
[Cancer Research 65, 6521-6525, August 1, 2005]
© 2005 American Association for Cancer Research
AF4p12, a Human Homologue to the furry Gene of Drosophila, as a Novel MLL Fusion Partner
Sandrine Hayette1,
Pascale Cornillet-Lefebvre3,
Isabelle Tigaud1,
Stéphanie Struski3,
Stéphanie Forissier2,
Adrien Berchet2,
Diane Doll2,
Lucile Gillot3,
Wajih Brahim4,
Eric Delabesse4,
Jean-Pierre Magaud1 and
Ruth Rimokh2
1 Laboratoire d'Hématologie et de Cytogénétique, Centre Hospitalier Lyon Sud and EA 3737, Pierre-Benite, France; 2 Institut National de la Sante et de la Recherche Medicale U590, Centre Léon Bérard, Université Claude Bernard Lyon I, Lyon, France; 3 Laboratoire d'Hématologie, CHU Robert Debré, Reims, France; and 4 Département d'Hématologie, Université Paris V René Descartes, Hôpital Necker, and Institut National de la Sante et de la Recherche Medicale EMI02.10, Paris, France
Requests for reprints: Ruth Rimokh, Institut National de la Sante et de la Recherche Medicale U590, Centre Léon Bérard, 69373 Lyon Cedex 08, France. Phone: 330-478-78-29-03; Fax: 330-478-78-27-20; E-mail: rimokh{at}lyon.fnclcc.fr, & Sandrine Hayette, Laboratoire d' Hématologie et de Cytogénétique, Centre Hospitalier Lyon Sud, 69495 Pierre-Bénite, France. Phone: 33-478-86-41-07; Fax: 33-478-86-41-04; E-mail: sandrine.hayette{at}chu-lyon.fr.
 |
Abstract
|
|---|
More than 35 different partner genes with the mixed lineage leukemia (MLL) gene have been cloned from leukemia cells with translocations involving chromosome 11 band q23. In this study, we report on a novel fusion partner of the MLL gene, AF4p12, which we have identified as the human homologue to the furry gene of Drosophila. AF4p12, highly conserved in evolution, encodes a large protein of 3,105 amino acids. The expression of AF4p12 has been preferentially detected in colon, placenta, and brain tissues and in tumor cells of lymphoid origin. We show that the t(4;11)(p12;q23) translocation results in the creation of a chimeric RNA encoding a putative fusion protein containing 1,362 amino acids from the NH2-terminal part of MLL and 712 amino acids from the COOH-terminal part of AF4p12. FLT3 and HOXA9 genes are overexpressed in this leukemia. We found that the COOH-terminal part of AF4p12 fused to MLL contains a leucine zipper motif and exhibits transcriptional activation properties when fused to Gal4 DNA-binding domains in transient transfection assays. The AF4p12 fragment fused to MLL may contribute to the oncogenic activation of MLL, possibly through specific recruitment of the transcriptional machinery.
 |
Introduction
|
|---|
11q23 abnormalities involving the mixed lineage leukemia (MLL) gene are found in a variety of hematologic malignancies including acute lymphoblastic leukemia (ALL), acute myeloid leukemia, and cases of myelodysplastic syndromes (1). Recently, we have shown that the involvement of the MLL gene is also recurrent in T-cell ALL, with an incidence of more than 8% (2). This rearrangement is also found in patients with therapy-related leukemia induced by topoisomerase-inhibiting epipodophyllotoxins. MLL, a histone methyltransferase protein, has been reported to assemble a supercomplex of several chromatin-modifying components. This transcriptional regulator is required for normal hematopoiesis and implicated in the maintenance of Hox gene expression (3). The most remarkable feature of MLL in leukemias is the diversity of its fusion partners. More than 35 MLL partner genes have been cloned from leukemia cells with various types of 11q23 translocations (1). These translocations result in the creation of fusion genes that encode chimeric proteins harboring the NH2-terminal amino acids of MLL and the COOH-terminal amino acids of its partner protein. The chimeric proteins localize in the nucleus and exhibit transforming activity. The partner proteins, which share no distinct common sequence motif and are functionally diverse, may arise from either nuclear or cytoplasmic origin (4). It has been shown that the acquisition of heterologous transcriptional effector or homo-oligomerization domains may be the mechanism that enables the oncogenic conversion of MLL, which supports the major role of fusion partners (3, 5). Furthermore, MLL translocations specify a distinct gene expression profile in leukemias (6). Although the dysregulation of Hox gene family members is the dominant mechanism in leukemic transformation induced by chimeric proteins, some oncogenic targets (such as the FLT3 gene) could be specific to particular lineages (7).
In the present study, we have identified the AF4p12 gene, a human homologue to the furry gene of Drosophila, as a novel fusion partner of the MLL gene in a patient with treatment-related ALL with t(4;11)(p12;q23) translocation.
 |
Materials and Methods
|
|---|
Patient. A 67-year-old female was diagnosed in 2001 as having therapy-related ALL. This patient had been diagnosed in 1996 with a breast adenocarcinoma treated with 5-fluorouracil, mitoxantrone, cyclophosphamide, and radiotherapy, and in 2000 with an endometrial carcinoma treated with radiotherapy. At diagnosis, her WBC count was 262 109/L with 97% lymphoblasts. Leukemic cells expressed CD19, CD20, CD79a, CD13, CD38, and HLADR but not CD34. Cytogenetic analysis was done at the time of diagnosis. The karyotype of bone marrow cells showed 46, XX, t(4;11)(p12;q23) [53]/46,XX [2]. The patient died 1 month after ALL diagnosis without responding to chemotherapy.
Culture conditions. The nonhematopoietic cell lines used in this study were cultured in DMEM containing 10% FCS, 0.03% L-glutamine, 100 µg/mL penicillin, and 100 µg/mL streptomycin sulfate. Hematopoietic cell lines were cultured in RPMI 1640 supplemented with FCS, L-glutamine, and antibiotics.
DNA and RNA analysis. High molecular weight DNA and RNA were extracted from the bone marrow leukemic cells following standard procedures. Southern blot analyses were hybridized with the MLLa cDNA probe (Fig. 1B) which encompasses the MLL breakpoint cluster region. Northern blot and human RNA Master Blot (Clontech Laboratories, Palo Alto, CA) were assayed for hybridization to an AF4p12 probe obtained by PCR amplification of human AF4p12 cDNA fragment (forward primer in exon 44: GTGCAGTCCACTACTGAGCC and reverse primer in exon 49: GGCCTTTTCCAACTAACAGG).

View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 1. The t(4;11) translocation involves MLL and AF4p12 genes in treatment-related ALL. A, Southern blot analysis done with 10 µg of genomic DNA extracted from leukemic cells (P) and normal peripheral blood lymphocytes (C) digested with BglII (Bg) and HindIII (Hd). The filter was assayed for hybridization to MLLa probe (B). B, restriction map of the normal MLL allele, the t(4;11) translocation breakpoint, and the normal AF4p12 allele. Black bars, chromosome 11 DNA regions; gray bars, chromosome 4 DNA regions. Horizontal lines under the map, location of the MLLa probe. Boxes, exons. CEN, centromere; TEL, telomere; H, HindIII; Ba, BamHI; X, XbaI; Bg, BglII; H, HindIII. C, panhandle PCR product from the der(9) chromosome. P, leukemic cells; C, control DNA; M, size marker. R, 2.8 kbp product derived from the der(9) BglII-rearranged allele; G, 2.3 kbp germ line product. D, nucleotide sequence of the genomic breakpoints of the translocation t(4;11) and corresponding normal chromosomes 11 and 4. Chromosome 11 sequence is in normal type; chromosome 4 sequence is in italics. Gaps have been introduced for optimal alignment. Additional nucleotides are underlined.
|
|
Panhandle PCR. Panhandle PCR amplification of MLL genomic breakpoint was done as previously described (8) apart from using the BglII enzyme instead of BamHI to digest the DNA containing known MLL sequence juxtaposed to unknown partner. Panhandle PCR products from the der(11) BglII-rearranged allele (2.8 kbp) were subcloned into the TA cloning vector (Invitrogen, Paisley, United Kingdom) and individual clones were sequenced. To confirm the genomic breakpoint and the presence of MLL/AF4p12 fusion mRNA, exonic sequences from MLL upstream of the junction and from AF4p12 downstream of the junction were used to design primers. Forward primer from MLL exon 6 was GCAAACAGAAAAAAGTGGCTCCCCG and reverse primer from AF4p12 exon 49 was GGCCTTTTCCAACTAACAGG. Reverse transcription was done as previously described. Fifty nanograms of genomic DNA and 2 µL of cDNA from leukemic cells and normal controls were amplified by long-distance PCR (Expand Long Template PCR System, Roche Diagnostics, Meylan, France). Thermocycling conditions were 94°C for 3 minutes followed by 35 cycles of denaturation at 94° for 30 seconds, annealing at 60°C for 30 seconds, extension at 68°C for 7 minutes (or for 30 seconds for cDNA), and a final extension step at 68°C for 10 minutes.
Transient transfections and reporter assays. The 2.1 kbp AF4p12 fragment fused to MLL, obtained by reverse transcription-PCR (RT-PCR; sense primer: 5'-ACTAGTACTCGAGAAACACCAATTATTGGAAACAAATAT-3'; antisense primer which contained the AF4p12 termination codon: 5'-ACTAGTACTCGAGTCAGAATCCAGTGCTCACCAT-3'; accession no. XM_093839.10), was subcloned into the XhoI site of the pSG5-Gal4-DBD expression vector, in frame with the yeast Gal4 DNA-binding domain coding sequence which contains Gal4 elements responsible for DNA binding, homodimerization, and nuclear localization. The pSG5-Gal4-DBD-AF4p12 construct was sequence checked. For transient transfections, HeLa cells were seeded (8 x 104 cells per well) in 24-well plates and transfected 24 hours later using Exgen 500 (Euromedex, Mundolsheim, France) with the reporter constructs (pSG5-Gal4-luciferase, 200 ng), various amounts of the expression vector (pSG5-Gal4-DBD-AF4p12), and pRL-TK internal control vector (25 ng) under the control of the thymidine kinase promoter (Promega, Madison, WI). When increasing amounts of Gal4-AF4p12 expression vectors were transfected, the amount of transfected SV40 promoter was kept constant (250 ng) by the addition of an empty vector (pSG5-Gal4-DBD wild-type vector) to the transfection mixture. Forty-eight hours after transfection, the luciferase activity was quantified using equivalent amounts of each lysate analyzed with the Dual Luciferase Reporter Assay (Promega). In all experiments, done in triplicate, firefly luciferase activity was normalized by reference to the Renilla luciferase activity expressed by the pRL-TK vector.
 |
Results and Discussion
|
|---|
The t(4;11)(p12;q23) translocation involves the MLL and AF4p12 genes in treatment-related acute lymphoblastic leukemia. Fluorescence in situ hybridization (FISH) analysis on tumor metaphases, done with a commercial probe covering the entire MLL gene (Oncor), gave a split signal between the der(4) and der(11) chromosomes, confirming the involvement of MLL in this case (data not shown). Southern blot analysis provided strong evidence that the t(4;11) translocation cytogenetically detected in treatment-related ALL disrupts the MLL gene. Using the MLLa probe which encompasses the breakpoint cluster region, we detected rearranged fragments in addition to the germ line bands in BglII- and HindIII-cleaved DNA (Fig. 1A). Southern blot analysis done with probes surrounding the MLL breakpoint probe allowed us to identify der(11) and der(4) rearranged bands (data not shown) and was used for restriction mapping (Fig. 1B).
To characterize the genomic sequences fused to MLL, we carried out a panhandle PCR amplification of MLL genomic breakpoints. In BglII-cleaved tumor DNA, the MLLa probe detected a 2.8 kbp rearranged band derived from der(11). As expected, panhandle PCR identified a 2.8 kbp product (Fig. 1C). Blast search analysis showed that the nucleotide sequence of this panhandle product contained MLL intron 6 and genomic sequences from chromosome 4 origin (accession no. NT_086650) surrounded by human cDNA sequence (KIAA0826, accession no. XM_093839.10). In line with the nomenclature for MLL fusion partner genes, we named this gene AF4p12 (ALL-1 fused gene from chromosome 4p12). A comparison of human cDNA (XM_093839.10) and genomic DNA chromosome 4 sequences (NT_086650) revealed that the AF4p12 gene extends over 127 kbp and contains at least 61 exons.
To confirm the specificity of this 2.8 kbp fragment, the sequences of the panhandle PCR products were used to design primers encompassing the breakpoint (forward primer from MLL exon 6 and reverse primer from AF4p12 exon 49). As expected, with tumor DNA, we obtained a 3.8 kbp PCR product (data not shown). The sequence analysis of this fragment confirmed the sequence obtained by panhandle PCR. The breakpoint occurs 1,434 nucleotides downstream from exon 6 of the MLL gene and 2,429 nucleotides upstream from exon 49 of the AF4p12 gene (Fig. 1D).
FISH analysis on leukemic metaphases, done with a BAC clone (RP11-19132) covering the entire KIAA0826 cDNA, gave three signals, one on the normal chromosome 4, one on the derivative chromosome 4, and one on the derivative chromosome 11, confirming the involvement of AF4p12 in this translocation (data not shown).
Next, to identify the presence of the MLL/AF4p12 fusion mRNA, we did an RT-PCR analysis (forward primer from MLL exon 6 and reverse primer from AF4p12 exon 49) on tumor cells, which successfully yielded products of predicted size (206 bp; Fig. 2A). Sequence analysis of the fusion point revealed an in-frame fusion between MLL exon 6 and AF4p12 exon 49 (Fig. 2B). The putative MLL-AF4p12 fusion protein of 2,074 amino acids contained 1,362 amino acids from the NH2-terminal part of MLL and 712 amino acids from the COOH-terminal part of AF4p12.

View larger version (45K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 2. Expression analysis of AF4p12. A, detection of the fusion transcripts by RT-PCR. RT-PCR analysis with an MLL sense primer and an AF4p12 antisense primer detects a chimeric MLL/AF4p12 transcript. M, size marker; P, leukemic cells from the patient; C, normal control. B, nucleotide sequence of the fusion transcript. In MLL-AF4p12 transcript, MLL exon 6 was fused in frame with human AF4p12 exon 49. MLL sequence is in normal type, AF4p12 sequence is in italics. C, expression analysis of the AF4p12 transcripts. Expression levels of human AF4p12 mRNA in various tissues were quantitated by measuring the hybridization signal on multiple human RNA dot blots. The amount of RNA was normalized using ubiquitin cDNA control probe (Clontech). The value of the expression level in fetal brain has been adjusted to 100 in the figure. D, Northern blot analysis, done with 10 µg of total RNA from various cell lines, hybridized with the AF4p12 probe. EtBr, ethidium bromide staining.
|
|
Expression analysis of AF4p12 transcripts. The expression of AF4p12, quantified in a variety of human tissues, was expressed in a wide spectrum of normal tissues. The highest steady-state levels were observed in the colon, the placenta, and in different parts of adult brain (substantia nigra, putamen, and thalamus). A weaker expression was observed in the bladder, the kidney, and mammary glands (Fig. 2C). Northern blots of total RNA extracted from several cell lines showed the expression of a single species of AF4p12 mRNA of
11 kb. A preferential expression was seen in cells of lymphoid origin (Fig. 2D).
AF4p12 is the human orthologue to the furry gene of Drosophila. The human KIAA0826 cDNA sequence identical to AF4p12 cDNA has 11,423 bp with a large open reading frame of 9,318 bp capable of encoding 3,105 amino acids. Comparison of AF4p12 cDNA sequence with those in the human data bank revealed the presence of a protein (accession no. CAB42442 highly homologous to AF4p12. These two proteins showed 60% identity at the amino acid level (74% with conservative substitution). Data bank analysis showed that two paralogues are found in human, rat, and chicken tissues, but only one orthologue gene is found for Drosophila, C. elegans, and Arabidopsis (Fig. 3). AF4p12 is highly conserved in evolution, a feature that indicates a large selective pressure to conserve the specific structural and functional characteristics of the protein. Sequences homologous to AF4p12 can be detected in lower species such as Drosophila, C. elegans, and Arabidopsis (Fig. 3). There is little information about the biological function of the homologues, as almost all were found in genome or EST sequencing projects. Furry, the Drosophila orthologue of AF4p12, is a large and complicated gene that encodes two proteins with no known functional domain. One contains 3,479 amino acids and the second is a truncated version of this large protein. Furry is important for maintaining the integrity of cellular extensions during morphogenesis (9) and for patterning the dendritic field of Drosophila sensory neurons (10). It has been shown that the fission yeast Furry-like protein, Mor2, is essential for cell morphogenesis and is required for the establishment of growth polarity (11). The furry gene and its homologues in yeast and C. elegans have been implicated as being essential for the function of the Ndr family of AGC kinases, essential regulators of the cell cycle and morphogenesis (12, 13).

View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 3. Diagrammatic representation of the human AF4p12 (KIAA0826) protein. BLAST search analysis shows that the human CAB42442protein is highly homologous to the human AF4p12 protein. The percentage of identical amino acids compared with AF4p12/CAB42442 is shown below the various AF4p12 homologues.
|
|
The fusion domain of AF4p12 to the chimeric protein MLL-AF4p12 displays transcriptional activation potential. Protein motif analysis using the PROSITE database indicated that AF4p12 protein contains two potential leucine zipper regions (amino acids 1,229-1,250 and 2,923-2,944). The second leucine zipper motif is very similar (77-100%) to the equivalent region in other species (Fig. 4A). Thus, there has been selective pressure to maintain the leucine zipper, suggesting that it has an important functional role. As it has been shown for AF10 (14), the leucine zipper motif is maintained in the MLL-AF4p12 fusion protein (Fig. 4B). Several partners of MLL (AF10, ENL, and ELL) display an ability to activate transcription under experimental conditions. Structure/function studies suggest that the gain of transcriptional effector properties contributes to the transformation of myeloid progenitors by the fusion protein (1416).

View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 4. Transactivation domain is provided by the fusion domain of AF4p12 to the chimeric protein MLL-AF4p12. A, comparison of the leucine zipper region of AF4p12 (XP_093839, amino acids 2,923-2,944) with equivalent regions of other proteins (rat: XP_344236, amino acids 1,628-1,649; chicken: XP_420718, amino acids 3,223-3,244; and fish: CAG00417 amino acids 2,780-2,801). *, conserved leucine residues. The leucine zipper region is underlined. B, schematic representation of the domain structures of MLL and of the MLL/AF4p12 fusion protein. MT, DNA methyltransferase homology domain; SET, SET domain; LZ, leucine zipper domain. Arrows, fusion point. Numbers, positions of amino acids in wild-type MLL or AF4p12. In the predicted chimeric MLL/AF4p12 fusion protein, the MLL zinc finger and the MLL SET domains have been replaced by the AF4p12 leucine zipper domain. C, HeLa cells have been transiently transfected with the indicated amounts of plasmids encoding Gal4-AF4p12 protein, 200 ng of the pSG5-Gal4-luciferase reporter plasmid, along with 25 ng of the pRL-TK internal control vector. Columns, mean relative luciferase activity of three independent experiments, each done in triplicate; bars, SD. In all experiments, luciferase activity has been normalized by reference to the Renilla luciferase activity expressed by the cotransfected pRL-TK control plasmid.
|
|
To study the transcriptional properties of AF4p12, we did transient transfection assays in HeLa cells with the 2.1 kbp fragment of AF4p12 fused to MLL cloned into the pSG5-Gal4-DBD expression vector, in frame with the yeast Gal4 DNA-binding domain coding sequence. This 2.1 kbp fragment encodes the COOH-terminal part of the AF4p12 protein (amino acids 2,394-3,105). Transcriptional activity was measured as a function of luciferase protein production. As shown in Fig. 4C, the transfection of HeLa cells with the pSG5-Gal4-luciferase reporter, together with increasing amounts of the construct expressing Gal4-AF4p12, activated transcription in a dose-dependent way. These results indicate that the COOH-terminal part of the AF4p12 protein exhibited transcriptional activation properties when fused to Gal4 DNA-binding domains. The leucine zipper domain found in the COOH-terminal part of AF4p12 fused to MLL is the sole motif found by sequence analysis in this region and could be implicated in the oncogenic activation of MLL. Further experiments are required to explore the consequences of the deletion of the leucine zipper motif on the transcriptional activation properties of AF4p12.
In the present study, we have isolated a novel fusion partner of the MLL gene, AF4p12, localized on chromosome 4 band p12, in a treatment-related ALL with chromosomal abnormalities involving 11q23 and 4p12. The t(4;11)(p12;q23) translocation was found as the sole anomaly in all metaphases analyzed and thus might contribute to leukemogenesis. The AF4p12 fused domain might convert MLL into an oncoprotein by the acquisition of a transcriptional effector domain. Moreover, as previously described in leukemias with MLL fusion proteins (6, 17, 18), quantitative real-time PCR experiments showed that FLT3 and HOXA9 were significantly overexpressed in our patient (data not shown). Although the clinical effect of these infrequent fusions may be limited, their characterization will certainly promote additional mechanistic insights into MLL-mediated leukemogenesis.
 |
Acknowledgments
|
|---|
Grant support: Institut National de la Sante et de la Recherche Medicale, Association pour la Recherche contre le Cancer, and Ligue Nationale contre le Cancer (Comités du Rhône, de la Saône et Loire et de l'Ardêche). S. Forissier was the recipient of a doctoral fellowship from the Ligue Nationale contre le Cancer. E. Delabesse is supported by the Fondation de France, Comité Leucémie.
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Annick Bertholin, Carole Charlot, and Chrisophe Ollagnier for their excellent technical assistance.
Received 4/15/05.
Revised 6/ 2/05.
Accepted 6/ 6/05.
 |
References
|
|---|
- Huret JL, Dessen P, Bernheim A. An atlas of chromosomes in hematological malignancies. Example: 11q23 and MLL partners. Leukemia 2001;15:9879.[CrossRef][Medline]
- Hayette S, Tigaud I, Maguer-Satta V, et al. Recurrent involvement of the MLL gene in adult T-lineage acute lymphoblastic leukemia. Blood 2002;99:46479.[Free Full Text]
- Daser A, Rabbitts TH. Extending the repertoire of the mixed-lineage leukemia gene MLL in leukemogenesis. Genes Dev 2004;18:96574.[Free Full Text]
- DiMartino JF, Cleary ML. Mll rearrangements in haematological malignancies: lessons from clinical and biological studies. Br J Haematol 1999;106:61426.[CrossRef][Medline]
- Ayton PM, Cleary ML. Molecular mechanisms of leukemogenesis mediated by MLL fusion proteins. Oncogene 2001;20:5695707.[CrossRef][Medline]
- Armstrong SA, Staunton JE, Silverman LB, et al. MLL translocations specify a distinct gene expression profile that distinguishes a unique leukemia. Nat Genet 2002;30:417.[CrossRef][Medline]
- Ferrando AA, Armstrong SA, Neuberg DS, et al. Gene expression signatures in MLL-rearranged T-lineage and B-precursor acute leukemias: dominance of HOX dysregulation. Blood 2003;102:2628.[Abstract/Free Full Text]
- Megonigal MD, Rappaport EF, Jones DH, et al. Panhandle PCR strategy to amplify MLL genomic breakpoints in treatment-related leukemias. Proc Natl Acad Sci U S A 1997;94:115838.[Abstract/Free Full Text]
- Cong J, Geng W, He B, Liu J, Charlton J, Adler PN. The furry gene of Drosophila is important for maintaining the integrity of cellular extensions during morphogenesis. Development 2001;128:2793802.
- Emoto K, He Y, Ye B, et al. Control of dendritic branching and tiling by the Tricornered-kinase/Furry signaling pathway in Drosophila sensory neurons. Cell 2004;119:24556.[CrossRef][Medline]
- Hirata D, Kishimoto N, Suda M, et al. Fission yeast Mor2/Cps12, a protein similar to Drosophila Furry, is essential for cell morphogenesis and its mutation induces Wee1-dependent G(2) delay. EMBO J 2002;21:486374.[CrossRef][Medline]
- He Y, Fang X, Emoto K, Jan YN, Adler PN. The tricornered Ser/Thr protein kinase is regulated by phosphorylation and interacts with furry during Drosophila wing hair development. Mol Biol Cell 2005;16:689700.[Abstract/Free Full Text]
- Tamaskovic R, Bichsel SJ, Hemmings BA. NDR family of AGC kinases-essential regulators of the cell cycle and morphogenesis. FEBS Lett 2003;546:7380.[CrossRef][Medline]
- DiMartino JF, Ayton PM, Chen EH, Naftzger CC, Young BD, Cleary ML. The AF10 leucine zipper is required for leukemic transformation of myeloid progenitors by MLL-AF10. Blood 2002;99:37805.[Abstract/Free Full Text]
- Slany RK, Lavau C, Cleary ML. The oncogenic capacity of HRX-ENL requires the transcriptional transactivation activity of ENL and the DNA binding motifs of HRX. Mol Cell Biol 1998;18:1229.[Abstract/Free Full Text]
- DiMartino JF, Miller T, Ayton PM, et al. A carboxy-terminal domain of ELL is required and sufficient for immortalization of myeloid progenitors by MLL-ELL. Blood 2000;96:388793.[Abstract/Free Full Text]
- Gilliland DG, Griffin JD. The roles of FLT3 in hematopoiesis and leukemia. Blood 2002;100:153242.[Abstract/Free Full Text]
- Tsutsumi S, Taketani T, Nishimura K, et al. Two distinct gene expression signatures in pediatric acute lymphoblastic leukemia with MLL rearrangements. Cancer Res 2003;63:48827.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
B. W. Robinson, N.-K. V. Cheung, C. P. Kolaris, S. C. Jhanwar, J. K. Choi, N. Osheroff, and C. A. Felix
Prospective tracing of MLL-FRYL clone with low MEIS1 expression from emergence during neuroblastoma treatment to diagnosis of myelodysplastic syndrome
Blood,
April 1, 2008;
111(7):
3802 - 3812.
[Abstract]
[Full Text]
[PDF]
|
 |
|