 from EGFR-mutant NSCLC cells in response to treatment with geldanamycin. A and B, EGFR-mutant (NCI-H1650, NCI-H3255, and NCI-H1975) and EGFR wild-type (Calu-1 and A549) cell lines were treated with the indicated concentrations of geldanamycin for 24 hours. Lysates were subjected to Western blotting with the indicated antibodies. In wild-type cell lines, Akt is depleted in a concentration-dependent manner. Phospho-Akt is depleted in parallel in A549 cells. In mutant cell lines, phospho-Akt is depleted more completely and at lower concentration than total Akt and correlates with the depletion of mutant EGFR in these cells. Depletion of phospho-Erk1/2 in these cell lines also occurs at low concentration and similarly correlates with depletion of mutant EGFR. C and D, similar experiment showing the depletion of cyclin D1 after exposure to low concentrations of geldanamycin in EGFR-mutant cells compared with the stable levels of cyclin D1 that persist in wild-type NSCLC cell lines (NCI-H441). Cdk4, an Hsp90 target, is similarly depleted from these cell lines.

 
Mutant epidermal growth factor receptor associates with the heat shock protein 90 chaperone. To further corroborate the dependence of EGFR L858R and del E746-A750 on the chaperone, we sought evidence of the association of these mutant proteins with Hsp90. As shown in Fig. 3D, Hsp90 could be detected in immunoprecipitates of EGFR from NCI-H3255, NCI-H1650, and NCI-H1975 cells and only very weakly from A-431 cells. NCI-H520 cells, which express very low levels of wild-type EGFR, were used as an additional negative control. Again, the results with NCI-H1975 cells indicate that association with the chaperone occurs in the presence of the T790M mutation.

Inhibition of downstream phosphorylation of Akt and extracellular signal-regulated kinase 1/2 occurs following geldanamycin-induced depletion of mutant epidermal growth factor receptor in non–small cell lung cancer cell lines. Inhibition of mutant EGFR using anilinoquinazoline inhibitors results in rapid depletion in phospho-Akt and phospho-Erk1/2 (2, 4). To confirm that similar events occur after exposure to geldanamycin, we examined levels of these proteins following treatment (Fig. 4A). As Akt is an Hsp90 client protein, total Akt depletion was observed in both EGFR-mutant and wild-type cells (30, 31). Although phospho-Akt levels paralleled total Akt levels in wild-type cells, phospho-Akt levels were reduced more rapidly than total Akt in EGFR-mutant cell lines (Fig. 4A and B). Therefore, the rapid depletion of phospho-Akt from these cells is most likely a result of depletion of mutant EGFR, which occurs following exposure to similar geldanamycin concentrations rather than a reflection of the less pronounced reduction in total Akt level induced by Hsp90 inhibition. Similarly, phospho-Erk was also rapidly depleted from mutant cell lines, again consistent with the destabilization of EGFR proteins in these cells.

Depletion of cyclin D1 and cyclin-dependent kinase 4 following exposure to geldanamycin in non–small cell lung cancer cell lines. cdk4 is an Hsp90 client (16) that is depleted following exposure to geldanamycins in NSCLC cell lines as well as in other cell types and is associated with Rb-dependent G1 arrest. However, in our previous survey of NSCLC cell lines treated with geldanamycin derivatives, cyclin D1 levels were stable following 24-hour exposure (14). However, in some cellular contexts, cyclin D expression is controlled by a PI3K-Akt dependent pathway (32). We therefore examined whether expression of cyclin D1 was compromised following geldanamycin exposure in EGFR-mutant lines (Fig. 4C). In contrast to effects observed in EGFR wild-type cells, rapid depletion of cyclin D1 occurred in NCI-H3255 and NCI-1975 cells and to a lesser extent in NCI-H1650 cells (Fig. 4C and D).

Geldanamycin induces apoptosis in epidermal growth factor receptor–mutant non–small cell lung cancer cell lines. Cell proliferation assays were done in the variety of EGFR-mutant and wild-type NSCLC cell lines (Fig. 5A). These assays showed a decrease in viable cell number compared with control-treated cells over a 48- to 72-hour exposure. In the majority of wild-type cell lines, this is due to decreased proliferation secondary to cell cycle arrest at the G1-S and G2-M boundaries (Fig. 5B). In contrast, as shown in Fig. 5B and C, apoptosis was evident in EGFR-mutant lines, with the appearance of sub-G1 peak; DNA fragmentation was confirmed by a flow cytometry–based TdT-mediated dUTP nick end labeling (TUNEL) assay, including cell lines exquisitely sensitive (NCI-H3255) or more resistant (NCI-H1975 and NCI-H1650) to anilinoquinazoline inhibitors. Results were confirmed by Western blotting, showing evidence of poly(ADP-ribose) polymerase (PARP) cleavage following geldanamycin treatment in these cells (Fig. 5D).



View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Geldanamycin induces apoptosis in NSCLC cell lines harboring EGFR mutation. A, Cells (5 x 103 per well) were seeded on 96-well plates and grown in the absence or presence of the indicated concentrations of geldanamycin for 72 hours. At 24-hour intervals, dehydrogenase activity was determined using the CCK-8 colorimetric assay. For each cell line, results of a single experiment are shown, in which each determination was done in triplicate. Calu-1, A549, and NCI-H358 express wild-type EGFR. B, A549 and NCI-H3255 cells were treated with 1,000 nmol/L geldanamycin for 48 hours and harvested for flow cytometry. A549 cells, representative of EGFR wild-type cell lines, undergo G1-S and G2-M arrest in response to geldanamycin; NCI-H3255 cells, representative of EGFR-mutant cell lines, show a sub-G1 peak following geldanamycin exposure. C, EGFR wild-type and mutant cell lines were exposed to 500 nmol/L geldanamycin for 72 hours. Cells were harvested and subjected to a flow cytometry–based TUNEL assay. The percentage of cells showing fluorescein shift in the presence of TdT was used to quantitate apoptosis. DNA fragmentation in this assay is readily detected in the three EGFR-mutant cell lines but only to a small degree in several EGFR wild-type cell lines. Columns, average of three experiments; bars, SE. D, EGFR wild-type and mutant cell lines were treated with the indicated concentrations of geldanamycin for 24 hours. Lysates were subjected to Western blotting with an anti-cleaved PARP antibody, confirming apoptosis in response to drug in EGFR-mutant cells.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
EGFR-mutant NSCLCs have shown dramatic responses to the anilinoquinazoline inhibitors, in part related to the altered sensitivity of mutant proteins to these inhibitors. In addition, these responses are likely also related to "oncogene addiction" in which cell death occurs following suppression of an oncogenic signal on which they have become dependent (33). Consistent with the dependence of this subset of lung adenocarcinomas on EGFR, EGFR mutation stimulates PI3K-Akt and STAT pathways that promote cell survival, and small interfering RNA (siRNA)–mediated depletion of EGFR expression in mutant cell lines results in rapid loss of viability and apoptosis (4).

Acquired resistance to the anilinoquinazoline EGFR inhibitors is universal and is in some cases mediated by the development of or selection for a second mutation in EGFR that confers resistance to these drugs. The appearance of such second mutations suggests that the tumor cells remain dependent on an active EGFR pathway for their survival. Indeed, siRNA-mediated depletion of EGFR from NCI-H1975 cells, which contain both the L858R point mutation and the T790M mutation, induces apoptosis, as occurs in mutant cell lines not reported to carry T790M (4).

The emergence of tumor cells resistant to the anilinoquinazoline inhibitors that retain EGFR dependence indicates that alternative strategies targeting EGFR or downstream pathways may have antitumor activity in this lung cancer subtype. Here, we have shown that EGFRs harboring kinase domain mutation interact with the Hsp90 chaperone and are rapidly depleted from cells following Hsp90 inhibition, suggesting that they are dependent on chaperone function for conformational maturation and stability. The depletion of mutants was shown for receptors carrying an exon 19 deletion (NCI-H1650) as well as those carrying the L858R point mutation either with (NCI-H1975) or without (NCI-H3255) the secondary T790M mutation. One subtle difference between these cell lines was in the modulation of Hsp90 levels in response to geldanamycin. Levels were stable to very slightly decreased in NCI-H1650 and NCI-H3255 cells and increased in NCI-H1975 cells as well as in cells expressing wild-type EGFR. Both depletion and induction of Hsp90 have been observed in responsive cell lines (34, 35) and may reflect cell line–specific differences in the ability of drug-bound Hsp90 to be ubiquitinated and degraded. Examination of additional NSCLC cell lines will be required to determine whether Hsp90 expression is routinely more persistent in cells harboring the T790M mutation. Nonetheless, other Hsp90 clients were similarly depleted from the mutant cell lines, and all of the mutant EGFRs were detected in complex with the Hsp90 chaperone. Similar immunoprecipitation Western analysis showed at most a very weak interaction between wild-type EGFR and Hsp90 even in cells with EGFR amplification (A-431), consistent with previously published results (19).

As wild-type EGFR is depleted slowly from cells following geldanamycin-mediated Hsp90 inhibition, it is likely that there is transient association of nascent protein with the chaperone, such that the decreased levels seen over time represent compromised appearance of newly synthesized protein. In contrast, similar to HER2 and other oncogenic kinases, mature mutant EGFR likely maintains interaction and dependence on the chaperone, such that the Hsp90 inhibition leads to rapid degradation and more complete depletion (19). Therefore, Hsp90 function appears essential to maintain high-level expression of mutant EGFR in NSCLC cells.

As EGFRvIII has also been reported to associate with Hsp90 (22), both types of EGFR mutants, containing alterations in either the kinase or the extracellular domain, associate with Hsp90 to a greater degree than wild-type EGFR. The enhanced association of mutant EGFR parallels recent studies showing that mutant BRAF preferentially interacts with Hsp90 compared with the wild-type protein (17). Similarly, constitutively active v-Src also preferentially interacts with Hsp90 compared with normal cellular Src (36). Why kinase mutation confers greater chaperone association and dependence is unclear. Although it is possible that the altered phosphorylation state of the mutant kinases might contribute to such interactions, both tyrosine-phosphorylated and nonphosphorylated HER2 proteins have been shown to have similar sensitivity to Hsp90 inhibition (19). Alternatively, mutation may result in an inherently less stable structure that requires chaperone machinery not only for proper folding but also for the maintenance of stability and ultimately for protein accumulation. Instability of mutant EGFR may account for the frequent association of somatic mutation with increased gene copy number (37).

Although our work has focused on the interaction of mutant EGFRs with Hsp90, Hsp90 does not interact with client proteins on its own but forms complexes with other proteins, some of which have chaperone-like activity. One of these proteins is Cdc37, which promotes the interaction of Hsp90 with protein kinases, including cdk4 and c-Raf (16, 38). EGFRvIII has been shown to physically interact with Cdc37 and it will be of interest to determine whether the same is true for EGFRs harboring kinase domain mutations (22). Cdc37 is able to function as an oncogene, as mouse mammary tumor virus-Cdc37–expressing mice develop mammary tumors, although with long latency, suggesting a requirement for additional genetic events (39). In this regard, it is possible that Cdc37 and mutant EGFR collaborate in the transformation of the bronchial epithelium.

The precise mechanism by which mutant EGFR is degraded also remains to be elucidated. An E3 ubiquitin ligase may be recruited to the mutant EGFR/Hsp90 complex by geldanamycin. Phosphorylation at Tyr1045, the docking site of the c-Cbl E3 ubiquitin ligase, is similar in wild-type and mutant EGFR proteins (4). However, it is possible that the ubiquitin E3 ligase CHIP is involved in a manner analogous to its geldanamycin-mediated recruitment to HER2/Hsp90 complexes (40).

Downstream signaling events in EGFR-mutant NSCLC cells appear analogous to those reported in HER2 amplified breast carcinoma cell lines and are similarly disrupted by geldanamycins. For example, among breast cancer cell lines, those expressing high levels of HER2 are among the most sensitive to Hsp90 inhibition, with antiproliferative effects observed at concentrations of geldanamycin derivatives 10- to 100-fold lower than cells without HER2 overexpression (41). In HER2-overexpressing cells, low nanomolar concentrations of ansamycins induce abrupt degradation of HER2, with concomitant loss of ErbB3-associated PI3K activity, and decreased Akt activity, before the loss of Akt protein, which occurs more slowly in response to drug (42, 43). Disruption of this pathway has been shown to result in rapid loss of cyclin D1 expression (42). Cyclin D1 is required for transformation by HER2 (44, 45), so that a critical effector of HER2-mediated oncogenicity is removed. Hsp90 inhibition also leads to apoptosis in these cells, whereas in low HER2-expressing breast cancer cell lines apoptosis is less prominent and occurs later (41).

Similarly, in NSCLC cell lines sensitive to gefitinib, ErbB3 is used to couple EGFR to the PI3K-Akt pathway (27). Thus, the destabilization of mutant EGFR by geldanamycin likely disrupts EGFR-ErbB3 heterodimers, resulting in rapid depletion of phospho-Akt before the more gradual loss in total Akt that occurs in most cell lines in response to Hsp90 inhibition. Compared with EGFR wild-type cell lines, cyclin D1 expression is abruptly compromised after geldanamycin treatment in EGFR-mutant cells. In addition, apoptosis in response to geldanamycin is readily detected in EGFR-mutant cell lines as assessed by both TUNEL assay and PARP cleavage. Further experiments will be required to determine if the depletion of cyclin D1 and the induction of apoptosis are linked or whether other Akt-dependent pathways are primarily responsible for cell death once EGFR is degraded. Nonetheless, the results raise the possibility that cyclin D1 is critical for transformation mediated by mutant EGFR in a manner similar to that described for HER2. Furthermore, depletion of mutant EGFR and phospho-Akt by geldanamycin may sensitize NSCLC cells to chemotherapy agents, as has been described in breast cancer cells (46) and HER2-overexpressing lung cancer cells (47).

Just as HER2-overexpressing breast cancer cell lines are more sensitive to ansamycins compared with cells expressing low levels of HER2, EGFR-mutant NSCLC cell lines are more susceptible to apoptosis than those expressing wild-type EGFR. The EGFR wild-type cell lines surveyed here undergo cell cycle arrest following geldanamycin; arrest at the G1-S boundary correlates in most cases with loss of cdk4 and cdk6 from these cells followed by induction of Cip/Kip proteins (14). In contrast, the rapid depletion of Akt activity in EGFR-mutant cells compromises their viability.

Nonetheless, our results do not necessarily predict that EGFR mutation will fully govern the response to geldanamycins in NSCLC. Some EGFR wild-type NSCLC may undergo apoptosis in response to ansamycins. For example, cdk4 amplification (48) or BRAF mutation (49, 50) have been shown in ~4% and 3% of NSCLCs, respectively, which may define alternative subsets dependent on these kinases for viability and hence more sensitive to Hsp90 inhibition. Conversely, BRAF mutation, present with highest frequency in malignant melanoma compared with other cancer cell types (51), has not correlated with sensitivity of melanoma cell lines to geldanamycins; in fact, the most sensitive melanoma cell line in a recently reported panel expressed HER2 (35).

Several geldanamycin derivatives are in early-phase human testing, including 17-allylamino-17-demethoxygeldanamycin (17AAG; ref. 52) and 17DMAG. 17AAG is overall well tolerated (53), without the hepatic toxicity that precluded clinical development of geldanamycin itself (54). 17DMAG is water soluble, with excellent bioavailability and tissue distribution shown in preclinical models (55). We have confirmed that 17DMAG causes destabilization of mutant EGFR similar to that induced by parental geldanamycin. The potent disruption of mutant EGFR expression and pharmacologic inhibition of Akt activation by these agents make them attractive for clinical trial in EGFR-mutant–driven NSCLCs.


    Acknowledgments
 
Grant support: Career Development Award as part of the Dana-Farber/Harvard Cancer Center Specialized Programs of Research Excellence in Lung Cancer, NIH grant P20 CA90578 (T. Shimamura).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Kathryn Folz-Donahue and Laura Prickett (Dana-Farber Flow Cytometry Core) for technical assistance.

Received 3/21/05. Revised 5/ 8/05. Accepted 5/11/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Lynch TJ, Bell DW, Sordella R, et al. Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med 2004;350:2129–39.[Abstract/Free Full Text]
  2. Paez JG, Jänne PA, Lee JC, et al. EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy. Science 2004;304:1497–500.
  3. Pao W, Miller V, Zakowski M, et al. EGF receptor gene mutations are common in lung cancers from "never smokers" and are associated with sensitivity of tumors to gefitinib and erlotinib. Proc Natl Acad Sci U S A 2004;101:13306–11.[Abstract/Free Full Text]
  4. Sordella R, Bell DW, Haber DA, Settleman J. Gefitinib-sensitizing EGFR mutations in lung cancer activate anti-apoptotic pathways. Science 2004;305:1163–7.[Abstract/Free Full Text]
  5. Kobayashi S, Boggon TJ, Dayaram T, et al. EGFR mutation and resistance of non-small-cell lung cancer to gefitinib. N Engl J Med 2005;352:786–92.[Abstract/Free Full Text]
  6. Pao W, Miller VA, Politi KA, et al. Acquired resistance of lung adenocarcinomas to gefitinib or erlotinib is associated with a second mutation in the EGFR kinase domain. PLoS Med 2005;2:1–11.
  7. Gorre ME, Mohammed M, Ellwood K, et al. Clinical resistance to STI-571 cancer therapy caused by BCR-ABL gene mutation or amplification. Science 2001;293:876–80.[Abstract/Free Full Text]
  8. Blencke S, Ullrich A, Daub H. Mutation of threonine 766 in the epidermal growth factor receptor reveals a hotspot for resistance formation against selective tyrosine kinase inhibitors. J Biol Chem 2003;278:15435–40.[Abstract/Free Full Text]
  9. Pratt WB. The hsp90-based chaperone system: involvement in signal transduction from a variety of hormone and growth factor receptors. Proc Soc Exp Biol Med 1998;217:420–34.[CrossRef][Medline]
  10. Pearl LH, Prodromou C. Structure and in vivo function of Hsp90. Curr Opin Struct Biol 2000;10:46–51.[CrossRef][Medline]
  11. Workman P. Combinatorial attack on multistep oncogenesis by inhibiting the Hsp90 molecular chaperone. Cancer Lett 2004;206:149–57.[CrossRef][Medline]
  12. Stebbins CE, Russo AA, Schneider C, Rosen N, Hartl FU, Pavletich NP. Crystal structure of an Hsp90-geldanamycin complex: targeting of a protein chaperone by an antitumor agent. Cell 1997;89:239–50.[CrossRef][Medline]
  13. Sepp-Lorenzino L, Ma Z, Lebwohl DE, Vintsky A, Rosen N. Herbimycin A induces the 20S proteasome- and ubiquitin-dependent degradation of receptor tyrosine kinases. J Biol Chem 1995;270:16580–7.[Abstract/Free Full Text]
  14. Jiang J, Shapiro GI. 17-AAG induces Rb-dependent G1 arrest in lung cancer cell lines. Proc Am Assoc Cancer Res 2002;43:A1645.
  15. Srethapakdi M, Liu F, Tavorath R, Rosen N. Inhibition of Hsp90 function by ansamycins causes retinoblastoma gene product-dependent G1 arrest. Cancer Res 2000;60:3940–6.[Abstract/Free Full Text]
  16. Stepanova L, Leng X, Parker SB, Harper JW. Mammalian p50Cdc37 is a protein-kinase targeting subunit of Hsp90 that binds and stabilizes Cdk4. Genes Dev 1996;10:1491–502.[Abstract/Free Full Text]
  17. Grbovic OM, Basso AD, Houghton A, Solit DB, Rosen N. Activated, mutated B-raf protein kinase requires the Hsp90 chaperone protein for folding and stability and is degraded in response to Hsp90 inhibitors. Clin Cancer Res 2003;9:A72.
  18. Gorre ME, Ellwood-Yen K, Chiosis G, Rosen N, Sawyers CL. BCR-ABL point mutants isolated from patients with imatinib mesylate-resistant chronic myeloid leukemia remain sensitive to inhibitors of the BCR-ABL chaperone heat shock protein 90. Blood 2002;100:3041–4.[Abstract/Free Full Text]
  19. Xu W, Mimnaugh E, Rosser MF, et al. Sensitivity of mature ErbB2 to geldanamycin is conferred by its kinase domain and is mediated by the chaperone protein Hsp90. J Biol Chem 2001;276:3702–8.[Abstract/Free Full Text]
  20. Sakagami M, Morrison P, Welch WJ. Benzoquinoid ansamycins (herbimycin A and geldanamycin) interfere with the maturation of growth factor receptor tyrosine kinases. Cell Stress Chaperones 1999;4:19–28.[CrossRef][Medline]
  21. Mimnaugh EG, Chavany C, Neckers L. Polyubiquitination and proteasomal degradation of the p185c-erbB-2 receptor protein-tyrosine kinase induced by geldanamycin. J Biol Chem 1996;271:22796–801.[Abstract/Free Full Text]
  22. Lavictoire SJ, Parolin DA, Klimowicz AC, Kelly JF, Lorimer IA. Interaction of Hsp90 with the nascent form of the mutant epidermal growth factor receptor EGFRvIII. J Biol Chem 2003;278:5292–9.[Abstract/Free Full Text]
  23. Humphrey PA, Wong AJ, Vogelstein B, et al. Anti-synthetic peptide antibody reacting at the fusion junction of deletion-mutant epidermal growth factor receptors in human glioblastoma. Proc Natl Acad Sci U S A 1990;87:4207–11.[Abstract/Free Full Text]
  24. Wikstrand CJ, Hale LP, Batra SK, et al. Monoclonal antibodies against EGFRvIII are tumor specific and react with breast and lung carcinomas and malignant gliomas. Cancer Res 1995;55:3140–8.[Abstract/Free Full Text]
  25. Learn CA, Hartzell TL, Wikstrand CJ, et al. Resistance to tyrosine kinase inhibition by mutant epidermal growth factor receptor variant III contributes to the neoplastic phenotype of glioblastoma multiforme. Clin Cancer Res 2004;10:3216–24.[Abstract/Free Full Text]
  26. Tracy S, Mukohara T, Hansen M, Meyerson M, Johnson BE, Jänne PA. Gefitinib induces apoptosis in the EGFR L858R non-small-cell lung cancer cell line H3255. Cancer Res 2004;64:7241–4.[Abstract/Free Full Text]
  27. Engelman JA, Jänne PA, Mermel C, et al. ErbB-3 mediates phosphoinositide 3'-kinase activity in gefitinib-sensitive non-small cell lung cancer cell lines. Proc Natl Acad Sci U S A 2005;102:3788–93.[Abstract/Free Full Text]
  28. Zhao JJ, Gjoerup OV, Subramanian RR, et al. Human mammary epithelial cell transformation through the activation of phosphatidylinositol 3-kinase. Cancer Cell 2003;3:483–95.[CrossRef][Medline]
  29. Shapiro GI, Koestner DA, Matranga CB, Rollins BJ. Flavopiridol induces cell cycle arrest and p53-independent apoptosis in non-small cell lung cancer cell lines. Clin Cancer Res 1999;5:2925–38.[Abstract/Free Full Text]
  30. Sato S, Fujita N, Tsuruo T. Modulation of Akt kinase activity by binding to Hsp90. Proc Natl Acad Sci U S A 2000;97:10832–7.[Abstract/Free Full Text]
  31. Basso AD, Solit DB, Chiosis G, Giri B, Tsichlis P, Rosen N. Akt forms an intracellular complex with Hsp90 and Cdc37 and is destabilized by inhibitors of Hsp90 function. J Biol Chem 2002;277:39858–66.[Abstract/Free Full Text]
  32. Muise-Helmericks RC, Grimes HL, Bellacosa A, Malstrom SE, Tsichlis PN, Rosen N. Cyclin D expression is controlled post-transcriptionally via a phosphatidylinositol 3-kinase/Akt-dependent pathway. J Biol Chem 1998;273:29864–72.[Abstract/Free Full Text]
  33. Weinstein IB. Addiction to oncogenes—the Achilles heal of cancer. Science 2002;297:63–4.[Free Full Text]
  34. Solit DB, Zheng FF, Drobnjak M, et al. 17-Allylamino-17-demethoxygeldanamycin induces the degradation of androgen receptor and HER-2/neu and inhibits the growth of prostate cancer xenografts. Clin Cancer Res 2002;8:986–93.[Abstract/Free Full Text]
  35. Smith V, Sausville EA, Camalier RF, Fiebig HH, Burger AM. Comparison of 17-dimethylaminoethylamino-17-demethoxy-geldanamycin (17DMAG) and 17-allylamino-17-demethoxygeldanamycin (17AAG) in vitro: effects on Hsp90 and client proteins in melanoma models. Cancer Chemother Pharmacol. In press 2005.
  36. Xu Y, Singer MA, Lindquist S. Maturation of the tyrosine kinase c-src as a kinase and as a substrate depends on the molecular chaperone Hsp90. Proc Natl Acad Sci U S A 1999;96:109–14.[Abstract/Free Full Text]
  37. Amann J, Kalyankrishna S, Massion PP, et al. Aberrant epidermal growth factor receptor signaling and enhanced sensitivity to EGFR inhibitors in lung cancer. Cancer Res 2005;65:226–35.[Abstract/Free Full Text]
  38. Silverstein AM, Grammatikakis N, Cochran BH, Chinkers M, Pratt WB. p50(cdc37) binds directly to the catalytic domain of Raf as well as to a site on hsp90 that is topologically adjacent to the tetratricopeptide repeat binding site. J Biol Chem 1998;273:20090–5.[Abstract/Free Full Text]
  39. Stepanova L, Finegold M, DeMayo F, Schmidt EV, Harper JW. The oncoprotein kinase chaperone CDC37 functions as an oncogene in mice and collaborates with both c-myc and cyclin D1 in transformation of multiple tissues. Mol Cell Biol 2000;20:4462–73.[Abstract/Free Full Text]
  40. Xu W, Marcu M, Yuan X, Mimnaugh E, Patterson C, Neckers L. Chaperone-dependent E3 ubiquitin ligase CHIP mediates a degradative pathway for c-ErbB2/Neu. Proc Natl Acad Sci U S A 2002;99:12847–52.[Abstract/Free Full Text]
  41. Munster PN, Marchion D, Basso A, Rosen N. Degradation of HER2 by ansamycins induces growth arrest and apoptosis in cells with HER2 overexpression via a HER3, phosphatidylinositol 3'-kinase-AKT-dependent pathway. Cancer Res 2002;62:3132–7.[Abstract/Free Full Text]
  42. Basso AD, Solit DB, Munster PN, Rosen N. Ansamycin antibiotics inhibit Akt activation and cyclin D expression in breast cancer cells that overexpress HER2. Oncogene 2002;21:1159–66.[CrossRef][Medline]
  43. Xu W, Yuan X, Jung YJ, et al. The heat shock protein 90 inhibitor geldanamycin and the ErbB inhibitor ZD1839 promote rapid PP1 phosphatase-dependent inactivation of AKT in ErbB2 overexpressing breast cancer cells. Cancer Res 2003;63:7777–84.[Abstract/Free Full Text]
  44. Lee RJ, Albanese C, Fu M, et al. Cyclin D1 is required for transformation by activated Neu and is induced through an E2F-dependent signaling pathway. Mol Cell Biol 2000;20:672–83.[Abstract/Free Full Text]
  45. Yu Q, Geng Y, Sicinski P. Specific protection against breast cancers by cyclin D1 ablation. Nature 2001;411:1017–21.[CrossRef][Medline]
  46. Munster PN, Basso A, Solit D, Norton L, Rosen N. Modulation of Hsp90 function by ansamycins sensitizes breast cancer cells to chemotherapy-induced apoptosis in an RB- and schedule-dependent manner. Clin Cancer Res 2001;7:2228–36.[Abstract/Free Full Text]
  47. Nguyen DM, Chen A, Mixon A, Schrump DS. Sequence-dependent enhancement of paclitaxel toxicity in non-small cell lung cancer by 17-allylamino 17-demethoxygeldanamycin. J Thorac Cardiovasc Surg 1999;118:908–15.[Abstract/Free Full Text]
  48. Wikman H, Nymark P, Vayrynen A, et al. CDK4 is a probable target gene in a novel amplicon at 12q13.3-q14.1 in lung cancer. Genes Chromosomes Cancer 2005;42:193–9.[CrossRef][Medline]
  49. Brose MS, Volpe P, Feldman M, et al. BRAF and RAS mutations in human lung cancer and melanoma. Cancer Res 2002;62:6997–7000.[Abstract/Free Full Text]
  50. Naoki K, Chen TH, Richards WG, Sugarbaker DJ, Meyerson M. Missense mutations of the BRAF gene in human lung adenocarcinoma. Cancer Res 2002;62:7001–3.[Abstract/Free Full Text]
  51. Davies H, Bignell GR, Cox C, et al. Mutations of the BRAF gene in human cancer. Nature 2002;417:949–54.[CrossRef][Medline]
  52. Hostein I, Robertson D, DiStefano F, Workman P, Clarke PA. Inhibition of signal transduction by the Hsp90 inhibitor 17-allylamino-17-demethoxygeldanamycin results in cytostasis and apoptosis. Cancer Res 2001;61:4003–9.[Abstract/Free Full Text]
  53. Goetz MP, Toft D, Reid J, et al. Phase I trial of 17-allylamino-17-demethoxygeldanamycin in patients with advanced cancer. J Clin Oncol 2005;23:1078–87.[Abstract/Free Full Text]
  54. Supko JG, Hickman RL, Grever MR, Malspeis L. Preclinical pharmacologic evaluation of geldanamycin as an antitumor agent. Cancer Chemother Pharmacol 1995;36:305–15.[Medline]
  55. Egorin MJ, Lagattuta TF, Hamburger DR, et al. Pharmacokinetics, tissue distribution, and metabolism of 17-(dimethylaminoethylamino)-17-demethoxygeldanamycin (NSC 707545) in CD2F1 mice and Fischer 344 rats. Cancer Chemother Pharmacol 2002;49:7–19.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Anticancer ResHome page
C. MOSER, S. A. LANG, and O. STOELTZING
Heat-shock Protein 90 (Hsp90) as a Molecular Target for Therapy of Gastrointestinal Cancer
Anticancer Res, June 1, 2009; 29(6): 2031 - 2042.
[Abstract] [Full Text] [PDF]


Home page
Anticancer ResHome page
F. KOGA, K. KIHARA, and L. NECKERS
Inhibition of Cancer Invasion and Metastasis by Targeting the Molecular Chaperone Heat-shock Protein 90
Anticancer Res, March 1, 2009; 29(3): 797 - 807.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
U. Banerji
Heat Shock Protein 90 as a Drug Target: Some Like It Hot
Clin. Cancer Res., January 1, 2009; 15(1): 9 - 14.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Shimamura, D. Li, H. Ji, H. J. Haringsma, E. Liniker, C. L. Borgman, A. M. Lowell, Y. Minami, K. McNamara, S. A. Perera, et al.
Hsp90 Inhibition Suppresses Mutant EGFR-T790M Signaling and Overcomes Kinase Inhibitor Resistance
Cancer Res., July 15, 2008; 68(14): 5827 - 5838.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. A. Engelman and P. A. Janne
Mechanisms of Acquired Resistance to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Non-Small Cell Lung Cancer
Clin. Cancer Res., May 15, 2008; 14(10): 2895 - 2899.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. L. Holmes, S. Y. Sharp, S. Hobbs, and P. Workman
Silencing of HSP90 Cochaperone AHA1 Expression Decreases Client Protein Activation and Increases Cellular Sensitivity to the HSP90 Inhibitor 17-Allylamino-17-Demethoxygeldanamycin
Cancer Res., February 15, 2008; 68(4): 1188 - 1197.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Sawai, S. Chandarlapaty, H. Greulich, M. Gonen, Q. Ye, C. L. Arteaga, W. Sellers, N. Rosen, and D. B. Solit
Inhibition of Hsp90 Down-regulates Mutant Epidermal Growth Factor Receptor (EGFR) Expression and Sensitizes EGFR Mutant Tumors to Paclitaxel
Cancer Res., January 15, 2008; 68(2): 589 - 596.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. Chandarlapaty, A. Sawai, Q. Ye, A. Scott, M. Silinski, K. Huang, P. Fadden, J. Partdrige, S. Hall, P. Steed, et al.
SNX2112, a Synthetic Heat Shock Protein 90 Inhibitor, Has Potent Antitumor Activity against HER Kinase Dependent Cancers
Clin. Cancer Res., January 1, 2008; 14(1): 240 - 248.
[Abstract] [Full Text] [PDF]


Home page
Am Soc Clin Oncol Ed BookHome page
P. A. Bunn Jr., E. B. Haura, and J. V. Heymach
Emerging Therapies for Non-small Cell Lung Cancer
ASCO Educational Book, January 1, 2008; 2008(1): e5 - e14.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
C. Moser, S. A. Lang, S. Kainz, A. Gaumann, S. Fichtner-Feigl, G. E. Koehl, H. J. Schlitt, E. K. Geissler, and O. Stoeltzing
Blocking heat shock protein-90 inhibits the invasive properties and hepatic growth of human colon cancer cells and improves the efficacy of oxaliplatin in p53-deficient colon cancer tumors in vivo
Mol. Cancer Ther., November 1, 2007; 6(11): 2868 - 2878.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
X. Li, L. Shen, J. Zhang, J. Su, L. Shen, X. Liu, H. Han, W. Han, and L. Yao
Degradation of HER2 by Cbl-Based Chimeric Ubiquitin Ligases
Cancer Res., September 15, 2007; 67(18): 8716 - 8724.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
A. Edwards, J. Li, P. Atadja, K. Bhalla, and E. B. Haura
Effect of the histone deacetylase inhibitor LBH589 against epidermal growth factor receptor dependent human lung cancer cells
Mol. Cancer Ther., September 1, 2007; 6(9): 2515 - 2524.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
G. J. Riely, M. G. Kris, B. Zhao, T. Akhurst, D. T. Milton, E. Moore, L. Tyson, W. Pao, N. A. Rizvi, L. H. Schwartz, et al.
Prospective Assessment of Discontinuation and Reinitiation of Erlotinib or Gefitinib in Patients with Acquired Resistance to Erlotinib or Gefitinib Followed by the Addition of Everolimus
Clin. Cancer Res., September 1, 2007; 13(17): 5150 - 5155.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. Padron, M. Sato, J. W. Shay, A. F. Gazdar, J. D. Minna, and M. G. Roth
Epidermal Growth Factor Receptors with Tyrosine Kinase Domain Mutations Exhibit Reduced Cbl Association, Poor Ubiquitylation, and Down-regulation but Are Efficiently Internalized
Cancer Res., August 15, 2007; 67(16): 7695 - 7702.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. de La Motte Rouge, L. Galluzzi, K. A. Olaussen, Y. Zermati, E. Tasdemir, T. Robert, H. Ripoche, V. Lazar, P. Dessen, F. Harper, et al.
A Novel Epidermal Growth Factor Receptor Inhibitor Promotes Apoptosis in Non-Small Cell Lung Cancer Cells Resistant to Erlotinib
Cancer Res., July 1, 2007; 67(13): 6253 - 6262.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
W. Xu and L. Neckers
Targeting the Molecular Chaperone Heat Shock Protein 90 Provides a Multifaceted Effect on Diverse Cell Signaling Pathways of Cancer Cells
Clin. Cancer Res., March 15, 2007; 13(6): 1625 - 1629.
[Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
S. A. Lang, D. Klein, C. Moser, A. Gaumann, G. Glockzin, M. H. Dahlke, W. Dietmaier, U. Bolder, H. J. Schlitt, E. K. Geissler, et al.
Inhibition of heat shock protein 90 impairs epidermal growth factor-mediated signaling in gastric cancer cells and reduces tumor growth and vascularization in vivo
Mol. Cancer Ther., March 1, 2007; 6(3): 1123 - 1132.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Matei, M. Satpathy, L. Cao, Y.-C. Lai, H. Nakshatri, and D. B. Donner
The Platelet-derived Growth Factor Receptor {alpha} Is Destabilized by Geldanamycins in Cancer Cells
J. Biol. Chem., January 5, 2007; 282(1): 445 - 453.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Perez-Torres, M. Guix, A. Gonzalez, and C. L. Arteaga
Epidermal Growth Factor Receptor (EGFR) Antibody Down-regulates Mutant Receptors and Inhibits Tumors Expressing EGFR Mutations
J. Biol. Chem., December 29, 2006; 281(52): 40183 - 40192.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
G. J. Riely, K. A. Politi, V. A. Miller, and W. Pao
Update on Epidermal Growth Factor Receptor Mutations in Non-Small Cell Lung Cancer
Clin. Cancer Res., December 15, 2006; 12(24): 7232 - 7241.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Kobayashi, T. Shimamura, S. Monti, U. Steidl, C. J. Hetherington, A. M. Lowell, T. Golub, M. Meyerson, D. G. Tenen, G. I. Shapiro, et al.
Transcriptional Profiling Identifies Cyclin D1 as a Critical Downstream Effector of Mutant Epidermal Growth Factor Receptor Signaling
Cancer Res., December 1, 2006; 66(23): 11389 - 11398.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. N. Balak, Y. Gong, G. J. Riely, R. Somwar, A. R. Li, M. F. Zakowski, A. Chiang, G. Yang, O. Ouerfelli, M. G. Kris, et al.
Novel D761Y and Common Secondary T790M Mutations in Epidermal Growth Factor Receptor-Mutant Lung Adenocarcinomas with Acquired Resistance to Kinase Inhibitors.
Clin. Cancer Res., November 1, 2006; 12(21): 6494 - 6501.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
E. G. Mimnaugh, W. Xu, M. Vos, X. Yuan, and L. Neckers
Endoplasmic Reticulum Vacuolization and Valosin-Containing Protein Relocalization Result from Simultaneous Hsp90 Inhibition by Geldanamycin and Proteasome Inhibition by Velcade
Mol. Cancer Res., September 1, 2006; 4(9): 667 - 681.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Germano, D. Barberis, M. M. Santoro, L. Penengo, A. Citri, Y. Yarden, and G. Gaudino
Geldanamycins Trigger a Novel Ron Degradative Pathway, Hampering Oncogenic Signaling
J. Biol. Chem., August 4, 2006; 281(31): 21710 - 21719.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Yang, S. Qu, M. Perez-Tores, A. Sawai, N. Rosen, D. B. Solit, and C. L. Arteaga
Association with HSP90 Inhibits Cbl-Mediated Down-regulation of Mutant Epidermal Growth Factor Receptors.
Cancer Res., July 15, 2006; 66(14): 6990 - 6997.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Shimamura, H. Ji, Y. Minami, R. K. Thomas, A. M. Lowell, K. Shah, H. Greulich, K. A. Glatt, M. Meyerson, G. I. Shapiro, et al.
Non-Small-Cell Lung Cancer and Ba/F3 Transformed Cells Harboring the ERBB2 G776insV_G/C Mutation Are Sensitive to the Dual-Specific Epidermal Growth Factor Receptor and ERBB2 Inhibitor HKI-272.
Cancer Res., July 1, 2006; 66(13): 6487 - 6491.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shimamura, T.
Right arrow Articles by Shapiro, G. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shimamura, T.
Right arrow Articles by Shapiro, G. I.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online