Cancer Research Cancer Epigenetics  Telomeres
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Perry, W. L.
Right arrow Articles by Dantzig, A. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Perry, W. L., III
Right arrow Articles by Dantzig, A. H.
[Cancer Research 65, 6593-6600, August 1, 2005]
© 2005 American Association for Cancer Research


Molecular Biology, Pathobiology and Genetics

Human Splicing Factor SPF45 (RBM17) Confers Broad Multidrug Resistance to Anticancer Drugs When Overexpressed— a Phenotype Partially Reversed By Selective Estrogen Receptor Modulators

William L. Perry, III1, Robert L. Shepard1, Janardhan Sampath1, Benjamin Yaden1, William W. Chin1, Philip W. Iversen1, Shengfang Jin2, Andrea Lesoon2, Kathryn A. O'Brien1, Victoria L. Peek1, Mark Rolfe2, Andrew Shyjan2, Michelle Tighe2, Mark Williamson2, Venkatesh Krishnan1, Robert E. Moore1 and Anne H. Dantzig1

1 Lilly Research Laboratories, Eli Lilly and Co., Indianapolis, Indiana and 2 Millennium Pharmaceuticals, Cambridge, Massachusetts

Requests for reprints: William L. Perry III, Lilly Research Laboratories, Eli Lilly and Co., Indianapolis, IN 46285. Phone: 317-276-1083; Fax: 317-433-2815; E-mail: bperry{at}lilly.com.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The splicing factor SPF45 (RBM17) is frequently overexpressed in many solid tumors, and stable expression in HeLa cells confers resistance to doxorubicin and vincristine. In this study, we characterized stable transfectants of A2780 ovarian carcinoma cells. In a 3-day cytotoxicity assay, human SPF45 overexpression conferred 3- to 21-fold resistance to carboplatin, vinorelbine, doxorubicin, etoposide, mitoxantrone, and vincristine. In addition, resistance to gemcitabine and pemetrexed was observed at the highest drug concentrations tested. Knockdown of SPF45 in parental A2780 cells using a hammerhead ribozyme sensitized A2780 cells to etoposide by ~5-fold relative to a catalytically inactive ribozyme control and untransfected cells, suggesting a role for SPF45 in intrinsic resistance to some drugs. A2780-SPF45 cells accumulated similar levels of doxorubicin as vector-transfected and parental A2780 cells, indicating that drug resistance is not due to differences in drug accumulation. Efforts to identify small molecules that could block SPF45-mediated drug resistance revealed that the selective estrogen receptor (ER) modulators tamoxifen and LY117018 (a raloxifene analogue) partially reversed SPF45-mediated drug resistance to mitoxantrone in A2780-SPF45 cells from 21-fold to 8- and 5-fold, respectively, but did not significantly affect the mitoxantrone sensitivity of vector control cells. Quantitative PCR showed that ERß but not ER{alpha} was expressed in A2780 transfectants. Coimmunoprecipitation experiments suggest that SPF45 and ERß physically interact in vivo. Thus, SPF45-mediated drug resistance in A2780 cells may result in part from effects of SPF45 on the transcription or alternate splicing of ERß-regulated genes.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Although chemotherapy is the most effective treatment for some cancers, drug resistance remains a significant obstacle to obtaining a complete response in many patients. Cancer cells can be drug resistant at presentation (intrinsic resistance) or may develop resistance during therapy or upon relapse (acquired resistance). Cancer cells may also acquire resistance to many structurally unrelated drugs with different mechanisms of action, and this is called multidrug resistance (MDR). Several different mechanisms for developing MDR have been described (1, 2), including reduced drug uptake and increased drug efflux. Increased expression of ATP-binding cassette (ABC) transporters, such as P-glycoprotein (Pgp) and multidrug resistance protein 1 (MRP1), are often detected in cell lines selected for resistance by continuous exposure to increasing doses of drugs in cell culture, and MDR results from their ability to pump many different classes of anticancer drugs out of the cell (3, 4). An alternate strategy for generating cell-based drug resistance models that may more closely model clinical drug resistance has been the selection in vivo by repeated drug treatment of tumor-bearing animals. This strategy was used to generate drug-resistant sublines of the mouse mammary carcinoma cell line EMT-6 (5).

In our first article, we reported the use of suppression subtractive hybridization to investigate the mechanisms of drug resistance in EMT-6 tumor cells selected for resistance to cyclophosphamide in vivo (6). Sequencing of clones selected for increased expression in EMT-6/cyclophosphamide cells identified a gene encoding a protein with significant homology to the Arabidopsis DNA damage repair protein DRT111 (7). While this work was in progress, Neubauer et al. identified this protein as a component of the RNA splicing complex known as the spliceosome through mass spectrometry analysis of splicing complexes assembled in vitro (7). They named this protein SPF45 (splicing factor 45 kDa). It has since been given the official human gene symbol RBM17, which stands for RNA-binding motif protein 17. Although we found that SPF45 is predominantly expressed in ductal epithelial cells of the breast, liver, pancreas, and prostate in normal tissues, SPF45 is frequently overexpressed in human cancers, including bladder, breast, colon, lung, ovarian, pancreas, and prostate carcinomas (6), suggesting a possible clinical role for this protein in drug resistance to anticancer agents in these cancers. To examine the possible role of SPF45 in drug resistance, we generated a stable transfectant of a human SPF45 expression construct in HeLa cells and examined drug sensitivity relative to a transfectant of the empty vector. Overexpression of human SPF45 was sufficient to confer resistance to two anticancer drugs with different mechanisms of action, doxorubicin and vincristine (6). To our knowledge, this was the first study demonstrating that overexpression of a splicing factor is sufficient to confer a multidrug-resistant phenotype to transfected cells.

SPF45 contains a RNA recognition motif (RRM) and a G-patch sequence, both putative RNA-binding motifs (8, 9). Neubauer et al. (7) found that a green fluorescent protein (GFP)-SPF45 fusion protein colocalized with U1A small nuclear ribonucleoprotein in nuclear speckles (7), structures enriched in components of the splicing machinery (10, 11). Using confocal microscopy, we reported that native SPF45 also colocalizes with serine/arginine–rich (SR protein) splicing factors in the nucleus in speckles (6). Recently, SPF45 was implicated as a second-step splicing factor required for activating proximal AG splice-acceptor sites for the splicing of some transcripts, including the Drosophila Sex-lethal gene and a variant of the human ß-globin gene present in some ß-thalassemia patients (12). Although most known mechanisms of regulating mRNA splicing occur at the earliest stages of spliceosome assembly, SPF45 directly participates in the selection of the AG that is used for exon ligation at the second catalytic step of splicing after intron removal has begun, representing a new mechanism of splicing regulation (12, 13).

In addition to splicing factors like SPF45, several proteins originally identified as transcriptional coregulators of nuclear hormone receptors (NHR) also contain one or more RRMs and other domains characteristic of splicing factors (14). Two of these RRM-containing coactivators, peroxisome proliferator-activated receptor-{gamma} coactivator-1 (PGC-1) and coactivator activator (CoAA), can also act as splicing factors that affect the alternate splicing of genes under the control of hormone-regulated promoters (14, 15). Some coactivators may only be able to regulate the alternate splicing of a gene when recruited to a transcriptional complex through interactions with NHRs and not when a gene is expressed from a ubiquitous promoter (14). The fact that SPF45 contains a RRM domain like PGC-1 and CoAA raises the intriguing possibility that SPF45 might also have dual activities as a splicing factor and as a NHR coregulator.

In the present study, we show that stable transfection of SPF45 expression constructs is sufficient to confer a broad multidrug-resistant phenotype to a second cell line, A2780 ovarian carcinoma cells, and that knockdown of endogenous SPF45 in A2780 parental cells results in increased drug sensitivity. SPF45 overexpression does not seem to affect the levels of intracellular drug accumulation, a common mechanism of developing drug resistance. The drug-resistant phenotype was partially reversed using selective estrogen receptor (ER) modulators and SPF45 immunoprecipitated with ERß, suggesting that these proteins physically interact in vivo. Hence, SPF45-mediated drug resistance in A2780 cells may result in part from direct effects of SPF45 on ERß-mediated transcription and on the alternate splicing of genes under the control of ERß-regulated promoters.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials. Vincristine sulfate, etoposide, 5-fluorouracil (5-FU), doxorubicin-HCl, mitoxantrone dihydrochloride, sodium orthovanadate, tamoxifen, and 17ß-estradiol (E2) were purchased from Sigma-Aldrich (St. Louis, MO). Cisplatinum, vinorelbine tartrate, and carboplatin were obtained from AmerisourceBergen Corp. (Valley Forge, PA). Paclitaxel was purchased from ICN Biochemicals, Inc. (St. Louis, MO). LY117018 [a benzothiophene raloxifene analogue, 6-hydroxy-2-(p-hydroxyphenyl)benzo(b)thien-3-yl-p-2-(L-pyrrolidinyl)ethoxy phenyl ketone], LY335984 (a potent Pgp modulator with the Ki value of 0.053 mmol/L; refs. 1618), (2R)-anti-5-{3-[4-(10,11-dichloromethanodibenzo-suber-5-yl)piperazin-1-yl]-2-hydroxypropoxy}quinoline trihydrochloride, LY487355 [a potent MRP1 modulator in the tricyclic isoxazole class (19) with a Ki of 0.034 µmol/L,3 N-[3-(9-chloro-3-methyl-4-oxo-4H-isoxazolo[4,3]quinolin-5yl)-cyclohexylmethyl]-6-fluoro-nicotinamide], pemetrexed, and gemcitabine were synthesized at Lilly Research Laboratories (Indianapolis, IN). Fetal bovine serum (FBS) and charcoal/dextran treated (CDT)-FBS were purchased from Hyclone (Logan, UT). FuGene 6 was purchased from Roche Diagnostics Corp. (Indianapolis, IN). PBS, trypsin-EDTA, LipofectAMINE Plus, LipofectAMINE 2000, G418, and all other cell culture reagents were purchased from Invitrogen (Carlsbad, CA).

Cell culture. A2780 human ovarian carcinoma cells and 2780AD cells (the Pgp-expressing variant selected in cell culture for resistance to Adriamycin) were provided by Dr. Thomas Hamilton (Fox Chase Cancer Center, Philadelphia, PA). A2780 cells were grown in RPMI 1640 containing L-glutamine supplemented with 10% FBS and 1 µg/mL insulin. 2780AD cells were maintained as described (18). HeLa cells were grown in DMEM containing 10% CDT-FBS, 2 mmol/L L-glutamine, 0.1 mmol/L nonessential amino acids, 10 mmol/L HEPES buffer (pH 7.5), and 1 mmol/L sodium pyruvate.

Western analysis. Cells were lysed in a buffer containing 10 mmol/L Tris (pH 7.4), 1% SDS, and 1 mmol/L sodium orthovanadate and protease inhibitors (EDTA-Free Complete Protease Inhibitor Cocktail, Roche Diagnostics) by vortexing and spinning lysate through a QIAshredder column (Qiagen, Valencia, CA) in a microfuge at 12,000 rpm for 5 minutes. Protein concentrations were determined using the detergent-compatible protein assay kit (Bio-Rad Laboratories, Hercules, CA) or the bichinonic acid protein assay kit (Pierce-Endogen, Rockford, IL). Proteins were resolved on Novex 4% to 20% Tris-glycine gels (Invitrogen) and transferred to nitrocellulose. Membranes were blocked in either PBST [PBS (136.9 mmol/L NaCl, 1.47 mmol/L KH2PO4, 8.1 mmol/L Na2HPO4, 2.68 mmol/L KCl) and 0.1% Tween 20)] or T-TBS [154 mmol/L NaCl, 100 mmol/L Tris-HCl (pH 7.4), 0.1% Tween 20)] containing 2.5% nonfat dry milk. Membranes were probed with either a SPF45 rabbit polyclonal antibody described previously (6) or with a ß-actin antibody (Sigma-Aldrich) diluted in the same solution used for blocking followed by incubation with peroxidase-conjugated secondary antibodies. Protein bands were visualized using the enhanced chemiluminescence-chemiluminescence system (Amersham Biosciences, Chicago, IL) or the SuperSignal West Pico Chemiluminescence reagent (Pierce-Endogen).

Northern analysis. Total RNA was isolated from tissue culture cells using RNeasy (Qiagen), resolved on formaldehyde agarose gels, and transferred to Hybond N+ nylon membranes (Amersham Biosciences) using the PosiBlot pressure blotter (Stratagene, La Jolla, CA) followed by cross-linking using a Stratalinker (Stratagene). The SPF45 cDNA was labeled as a probe using the Prime-It RmT random priming labeling kit (Stratagene) an [{alpha}-32P]dCTP (Amersham Biosciences). Filters were hybridized in rapid hybridization buffer (Amersham Biosciences) and washed according to manufacturer's instructions. Radioactive hybridization signals were captured by a Fuji BAS 2500 PhosphorImager (Fuji Medical Systems, Stamford, CT).

A2780 SPF45 transfectants. A2780 cells were transfected with pMiNeo-hSPF45 (6) or the empty vector using LipofectAMINE 2000 according to the supplied protocols. Cells were put under neomycin selection 48 hours after transfection by adding G418 to 600 µg/mL. Single colonies were expanded and expression levels of SPF45-IRES-neo transcripts relative to the shorter endogenous SPF45 transcript levels were determined by Northern hybridizations to a labeled SPF45 cDNA probe.

SPF45-targeted ribozyme. The pcDNA3.1-triple ribozyme 8 (TRz8) construct based on the work of Benedict et al. (20) was constructed from overlapping oligonucleotides and cloned into the vector pcDNA3.1 (Invitrogen). Self-cleavage of the primary transcript by the 5' and 3' ribozymes result in release of the internal SPF45 targeted ribozyme. The sequence of the triple ribozyme is as follows where the 5' and 3' ribozymes are shown in bold and catalytically essential residues (20) of the internal ribozyme are underlined: 5'-GGCCCUGAUGAGUCCGUGAGGACGAAACUUGGCCCGGCCAAGUCGGCCUGUCUGUCUUCUGAUGAGCAUGAGCAUGCGAAACGCCUUUUUGGCCGUCUUGGCCUCUAGAGGCCAACUGAUGAGUCCGUGAGGACGAAACGGCC-3'.

The internal ribozyme sequences 5'-UGUCUGUCUU-3' and 5'-ACGCCUUUUU-3' are homologous to the human SPF45 mRNA (Genbank accession no. NM_032905). A control construct encoding a catalytically inactive internal ribozyme that was designed to bind but not cleave the SPF45 mRNA [pcDNA3.1-TRz8 mutant (TRz8M)] was generated by mutating the catalytically essential G and A nucleotides to A and G, respectively. Stable transfectants of both constructs were generated as described above.

Cytotoxicity assays. The CellTiter 96 (Promega Corp., Madison, WI) or the WST-1 (Roche Diagnostics) cell proliferation assays were used to determine resistance of the transfected cells or parental A2780 cells to various chemotherapeutic agents in 96-well plates. The cells were plated at 10,000 cells per well in the medium detailed above in the absence of G418. Twenty-four hours after seeding, the cells were exposed to anticancer drugs and incubated for an additional 72 hours before assaying for cell viability. Resistance was determined in at least two experiments done in duplicate. EC50 values (the concentration of drug that results in 50% of maximal growth inhibition) were calculated using a four-parameter logistic fit, and data from multiple experiments were used to calculate mean EC50 values ± SE.

The significance of changes in EC50 values was evaluated using the Student's t test or by the use of confidence intervals for the difference of two log(EC50) values based on the between-experiment SEs as noted in the tables. To calculate these confidence intervals, the end points of these intervals were anti-logged to convert back to the EC50 scale, resulting in a multiplicative confidence interval for the ratio of 2 EC50 values (fold resistance). Two EC50 values were deemed statistically significantly different if this interval did not contain the value, 1. EC50 values from single experiments were compared using the curve fit SEs analyzed on the log-EC50 scale (Table 3).


View this table:
[in this window]
[in a new window]

 
Table 3. Effect of selective ER modulators tamoxifen and LY117018 (a raloxifene analogue) on SPF45-mediated drug resistance

 
Intracellular drug accumulation. A2780, A2780-SPF45, A2780-Vector, and 2780AD cells (1 x 105) were plated in six-well dishes in the medium with or without G418 as described above and incubated overnight at 37°C in 5% CO2. Doxorubicin was added to 50 µg/mL and incubated for 1, 3, 6, or 9 hours or overnight. Cells were removed from dishes by incubating with 0.05% trypsin-EDTA and pelleted by centrifugation. The pellet was washed twice with PBS containing 5% FBS followed by centrifugation and was resuspended in 1 mL of the same solution and kept on ice. Doxorubicin fluorescence was detected by fluorescence-activated cell sorting (FACS) on a LSR flow cytometer running CellQuest software (BD Biosciences, San Jose, CA) using 550 to 600 nm cutoff filters. Data were analyzed using WinList software (Verity Software House, Topsham, ME). The medium level of fluorescence intensity of ~2 x 105 cells were plotted based on geoMean X of gated region R2 and compared with the untreated samples gated in the same way.

Coimmunoprecipitation. An ovarian cDNA library K-1421-1 (Clontech, Palo Alto, CA) was used to isolate a cDNA encoding the full-length human ERß protein identical to that reported in Genbank (accession no. AB006590). This cDNA was cloned into the HindIII site of pcDNA3.1(+) (Invitrogen) behind the cytomegalovirus promoter to generate the ERß expression plasmid pMK104.

HeLa cells (1 x 106) were plated into 100 mm dishes and transfected using FuGene the next day during a 5-hour incubation at 37°C. Transfected cells were incubated overnight in fresh growth medium followed by growth in medium containing 100 nmol/L E2 or an equal volume of DMSO for additional 24 hours. Cells were transfected with either 5 µg pMK104 (ERß expression plasmid) plus 5 µg EW1969-hisB-SPF45 (SPF45 expression plasmid) or 5 µg pcDNA3.1-GFP plus 5 µg EW1969 vector control DNA. Cells were washed in 1x PBS containing 1 mmol/L sodium orthovanadate and lysed in radioimmunoprecipitation assay (RIPA) buffer [20 mmol/L Tris-HCl (pH 7.5), 5 mmol/L EDTA, 150 mmol/L NaCl, 10 mmol/L sodium pyrophosphate, 50 mmol/L NaF, 1% NP40, 2 mmol/L sodium orthovanadate, protease inhibitor cocktail (Roche Diagnostics)] by repeated freeze-thaw cycles using dry ice. The lysate was centrifuged at 14,000 rpm and the protein concentration of the supernatant was determined using the Coomassie (Bradford) protein assay kit (Pierce-Endogen).

A polyclonal antibody to ERß or normal rabbit IgG (Santa Cruz Biotechnology Inc., Santa Cruz, CA) was conjugated to biomagnetic particles (BMP) containing autoreactive aldehyde groups (Rockland Immunochemicals, Gilbertsville, PA) according to supplied protocols. For immunoprecipitation, cell lysate (1 mg) was added to 110 µL of the antibody-conjugated BMPs, IgG-conjugated BMPs, or unconjugated BMPs (after reactive groups were blocked), and TET buffer (1x TBS + 0.1% Tween 20 + 5 mmol/L EDTA) was added to a total volume of 1.5 mL. The lysates were mixed for 20 hours at 4°C. BMPs were washed thrice in TET buffer and once in 2x SDS sample buffer to recover bound proteins. Western analysis was done as described above using a mouse monoclonal antibody against SPF45. Total lysate from ERß plus SPF45–transfected and E2-stimulated cells (50 µg) was included on Western blots to provide a reference to the level of SPF45 in the lysate.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Overexpression of SPF45 confers a multidrug-resistant phenotype to A2780 ovarian carcinoma cells. We showed previously that transfection of SPF45 was sufficient to confer vincristine and doxorubicin resistance to HeLa cells (6). To further explore the role of SPF45 as a drug resistance gene, we transfected a different cell line, A2780 ovarian carcinoma cells, with SPF45 expression constructs. Ninety-three clones were screened by Northern hybridizations to a SPF45 cDNA probe to identify transcripts derived from the transfected construct as well as the lower molecular weight transcripts of the endogenous gene. SPF45 transcripts derived from the expression construct were detected in approximately two-thirds of the clones but often at lower levels than endogenous SPF45 transcripts (data not shown).

Twenty-two independent clones with elevated SPF45 expression levels were screened for drug resistance to doxorubicin and etoposide in cytotoxicity assays done once, and 20 of these were resistant to both drugs (data not shown). Four of these clones were analyzed in additional cytotoxicity assays and found to be 14- to 18-fold resistant to mitoxantrone, 3- to 5-fold resistant to doxorubicin, 3- to 12-fold resistant to etoposide, and 3- to 5-fold resistant to cisplatinum. Resistance values for individual clones are given in a footnote to Table 1. One of these, clone 51, with stable overexpression of SPF45 at high levels (A2780-SPF45) was selected for further study. A2780-SPF45 cells and a stable transfectant of the empty vector (A2780-Vector) had similar doubling times of 21 and 23 hours, respectively. A2780-SPF45 cells had increased expression of SPF45 relative to A2780-Vector cells when analyzed by Western using a SPF45 polyclonal antibody and a ß-actin antibody to control for protein loading (Fig. 1A).


View this table:
[in this window]
[in a new window]

 
Table 1. Drug sensitivity of A2780-SPF45 cells

 


View larger version (17K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. SPF45 overexpression confers drug resistance to A2780 ovarian carcinoma cells. A, SPF45 expression in A2780 cells stably transfected with empty vector (Vector) or the SPF45 expression vector (SPF45) was detected on Western blots using SPF45 polyclonal antisera. Blots were reprobed with a ß-actin antibody to control for protein loading. B-D, A2780-Vector and A2780-SPF45 cells were grown for 3 days in the presence of increasing concentrations of vincristine (B), gemcitabine (C), or pemetrexed (D). B, points, average of duplicate determinations; bars, range. Representative of eight independent experiments. C and D, points, mean for quadruplicate points; bars, SE. Representative of three independent experiments measured in quadruplicate. *, P < 0.05, the value for A2780-SPF45 cells was significantly different from the A2780-Vector cells by Student's t test.

 
In cytotoxicity assays, A2780-SPF45 cells were 2.8- to 20.9-fold resistant relative to A2780-Vector cells to several drugs with different mechanisms of action. A representative survival curve for vincristine is shown in Fig. 1B. EC50 and fold resistance values for seven anticancer drugs (paclitaxel, carboplatin, vinorelbine, doxorubicin, etoposide, mitoxantrone, and vincristine) are shown in Table 1. A2780-SPF45 cells were resistant to six drugs (P < 0.05) but were not resistant to paclitaxel (Table 1). Results from a single experiment also found that A2780-SPF45 cells were not resistant to 5-FU but were ~5-fold resistant to cisplatinum. Sensitivity to gemcitabine and pemetrexed was also determined. As shown in Fig. 1C and D, the dose-response survival curves for gemcitabine and pemetrexed were only significantly different in the two transfectants at the highest drug concentrations where cell survival plateaued. Survival was significantly different at ≥0.02 µmol/L for gemcitabine and ≥0.12 µmol/L for pemetrexed (P < 0.05). Taken together, these data indicate that overexpression of SPF45 in A2780 cells confers MDR.

Ribozyme knockdown of SPF45 sensitizes A2780 cells to etoposide. To further explore the relationship between SPF45 levels in A2780 cells with sensitivity to anticancer drugs, we developed a ribozyme strategy for decreasing SPF45 mRNA levels and SPF45 protein. Based on the work of Benedict et al. (20), we designed a mammalian expression construct that would produce a primary transcript containing three tandem hammerhead ribozyme catalytic regions (a triple ribozyme; see Fig. 2A). The 5' and 3' ribozymes were targeted to the primary triple ribozyme transcript, resulting in self-cleavage and release of the internal SPF45-targeted ribozyme. Stable transfectants of A2780 cells were generated with constructs expressing the active SPF45-targeted ribozyme TRz8 and with a construct expressing a catalytically inactive ribozyme TRz8M as a control that was designed to bind but not cleave SPF45 mRNA (see Materials and Methods). A slight reduction in SPF45 protein levels was noted in A2780-TRz8M cells relative to parental A2780 cells (Fig. 2B), but this had little effect on drug sensitivity to etoposide (Fig. 2C); only two of seven data points were significantly different by the Student's t test (P < 0.05). However, a pronounced reduction in SPF45 protein levels was detected in A2780-TRz8 cells relative to A2780-TRz8M and A2780 parental cells by Western analysis (Fig. 2B). This resulted in increased etoposide sensitivity relative to A2780-TRz8M and A2780 parental cells with the EC50 decreased ~5-fold by TRz8 expression (Fig. 2C).



View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Ribozyme knockdown of SPF45 sensitizes cells to etoposide. A, triple ribozyme (TRz) expression constructs were based on the work of Benedict et al. (20). The 5' and 3' ribozymes cleave the primary transcript to release an internal ribozyme that binds to and cleaves human SPF45 mRNA. The positions of ribozyme bases mutated to create a catalytically inactive ribozyme control are marked by asterisks. See Materials and Methods for the ribozyme sequence and location of the mutated bases. B, SPF45 expression in A2780 parental cells (A2780) and in A2780 cells stably transfected with the SPF45 ribozyme 8 (TRz8) expression construct or with the catalytically inactive ribozyme control (TRz8M) expression construct was determined by Western blotting with SPF45 polyclonal antisera. Blots were reprobed with a ß-actin antibody to control for protein loading. C, survival curves for exponentially growing A2780 cells or for A2780 cells stably transfected with the mutant ribozyme control TRz8M or the SPF45 ribozyme TRz8 in the presence of etoposide. Points, mean of triplicate determinations; bars, SE. *, P < 0.05, the value was significantly different from the A2780-parental cells by Student's t test.

 
Increased SPF45 expression in A2780 cells does not affect drug accumulation. One common way that cells can become multidrug resistant to anticancer drugs is through the increased expression of ATP-dependent transporters like Pgp or MRP1 that pump a structurally diverse set of drugs out of the cell (1, 21, 22). Overexpression of either transporter confers resistance to vincristine and doxorubicin (1, 3, 23). It was possible that SPF45 overexpression increased the expression of these or other transporters in A2780-SPF45 cells. To determine whether changes in the activity of these transporters could partially explain SPF45-mediated drug resistance, the effect of a potent and selective inhibitor of Pgp (LY335984) with a Ki of 0.053 µmol/L (16) and a potent MRP1 inhibitor (LY487355) with a Ki of 0.034 µmol/L was examined. As shown in Table 2, neither modulator had a significant effect on EC50 values for vincristine (P > 0.5). To further explore whether drug accumulation was affected by SPF45 overexpression, the time-dependent intracellular accumulation of the naturally fluorescent anticancer drug doxorubicin was measured in SPF45, vector-transfected, and parental A2780 cells and in Pgp-expressing 2780AD cells (Fig. 3). Fluorescence increased in three cell lines over time, whereas fluorescence remained low in 2780AD cells that express Pgp. Furthermore, drug accumulation was not significantly different among SPF45, vector-transfected, and parental A2780 cells (Fig. 3). Taken together, these data show that SPF45-mediated drug resistance in A2780 cells is not the result of decreased drug accumulation.


View this table:
[in this window]
[in a new window]

 
Table 2. Effect of inhibitors of Pgp and MRP1 on drug resistance in A2780-SPF45 cells

 


View larger version (15K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Doxorubicin accumulation in A2780 cell lines. The mean fluorescence of A2780 parental cells, A2780-Vector, A2780-SPF45, and Pgp-expressing 2780AD cells was determined by FACS analysis after incubation with 50 µg/mL doxorubicin for the intervals indicated.

 
Estrogen receptor modulators partially reverse SPF45-mediated drug resistance in A2780 cells. The recent demonstration that some RRM-containing transcriptional coregulators of NHRs can act as alternative splicing factors of NHR-regulated genes (14, 15) suggested that SPF45 might also have dual activities as a splicing factor and as a NHR coregulator. If this were true, NHR modulators might be predicted to alter the SPF45-mediated, drug-resistant phenotype. Transcriptional profiling of A2780-Vector and A2780-SPF45 cell lines indicated that ERß is expressed at reasonable levels in these cell lines, and this was confirmed by Taqman quantitative PCR assays (data not shown). In contrast, ER{alpha} was not expressed by these cells when analyzed by Taqman (data not shown) in agreement with previous reports that A2780 is ER{alpha} negative (24). Hence, the role of ERß in SPF45-mediated drug resistance in these cells could be investigated using ERß modulators.

We evaluated the effect of the mixed agonist-antagonists of ERß, tamoxifen, and LY117018 (a raloxifene analogue) on the drug sensitivity of the A2780 transfectants. Both compounds increased the drug sensitivity of A2780-SPF45 cells to mitoxantrone up to ~4-fold (Table 3). LY117018 achieved significant sensitization of A2780-SPF45 cells at the lowest concentration tested (0.185 µmol/L) compared with tamoxifen that achieved significant sensitization at ~10-fold higher concentration (1.67 µmol/L). Moreover, these compounds did not significantly affect the mitoxantrone sensitivity of A2780-Vector cells at any of the concentrations tested (Table 3). These results suggest a possible involvement of the ERß signaling pathway in SPF45-mediated drug resistance.

SPF45 interacts with ERß. To further explore the relationship between ERß and SPF45, immunoprecipitation experiments were done to look for physical interaction of these proteins in vivo. ERß and SPF45 expression plasmids were cotransfected into HeLa cells, and cells were treated with E2 or DMSO (as a vehicle control) 24 hours later. As a negative control, HeLa cells were also transfected with a GFP expression plasmid and EW1969 vector control plasmid. For immunoprecipitation, lysates were incubated with ERß polyclonal antibody–conjugated BMPs, normal rabbit IgG, or unconjugated BMPs followed by sedimentation of antibody-bound complexes under a magnetic field and Western analysis with a SPF45 monoclonal antibody. SPF45 was coimmunoprecipitated with ERß using the ERß antibody BMPs in samples from ERß plus SPF45 transfections but not from the GFP plus vector control transfection (Fig. 4). SPF45 was also not precipitated when ERß antibody BMPs were replaced by IgG-BMPs or unconjugated BMPs. The ERß-SPF45 interaction was not ligand dependent, but less SPF45 was precipitated from DMSO-treated cells than from E2-stimulated cells (Fig. 4). These results suggest that SPF45 and ERß can physically interact in vivo.



View larger version (23K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. Coimmunoprecipitation of ERß and SPF45. HeLa cells were transfected with ERß and SPF45 expression construct or with a GFP expression plasmid and EW1969 vector control plasmid followed by incubation with 100 nmol/L E2 or DMSO as indicated. Lysates were incubated with BMPs conjugated to an ERß-antibody, normal rabbit IgG, or unconjugated BMPs. Captured proteins and total cellular lysate controls were analyzed by Western using a SPF45 monoclonal antibody.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the present study, we report the characterization of SPF45 transfectants of A2780 ovarian carcinoma cells and explore possible mechanisms for SPF45-mediated MDR. SPF45 overexpression conferred resistance to several drugs with different mechanisms of action, including a DNA cross-linker (carboplatin), a topoisomerase II inhibitor (etoposide), DNA intercalators (doxorubicin and mitoxantrone), a DNA synthesis inhibitor (gemcitabine), microtubule polymerization inhibitors (vincristine and vinorelbine), and a multitargeted antifolate (pemetrexed). A2780-SPF45 cells were not resistant to paclitaxel, a microtubule depolymerization inhibitor. Results from a single experiment also found that A2780-SPF45 cells were not resistant to 5-FU (a DNA synthesis inhibitor) but were ~5-fold resistant to cisplatinum (a DNA cross-linker; data not shown). MDR was also observed in 19 additional A2780 SPF45 transfectants, ruling out insertional mutagenesis and integration-position effects on host genes as explanations for the multidrug-resistant phenotype. In addition, the knockdown of SPF45 levels in parental A2780 cells with a hammerhead ribozyme resulted in increased sensitivity to etoposide, indicating a role for SPF45 in regulating intrinsic resistance to some drugs as well.

To investigate the mechanism of SPF45-mediated drug resistance, we determined whether SPF45 overexpression increased the activity of one or more ABC transporters that resulted in drug resistance by decreasing the intracellular concentrations of chemotherapeutic drugs through active efflux. Several ABC transporters are known to confer resistance to anticancer drugs, including Pgp (ABCB1), members 1 to 8 of the cystic fibrosis transmembrance conductance regulator/MRP1 family (ABCC1-6, ABCC10, and ABCC11), and BCRP (ABCG2; refs. 1, 3, 4, 2534). However, this possibility was ruled out. Drug sensitivity was not modulated by potent Pgp and MRP1 inhibitors. In addition, doxorubicin accumulation in A2780-SPF45 cells was unaltered from that in A2780-Vector and A2780 parental cells, although doxorubicin is a substrate of several ABC transporters. Furthermore, transcriptional profiling failed to detect changes in the abundance of transcripts encoding any of these ABC transporters that could explain resistance to chemotherapeutic agents.4 These data strongly argue against increased drug efflux as a mechanism of SPF45-mediated drug resistance.

Although SPF45 has an established role as a RNA splicing factor, it seems possible that SPF45 could have another role as a coregulator of NHRs. Like SPF45, several coregulators have RRM and other RNA-binding motifs (14). Furthermore, two NHR coregulators with RRM domains (PGC-1 and CoAA) can also act as alternate splicing factors that affect the alternate splicing of genes with hormone-responsive promoters (14, 15). Interestingly, several coactivators that affected the alternate splicing of model genes when expressed from NHR-regulated promoters had no effect on splicing when the same genes were transcribed from a ubiquitous promoter (14). Recruitment of coactivators by activated NHRs may be necessary for the involvement of these coactivators in regulating the splicing of some genes. If SPF45 was involved in the splicing or transcriptional regulation of hormone-responsive promoters, we reasoned that modulators of NHR activity might affect the SPF45-mediated, drug-resistant phenotype in A2780-SPF45 cells. Quantitative PCR indicated that A2780-Vector and A2780-SPF45 cells express ERß (but not ER{alpha}), allowing the use of selective ER modulators to test this hypothesis.

We evaluated the effect of mixed agonist-antagonists of both ER{alpha} and ERß on the drug sensitivity of A2780 transfectants. Tamoxifen and LY117018 (a raloxifene analogue) partially reversed the SPF45-mediated resistance to mitoxantrone in A2780-SPF45 cells from 21-fold to as low as 8- and 5-fold, respectively, while not significantly affecting the mitoxantrone sensitivity of A2780-Vector cells. One interpretation of these results is that SPF45 overexpression in A2780 cells affects the ERß signaling pathway in a way that contributes to the drug-resistant phenotype. We also showed that SPF45 could be immunoprecipitated with ERß from cellular lysates using an ERß polyclonal antibody, providing evidence that SPF45 and ERß interact in vivo. Thus, SPF45 may have a direct effect on the regulation of transcription and/or splicing of ERß-regulated genes.

Our working model is that SPF45 overexpression causes changes in the splicing pattern of some genes through its activity as an alternate splicing factor and potentially also affects the transcriptional abundance of other transcripts through effects on ERß and possibly other NHRs. The affected genes could directly or indirectly affect the resistance of the cell to one or several anticancer agents; the effects on several genes would together result in the broad multidrug-resistant phenotype observed here. As discussed above, we found no evidence that SPF45 overexpression affects the genes encoding ABC transporters that can cause drug resistance through decreasing intracellular drug accumulation. Other mechanisms of drug resistance include increased repair of drug-induced cellular damage, activation of coordinately regulated detoxification systems, and changes in apoptotic signaling pathways (1). SPF45 overexpression could affect one or more of these processes. For example, some members of the cytochrome P450 family are involved in the metabolism of drugs and xenobiotics. Induction of some of these genes is mediated by NHRs (35) and distinct isoforms of these NHRs are generated through alternate splicing (36, 37). Additionally, alternate splicing is used to generate either proapoptotic or antiapoptotic forms of the BCL-2 family of proteins that are major regulators of apoptotic processes (38, 39). Further studies are needed to identify SPF45 target genes and to discover if SPF45 has any effect on the transcriptional activity of ERß and other NHRs. This research will help elucidate the mechanism(s) of SPF45-mediated MDR.

In summary, SPF45 conferred a broad multidrug-resistant phenotype to A2780 cells when overexpressed, and knockdown of endogenous SPF45 in A2780 parental cells resulted in increased drug sensitivity. Physical interaction of SPF45 and ERß was suggested by coimmunoprecipitation, and ERß modulators partially reversed SPF45-mediated drug resistance. The fact that SPF45 is overexpressed in most tumors derived from seven different tissues (6) suggests that SPF45 up-regulation is a common event in certain tumors. Thus, SPF45 may play an important role in clinical resistance to chemotherapy.


    Acknowledgments
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    Footnotes
 
3 A.H. Dantzig and L. Tabas, unpublished data. Back

4 W.L. Perry and S. Jin, unpublished observations. Back

Received 11/24/04. Revised 4/11/05. Accepted 5/20/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Gottesman MM, Fojo T, Bates SE. Multidrug resistance in cancer: role of ATP-dependent transporters. Nat Rev Cancer 2002;2:48–58.[CrossRef][Medline]
  2. Jones RH, Vasey PA. New directions in testicular cancer; molecular determinants of oncogenesis and treatment success. Eur J Cancer 2003;39:147–56.
  3. Hrycyna CA, Zhang S, Ramachandra M, Ni B, Pastan I, Gottesman MM. Function and molecular characterization of the human multidrug transporter. In: Gupta S, Tsuro T, editors. Multidrug resistance in cancer cells: molecular, biochemical, physiological and biological aspects. New York: Wiley & Sons; 1996. p. 29–38.
  4. Zaman GJR, Borst P. MRP, mode of action and role in MDR. In: Gupta S, Tsuro T, editors. Multidrug resistance in cancer cells: molecular, biochemical, physiological and biological aspects. New York: John Wiley & Sons; 1996. p. 95–108.
  5. Teicher BA, Herman TS, Holden SA, et al. Tumor resistance to alkylating agents conferred by mechanisms operative only in vivo. Science 1990;247:1457–61.[Abstract/Free Full Text]
  6. Sampath J, Long PR, Shepard RL, et al. Human SPF45, a splicing factor, has limited expression in normal tissues, is overexpressed in many tumors and can confer multidrug resistant phenotype to cells. Am J Pathol 2003;163:1781–90.[Abstract/Free Full Text]
  7. Neubauer G, King A, Rappsilber J, et al. Mass spectrometry and EST-database searching allows characterization of the multi-protein spliceosome complex. Nat Genet 1998;20:46–50.[CrossRef][Medline]
  8. Crowder S, Holton J, Alber T. Covariance analysis of RNA recognition motifs identifies functionally linked amino acids. J Mol Biol 2001;310:793–800.[CrossRef][Medline]
  9. Aravind L, Koonin EV. G-patch: a new conserved domain in eukaryotic RNA-processing proteins and type D retroviral polyproteins. Trends Biochem Sci 1999;24:342–4.[CrossRef][Medline]
  10. Carmo-Fonseca M, Tollervey D, Pepperkok R, et al. Mammalian nuclei contain foci which are highly enriched in components of the pre-mRNA splicing machinery. EMBO J 1991;10:195–206.[Medline]
  11. Carmo-Fonseca M, Pepperkok R, Sproat BS, et al. In vivo detection of snRNP-rich organelles in the nuclei of mammalian cells. EMBO J 1991;10:1863–73.[Medline]
  12. Lallena MJ, Chalmers KJ, Llamazares S, Lamond AI, Valcarcel J. Splicing regulation at the second catalytic step by Sex-lethal involves 3' splice site recognition by SPF45. Cell 2002;109:285–96.[CrossRef][Medline]
  13. Graveley BR. Sex, agility, and the regulation of alternative splicing. Cell 2002;109:409–12.[CrossRef][Medline]
  14. Auboeuf D, Honig A, Berget SM, O'Malley BW. Coordinate regulation of transcription and splicing by steroid receptor coregulators. Science 2002;298:416–9.[Abstract/Free Full Text]
  15. Monsalve M, Wu Z, Adelmant G, et al. Direct coupling of transcription and mRNA processing through the thermogenic coactivator PGC-1. Mol Cell 2000;6:307–16.[CrossRef][Medline]
  16. Ekins S, Kim RB, Leake BF, et al. Application of three-dimensional quantitative structure-activity relationships of P-glycoprotein inhibitors and substrates. Mol Pharmacol 2002;61:974–81.[Abstract/Free Full Text]
  17. Pfister JR, Makra F, Muehldorf AV, et al. Methanodibenzosuberylpiperazines as potent multidrug resistance reversal agents. Bioorg Med Chem Lett 1995;5:2473–6.[CrossRef]
  18. Starling JJ, Shepard RL, Cao J, et al. Pharmacological characterization of LY335979: a potent cyclopropyldibenzosuberane modulator of P-glycoprotein. Adv Enzyme Regul 1997;37:335–47.[CrossRef][Medline]
  19. Norman BH, Gruber JM, Hollinshead SP, et al. Tricyclic isoxazoles are novel inhibitors of the multidrug resistance protein (MRP1). Bioorg Med Chem Lett 2002;12:883–6.[CrossRef][Medline]
  20. Benedict CM, Pan W, Loy SE, Clawson GA. Triple ribozyme-mediated down-regulation of the retinoblastoma gene. Carcinogenesis 1998;19:1223–30.[Abstract/Free Full Text]
  21. Ramachandran C, Melnick SJ. Multidrug resistance in human tumors—molecular diagnosis and clinical significance. Mol Diagn 1999;4:81–94.[CrossRef][Medline]
  22. Lockhart AC, Tirona RG, Kim RB. Pharmacogenetics of ATP-binding cassette transporters in cancer and chemotherapy. Mol Cancer Ther 2003;2:685–98.[Abstract/Free Full Text]
  23. Leslie EM, Deeley RG, Cole SP. Toxicological relevance of the multidrug resistance protein 1, MRP1 (ABCC1) and related transporters. Toxicology 2001;167:3–23.[CrossRef][Medline]
  24. Ercoli A, Scambia G, Fattorossi A, et al. Comparative study on the induction of cytostasis and apoptosis by ICI 182,780 and tamoxifen in an estrogen receptor-negative ovarian cancer cell line. Int J Cancer 1998;76:47–54.[CrossRef][Medline]
  25. Adachi M, Reid G, Schuetz JD. Therapeutic and biological importance of getting nucleotides out of cells: a case for the ABC transporters, MRP4 and 5. Adv Drug Deliv Rev 2002;54:1333–42.[CrossRef][Medline]
  26. Sampath J, Adachi M, Hatse S, et al. Role of MRP4 and MRP5 in biology and chemotherapy. AAPS Pharm Sci 2002;4:E14.
  27. Belinsky MG, Chen ZS, Shchaveleva I, Zeng H, Kruh GD. Characterization of the drug resistance and transport properties of multidrug resistance protein 6 (MRP6, ABCC6). Cancer Res 2002;62:6172–7.[Abstract/Free Full Text]
  28. Kawabata S, Oka M, Shiozawa K, et al. Breast cancer resistance protein directly confers SN-38 resistance of lung cancer cells. Biochem Biophys Res Commun 2001;280:1216–23.[CrossRef][Medline]
  29. Nakatomi K, Yoshikawa M, Oka M, et al. Transport of 7-ethyl-10-hydroxycamptothecin (SN-38) by breast cancer resistance protein ABCG2 in human lung cancer cells. Biochem Biophys Res Commun 2001;288:827–32.[CrossRef][Medline]
  30. Turriziani O, Schuetz JD, Focher F, et al. Impaired 2',3'-dideoxy-3'-thiacytidine accumulation in T-lymphoblastoid cells as a mechanism of acquired resistance independent of multidrug resistant protein 4 with a possible role for ATP-binding cassette C11. Biochem J 2002;368:325–32.[CrossRef][Medline]
  31. Zelcer N, Saeki T, Reid G, Beijnen JH, Borst P. Characterization of drug transport by the human multidrug resistance protein 3 (ABCC3). J Biol Chem 2001;276:46400–7.[Abstract/Free Full Text]
  32. Chen ZS, Hopper-Borge E, Belinsky MG, et al. Characterization of the transport properties of human multidrug resistance protein 7 (MRP7, ABCC10). Mol Pharmacol 2003;63:351–8.[Abstract/Free Full Text]
  33. Hooijberg JH, Peters GJ, Assaraf YG, et al. The role of multidrug resistance proteins MRP1, MRP2 and MRP3 in cellular folate homeostasis. Biochem Pharmacol 2003;65:765–71.[CrossRef][Medline]
  34. Evers R, de Haas M, Sparidans R, et al. Vinblastine and sulfinpyrazone export by the multidrug resistance protein MRP2 is associated with glutathione export. Br J Cancer 2000;83:375–83.[CrossRef][Medline]
  35. Pascussi JM, Gerbal-Chaloin S, Drocourt L, Maurel P, Vilarem MJ. The expression of CYP2B6, CYP2C9 and CYP3A4 genes: a tangle of networks of nuclear and steroid receptors. Biochim Biophys Acta 2003;1619:243–53.[Medline]
  36. Savkur RS, Wu Y, Bramlett KS, et al. Alternative splicing within the ligand binding domain of the human constitutive androstane receptor. Mol Genet Metab 2003;80:216–26.[CrossRef][Medline]
  37. Lamba V, Yasuda K, Lamba JK, et al. PXR (NR1I2): splice variants in human tissues, including brain, and identification of neurosteroids and nicotine as PXR activators. Toxicol Appl Pharmacol 2004;199:251–65.[CrossRef][Medline]
  38. Minn AJ, Boise LH, Thompson CB. Bcl-x(S) antagonizes the protective effects of Bcl-x(L). J Biol Chem 1996;271:6306–12.[Abstract/Free Full Text]
  39. Akgul C, Moulding DA, Edwards SW. Alternative splicing of Bcl-2-related genes: functional consequences and potential therapeutic applications. Cell Mol Life Sci 2004;61:2189–99.[Medline]



This article has been cited by other articles:


Home page
BloodHome page
M. Stark, C. Wichman, I. Avivi, and Y. G. Assaraf
Aberrant splicing of folylpolyglutamate synthetase as a novel mechanism of antifolate resistance in leukemia
Blood, April 30, 2009; 113(18): 4362 - 4369.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Perry, W. L.
Right arrow Articles by Dantzig, A. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Perry, W. L., III
Right arrow Articles by Dantzig, A. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online