| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology, Pathobiology and Genetics |
1 Lilly Research Laboratories, Eli Lilly and Co., Indianapolis, Indiana and 2 Millennium Pharmaceuticals, Cambridge, Massachusetts
Requests for reprints: William L. Perry III, Lilly Research Laboratories, Eli Lilly and Co., Indianapolis, IN 46285. Phone: 317-276-1083; Fax: 317-433-2815; E-mail: bperry{at}lilly.com.
| Abstract |
|---|
|
|
|---|
5-fold relative to a catalytically inactive ribozyme control and untransfected cells, suggesting a role for SPF45 in intrinsic resistance to some drugs. A2780-SPF45 cells accumulated similar levels of doxorubicin as vector-transfected and parental A2780 cells, indicating that drug resistance is not due to differences in drug accumulation. Efforts to identify small molecules that could block SPF45-mediated drug resistance revealed that the selective estrogen receptor (ER) modulators tamoxifen and LY117018 (a raloxifene analogue) partially reversed SPF45-mediated drug resistance to mitoxantrone in A2780-SPF45 cells from 21-fold to 8- and 5-fold, respectively, but did not significantly affect the mitoxantrone sensitivity of vector control cells. Quantitative PCR showed that ERß but not ER
was expressed in A2780 transfectants. Coimmunoprecipitation experiments suggest that SPF45 and ERß physically interact in vivo. Thus, SPF45-mediated drug resistance in A2780 cells may result in part from effects of SPF45 on the transcription or alternate splicing of ERß-regulated genes. | Introduction |
|---|
|
|
|---|
In our first article, we reported the use of suppression subtractive hybridization to investigate the mechanisms of drug resistance in EMT-6 tumor cells selected for resistance to cyclophosphamide in vivo (6). Sequencing of clones selected for increased expression in EMT-6/cyclophosphamide cells identified a gene encoding a protein with significant homology to the Arabidopsis DNA damage repair protein DRT111 (7). While this work was in progress, Neubauer et al. identified this protein as a component of the RNA splicing complex known as the spliceosome through mass spectrometry analysis of splicing complexes assembled in vitro (7). They named this protein SPF45 (splicing factor 45 kDa). It has since been given the official human gene symbol RBM17, which stands for RNA-binding motif protein 17. Although we found that SPF45 is predominantly expressed in ductal epithelial cells of the breast, liver, pancreas, and prostate in normal tissues, SPF45 is frequently overexpressed in human cancers, including bladder, breast, colon, lung, ovarian, pancreas, and prostate carcinomas (6), suggesting a possible clinical role for this protein in drug resistance to anticancer agents in these cancers. To examine the possible role of SPF45 in drug resistance, we generated a stable transfectant of a human SPF45 expression construct in HeLa cells and examined drug sensitivity relative to a transfectant of the empty vector. Overexpression of human SPF45 was sufficient to confer resistance to two anticancer drugs with different mechanisms of action, doxorubicin and vincristine (6). To our knowledge, this was the first study demonstrating that overexpression of a splicing factor is sufficient to confer a multidrug-resistant phenotype to transfected cells.
SPF45 contains a RNA recognition motif (RRM) and a G-patch sequence, both putative RNA-binding motifs (8, 9). Neubauer et al. (7) found that a green fluorescent protein (GFP)-SPF45 fusion protein colocalized with U1A small nuclear ribonucleoprotein in nuclear speckles (7), structures enriched in components of the splicing machinery (10, 11). Using confocal microscopy, we reported that native SPF45 also colocalizes with serine/argininerich (SR protein) splicing factors in the nucleus in speckles (6). Recently, SPF45 was implicated as a second-step splicing factor required for activating proximal AG splice-acceptor sites for the splicing of some transcripts, including the Drosophila Sex-lethal gene and a variant of the human ß-globin gene present in some ß-thalassemia patients (12). Although most known mechanisms of regulating mRNA splicing occur at the earliest stages of spliceosome assembly, SPF45 directly participates in the selection of the AG that is used for exon ligation at the second catalytic step of splicing after intron removal has begun, representing a new mechanism of splicing regulation (12, 13).
In addition to splicing factors like SPF45, several proteins originally identified as transcriptional coregulators of nuclear hormone receptors (NHR) also contain one or more RRMs and other domains characteristic of splicing factors (14). Two of these RRM-containing coactivators, peroxisome proliferator-activated receptor-
coactivator-1 (PGC-1) and coactivator activator (CoAA), can also act as splicing factors that affect the alternate splicing of genes under the control of hormone-regulated promoters (14, 15). Some coactivators may only be able to regulate the alternate splicing of a gene when recruited to a transcriptional complex through interactions with NHRs and not when a gene is expressed from a ubiquitous promoter (14). The fact that SPF45 contains a RRM domain like PGC-1 and CoAA raises the intriguing possibility that SPF45 might also have dual activities as a splicing factor and as a NHR coregulator.
In the present study, we show that stable transfection of SPF45 expression constructs is sufficient to confer a broad multidrug-resistant phenotype to a second cell line, A2780 ovarian carcinoma cells, and that knockdown of endogenous SPF45 in A2780 parental cells results in increased drug sensitivity. SPF45 overexpression does not seem to affect the levels of intracellular drug accumulation, a common mechanism of developing drug resistance. The drug-resistant phenotype was partially reversed using selective estrogen receptor (ER) modulators and SPF45 immunoprecipitated with ERß, suggesting that these proteins physically interact in vivo. Hence, SPF45-mediated drug resistance in A2780 cells may result in part from direct effects of SPF45 on ERß-mediated transcription and on the alternate splicing of genes under the control of ERß-regulated promoters.
| Materials and Methods |
|---|
|
|
|---|
Cell culture. A2780 human ovarian carcinoma cells and 2780AD cells (the Pgp-expressing variant selected in cell culture for resistance to Adriamycin) were provided by Dr. Thomas Hamilton (Fox Chase Cancer Center, Philadelphia, PA). A2780 cells were grown in RPMI 1640 containing L-glutamine supplemented with 10% FBS and 1 µg/mL insulin. 2780AD cells were maintained as described (18). HeLa cells were grown in DMEM containing 10% CDT-FBS, 2 mmol/L L-glutamine, 0.1 mmol/L nonessential amino acids, 10 mmol/L HEPES buffer (pH 7.5), and 1 mmol/L sodium pyruvate.
Western analysis. Cells were lysed in a buffer containing 10 mmol/L Tris (pH 7.4), 1% SDS, and 1 mmol/L sodium orthovanadate and protease inhibitors (EDTA-Free Complete Protease Inhibitor Cocktail, Roche Diagnostics) by vortexing and spinning lysate through a QIAshredder column (Qiagen, Valencia, CA) in a microfuge at 12,000 rpm for 5 minutes. Protein concentrations were determined using the detergent-compatible protein assay kit (Bio-Rad Laboratories, Hercules, CA) or the bichinonic acid protein assay kit (Pierce-Endogen, Rockford, IL). Proteins were resolved on Novex 4% to 20% Tris-glycine gels (Invitrogen) and transferred to nitrocellulose. Membranes were blocked in either PBST [PBS (136.9 mmol/L NaCl, 1.47 mmol/L KH2PO4, 8.1 mmol/L Na2HPO4, 2.68 mmol/L KCl) and 0.1% Tween 20)] or T-TBS [154 mmol/L NaCl, 100 mmol/L Tris-HCl (pH 7.4), 0.1% Tween 20)] containing 2.5% nonfat dry milk. Membranes were probed with either a SPF45 rabbit polyclonal antibody described previously (6) or with a ß-actin antibody (Sigma-Aldrich) diluted in the same solution used for blocking followed by incubation with peroxidase-conjugated secondary antibodies. Protein bands were visualized using the enhanced chemiluminescence-chemiluminescence system (Amersham Biosciences, Chicago, IL) or the SuperSignal West Pico Chemiluminescence reagent (Pierce-Endogen).
Northern analysis. Total RNA was isolated from tissue culture cells using RNeasy (Qiagen), resolved on formaldehyde agarose gels, and transferred to Hybond N+ nylon membranes (Amersham Biosciences) using the PosiBlot pressure blotter (Stratagene, La Jolla, CA) followed by cross-linking using a Stratalinker (Stratagene). The SPF45 cDNA was labeled as a probe using the Prime-It RmT random priming labeling kit (Stratagene) an [
-32P]dCTP (Amersham Biosciences). Filters were hybridized in rapid hybridization buffer (Amersham Biosciences) and washed according to manufacturer's instructions. Radioactive hybridization signals were captured by a Fuji BAS 2500 PhosphorImager (Fuji Medical Systems, Stamford, CT).
A2780 SPF45 transfectants. A2780 cells were transfected with pMiNeo-hSPF45 (6) or the empty vector using LipofectAMINE 2000 according to the supplied protocols. Cells were put under neomycin selection 48 hours after transfection by adding G418 to 600 µg/mL. Single colonies were expanded and expression levels of SPF45-IRES-neo transcripts relative to the shorter endogenous SPF45 transcript levels were determined by Northern hybridizations to a labeled SPF45 cDNA probe.
SPF45-targeted ribozyme. The pcDNA3.1-triple ribozyme 8 (TRz8) construct based on the work of Benedict et al. (20) was constructed from overlapping oligonucleotides and cloned into the vector pcDNA3.1 (Invitrogen). Self-cleavage of the primary transcript by the 5' and 3' ribozymes result in release of the internal SPF45 targeted ribozyme. The sequence of the triple ribozyme is as follows where the 5' and 3' ribozymes are shown in bold and catalytically essential residues (20) of the internal ribozyme are underlined: 5'-GGCCCUGAUGAGUCCGUGAGGACGAAACUUGGCCCGGCCAAGUCGGCCUGUCUGUCUUCUGAUGAGCAUGAGCAUGCGAAACGCCUUUUUGGCCGUCUUGGCCUCUAGAGGCCAACUGAUGAGUCCGUGAGGACGAAACGGCC-3'.
The internal ribozyme sequences 5'-UGUCUGUCUU-3' and 5'-ACGCCUUUUU-3' are homologous to the human SPF45 mRNA (Genbank accession no. NM_032905). A control construct encoding a catalytically inactive internal ribozyme that was designed to bind but not cleave the SPF45 mRNA [pcDNA3.1-TRz8 mutant (TRz8M)] was generated by mutating the catalytically essential G and A nucleotides to A and G, respectively. Stable transfectants of both constructs were generated as described above.
Cytotoxicity assays. The CellTiter 96 (Promega Corp., Madison, WI) or the WST-1 (Roche Diagnostics) cell proliferation assays were used to determine resistance of the transfected cells or parental A2780 cells to various chemotherapeutic agents in 96-well plates. The cells were plated at 10,000 cells per well in the medium detailed above in the absence of G418. Twenty-four hours after seeding, the cells were exposed to anticancer drugs and incubated for an additional 72 hours before assaying for cell viability. Resistance was determined in at least two experiments done in duplicate. EC50 values (the concentration of drug that results in 50% of maximal growth inhibition) were calculated using a four-parameter logistic fit, and data from multiple experiments were used to calculate mean EC50 values ± SE.
The significance of changes in EC50 values was evaluated using the Student's t test or by the use of confidence intervals for the difference of two log(EC50) values based on the between-experiment SEs as noted in the tables. To calculate these confidence intervals, the end points of these intervals were anti-logged to convert back to the EC50 scale, resulting in a multiplicative confidence interval for the ratio of 2 EC50 values (fold resistance). Two EC50 values were deemed statistically significantly different if this interval did not contain the value, 1. EC50 values from single experiments were compared using the curve fit SEs analyzed on the log-EC50 scale (Table 3).
|
2 x 105 cells were plotted based on geoMean X of gated region R2 and compared with the untreated samples gated in the same way. Coimmunoprecipitation. An ovarian cDNA library K-1421-1 (Clontech, Palo Alto, CA) was used to isolate a cDNA encoding the full-length human ERß protein identical to that reported in Genbank (accession no. AB006590). This cDNA was cloned into the HindIII site of pcDNA3.1(+) (Invitrogen) behind the cytomegalovirus promoter to generate the ERß expression plasmid pMK104.
HeLa cells (1 x 106) were plated into 100 mm dishes and transfected using FuGene the next day during a 5-hour incubation at 37°C. Transfected cells were incubated overnight in fresh growth medium followed by growth in medium containing 100 nmol/L E2 or an equal volume of DMSO for additional 24 hours. Cells were transfected with either 5 µg pMK104 (ERß expression plasmid) plus 5 µg EW1969-hisB-SPF45 (SPF45 expression plasmid) or 5 µg pcDNA3.1-GFP plus 5 µg EW1969 vector control DNA. Cells were washed in 1x PBS containing 1 mmol/L sodium orthovanadate and lysed in radioimmunoprecipitation assay (RIPA) buffer [20 mmol/L Tris-HCl (pH 7.5), 5 mmol/L EDTA, 150 mmol/L NaCl, 10 mmol/L sodium pyrophosphate, 50 mmol/L NaF, 1% NP40, 2 mmol/L sodium orthovanadate, protease inhibitor cocktail (Roche Diagnostics)] by repeated freeze-thaw cycles using dry ice. The lysate was centrifuged at 14,000 rpm and the protein concentration of the supernatant was determined using the Coomassie (Bradford) protein assay kit (Pierce-Endogen).
A polyclonal antibody to ERß or normal rabbit IgG (Santa Cruz Biotechnology Inc., Santa Cruz, CA) was conjugated to biomagnetic particles (BMP) containing autoreactive aldehyde groups (Rockland Immunochemicals, Gilbertsville, PA) according to supplied protocols. For immunoprecipitation, cell lysate (1 mg) was added to 110 µL of the antibody-conjugated BMPs, IgG-conjugated BMPs, or unconjugated BMPs (after reactive groups were blocked), and TET buffer (1x TBS + 0.1% Tween 20 + 5 mmol/L EDTA) was added to a total volume of 1.5 mL. The lysates were mixed for 20 hours at 4°C. BMPs were washed thrice in TET buffer and once in 2x SDS sample buffer to recover bound proteins. Western analysis was done as described above using a mouse monoclonal antibody against SPF45. Total lysate from ERß plus SPF45transfected and E2-stimulated cells (50 µg) was included on Western blots to provide a reference to the level of SPF45 in the lysate.
| Results |
|---|
|
|
|---|
Twenty-two independent clones with elevated SPF45 expression levels were screened for drug resistance to doxorubicin and etoposide in cytotoxicity assays done once, and 20 of these were resistant to both drugs (data not shown). Four of these clones were analyzed in additional cytotoxicity assays and found to be 14- to 18-fold resistant to mitoxantrone, 3- to 5-fold resistant to doxorubicin, 3- to 12-fold resistant to etoposide, and 3- to 5-fold resistant to cisplatinum. Resistance values for individual clones are given in a footnote to Table 1. One of these, clone 51, with stable overexpression of SPF45 at high levels (A2780-SPF45) was selected for further study. A2780-SPF45 cells and a stable transfectant of the empty vector (A2780-Vector) had similar doubling times of 21 and 23 hours, respectively. A2780-SPF45 cells had increased expression of SPF45 relative to A2780-Vector cells when analyzed by Western using a SPF45 polyclonal antibody and a ß-actin antibody to control for protein loading (Fig. 1A).
|
|
5-fold resistant to cisplatinum. Sensitivity to gemcitabine and pemetrexed was also determined. As shown in Fig. 1C and D, the dose-response survival curves for gemcitabine and pemetrexed were only significantly different in the two transfectants at the highest drug concentrations where cell survival plateaued. Survival was significantly different at
0.02 µmol/L for gemcitabine and
0.12 µmol/L for pemetrexed (P < 0.05). Taken together, these data indicate that overexpression of SPF45 in A2780 cells confers MDR.
Ribozyme knockdown of SPF45 sensitizes A2780 cells to etoposide. To further explore the relationship between SPF45 levels in A2780 cells with sensitivity to anticancer drugs, we developed a ribozyme strategy for decreasing SPF45 mRNA levels and SPF45 protein. Based on the work of Benedict et al. (20), we designed a mammalian expression construct that would produce a primary transcript containing three tandem hammerhead ribozyme catalytic regions (a triple ribozyme; see Fig. 2A). The 5' and 3' ribozymes were targeted to the primary triple ribozyme transcript, resulting in self-cleavage and release of the internal SPF45-targeted ribozyme. Stable transfectants of A2780 cells were generated with constructs expressing the active SPF45-targeted ribozyme TRz8 and with a construct expressing a catalytically inactive ribozyme TRz8M as a control that was designed to bind but not cleave SPF45 mRNA (see Materials and Methods). A slight reduction in SPF45 protein levels was noted in A2780-TRz8M cells relative to parental A2780 cells (Fig. 2B), but this had little effect on drug sensitivity to etoposide (Fig. 2C); only two of seven data points were significantly different by the Student's t test (P < 0.05). However, a pronounced reduction in SPF45 protein levels was detected in A2780-TRz8 cells relative to A2780-TRz8M and A2780 parental cells by Western analysis (Fig. 2B). This resulted in increased etoposide sensitivity relative to A2780-TRz8M and A2780 parental cells with the EC50 decreased
5-fold by TRz8 expression (Fig. 2C).
|
|
|
was not expressed by these cells when analyzed by Taqman (data not shown) in agreement with previous reports that A2780 is ER
negative (24). Hence, the role of ERß in SPF45-mediated drug resistance in these cells could be investigated using ERß modulators.
We evaluated the effect of the mixed agonist-antagonists of ERß, tamoxifen, and LY117018 (a raloxifene analogue) on the drug sensitivity of the A2780 transfectants. Both compounds increased the drug sensitivity of A2780-SPF45 cells to mitoxantrone up to
4-fold (Table 3). LY117018 achieved significant sensitization of A2780-SPF45 cells at the lowest concentration tested (0.185 µmol/L) compared with tamoxifen that achieved significant sensitization at
10-fold higher concentration (1.67 µmol/L). Moreover, these compounds did not significantly affect the mitoxantrone sensitivity of A2780-Vector cells at any of the concentrations tested (Table 3). These results suggest a possible involvement of the ERß signaling pathway in SPF45-mediated drug resistance.
SPF45 interacts with ERß. To further explore the relationship between ERß and SPF45, immunoprecipitation experiments were done to look for physical interaction of these proteins in vivo. ERß and SPF45 expression plasmids were cotransfected into HeLa cells, and cells were treated with E2 or DMSO (as a vehicle control) 24 hours later. As a negative control, HeLa cells were also transfected with a GFP expression plasmid and EW1969 vector control plasmid. For immunoprecipitation, lysates were incubated with ERß polyclonal antibodyconjugated BMPs, normal rabbit IgG, or unconjugated BMPs followed by sedimentation of antibody-bound complexes under a magnetic field and Western analysis with a SPF45 monoclonal antibody. SPF45 was coimmunoprecipitated with ERß using the ERß antibody BMPs in samples from ERß plus SPF45 transfections but not from the GFP plus vector control transfection (Fig. 4). SPF45 was also not precipitated when ERß antibody BMPs were replaced by IgG-BMPs or unconjugated BMPs. The ERß-SPF45 interaction was not ligand dependent, but less SPF45 was precipitated from DMSO-treated cells than from E2-stimulated cells (Fig. 4). These results suggest that SPF45 and ERß can physically interact in vivo.
|
| Discussion |
|---|
|
|
|---|
5-fold resistant to cisplatinum (a DNA cross-linker; data not shown). MDR was also observed in 19 additional A2780 SPF45 transfectants, ruling out insertional mutagenesis and integration-position effects on host genes as explanations for the multidrug-resistant phenotype. In addition, the knockdown of SPF45 levels in parental A2780 cells with a hammerhead ribozyme resulted in increased sensitivity to etoposide, indicating a role for SPF45 in regulating intrinsic resistance to some drugs as well. To investigate the mechanism of SPF45-mediated drug resistance, we determined whether SPF45 overexpression increased the activity of one or more ABC transporters that resulted in drug resistance by decreasing the intracellular concentrations of chemotherapeutic drugs through active efflux. Several ABC transporters are known to confer resistance to anticancer drugs, including Pgp (ABCB1), members 1 to 8 of the cystic fibrosis transmembrance conductance regulator/MRP1 family (ABCC1-6, ABCC10, and ABCC11), and BCRP (ABCG2; refs. 1, 3, 4, 2534). However, this possibility was ruled out. Drug sensitivity was not modulated by potent Pgp and MRP1 inhibitors. In addition, doxorubicin accumulation in A2780-SPF45 cells was unaltered from that in A2780-Vector and A2780 parental cells, although doxorubicin is a substrate of several ABC transporters. Furthermore, transcriptional profiling failed to detect changes in the abundance of transcripts encoding any of these ABC transporters that could explain resistance to chemotherapeutic agents.4 These data strongly argue against increased drug efflux as a mechanism of SPF45-mediated drug resistance.
Although SPF45 has an established role as a RNA splicing factor, it seems possible that SPF45 could have another role as a coregulator of NHRs. Like SPF45, several coregulators have RRM and other RNA-binding motifs (14). Furthermore, two NHR coregulators with RRM domains (PGC-1 and CoAA) can also act as alternate splicing factors that affect the alternate splicing of genes with hormone-responsive promoters (14, 15). Interestingly, several coactivators that affected the alternate splicing of model genes when expressed from NHR-regulated promoters had no effect on splicing when the same genes were transcribed from a ubiquitous promoter (14). Recruitment of coactivators by activated NHRs may be necessary for the involvement of these coactivators in regulating the splicing of some genes. If SPF45 was involved in the splicing or transcriptional regulation of hormone-responsive promoters, we reasoned that modulators of NHR activity might affect the SPF45-mediated, drug-resistant phenotype in A2780-SPF45 cells. Quantitative PCR indicated that A2780-Vector and A2780-SPF45 cells express ERß (but not ER
), allowing the use of selective ER modulators to test this hypothesis.
We evaluated the effect of mixed agonist-antagonists of both ER
and ERß on the drug sensitivity of A2780 transfectants. Tamoxifen and LY117018 (a raloxifene analogue) partially reversed the SPF45-mediated resistance to mitoxantrone in A2780-SPF45 cells from 21-fold to as low as 8- and 5-fold, respectively, while not significantly affecting the mitoxantrone sensitivity of A2780-Vector cells. One interpretation of these results is that SPF45 overexpression in A2780 cells affects the ERß signaling pathway in a way that contributes to the drug-resistant phenotype. We also showed that SPF45 could be immunoprecipitated with ERß from cellular lysates using an ERß polyclonal antibody, providing evidence that SPF45 and ERß interact in vivo. Thus, SPF45 may have a direct effect on the regulation of transcription and/or splicing of ERß-regulated genes.
Our working model is that SPF45 overexpression causes changes in the splicing pattern of some genes through its activity as an alternate splicing factor and potentially also affects the transcriptional abundance of other transcripts through effects on ERß and possibly other NHRs. The affected genes could directly or indirectly affect the resistance of the cell to one or several anticancer agents; the effects on several genes would together result in the broad multidrug-resistant phenotype observed here. As discussed above, we found no evidence that SPF45 overexpression affects the genes encoding ABC transporters that can cause drug resistance through decreasing intracellular drug accumulation. Other mechanisms of drug resistance include increased repair of drug-induced cellular damage, activation of coordinately regulated detoxification systems, and changes in apoptotic signaling pathways (1). SPF45 overexpression could affect one or more of these processes. For example, some members of the cytochrome P450 family are involved in the metabolism of drugs and xenobiotics. Induction of some of these genes is mediated by NHRs (35) and distinct isoforms of these NHRs are generated through alternate splicing (36, 37). Additionally, alternate splicing is used to generate either proapoptotic or antiapoptotic forms of the BCL-2 family of proteins that are major regulators of apoptotic processes (38, 39). Further studies are needed to identify SPF45 target genes and to discover if SPF45 has any effect on the transcriptional activity of ERß and other NHRs. This research will help elucidate the mechanism(s) of SPF45-mediated MDR.
In summary, SPF45 conferred a broad multidrug-resistant phenotype to A2780 cells when overexpressed, and knockdown of endogenous SPF45 in A2780 parental cells resulted in increased drug sensitivity. Physical interaction of SPF45 and ERß was suggested by coimmunoprecipitation, and ERß modulators partially reversed SPF45-mediated drug resistance. The fact that SPF45 is overexpressed in most tumors derived from seven different tissues (6) suggests that SPF45 up-regulation is a common event in certain tumors. Thus, SPF45 may play an important role in clinical resistance to chemotherapy.
| Acknowledgments |
|---|
| Footnotes |
|---|
4 W.L. Perry and S. Jin, unpublished observations. ![]()
Received 11/24/04. Revised 4/11/05. Accepted 5/20/05.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. Stark, C. Wichman, I. Avivi, and Y. G. Assaraf Aberrant splicing of folylpolyglutamate synthetase as a novel mechanism of antifolate resistance in leukemia Blood, April 30, 2009; 113(18): 4362 - 4369. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |