| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology, Pathobiology and Genetics |
Departments of 1 Interdisciplinary Oncology and 2 Surgery, University of South Florida College of Medicine and H. Lee Moffitt Cancer Center and Research Institute, Tampa, Florida
Requests for reprints: Javier F. Torres-Roca, Department of Interdisciplinary Oncology, University of South Florida College of Medicine and H. Lee Moffitt Cancer Center and Research Institute, 12902 Magnolia Drive, MOD-9, Tampa, FL 33612. Phone: 813-972-8424; Fax: 813-979-7231; E-mail: torresjf{at}moffitt.usf.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The development of a radiation sensitivity predictive assay has been a central goal of radiation biology for several decades (2). The clinical value of a radiation sensitivity predictive assay is significant, as it could potentially lead to better selection of patients for radiotherapy protocols, an improved ability to predict prognosis, and perhaps a decrease in therapy-related side effects. Although a number of approaches have been developed (tumor hypoxic fraction prediction, tumor proliferative potential determination, and determination of tumor inherent radiosensitivity), none have become routine in the clinic (3). There are several reasons for failure; however, it could be argued that a major reason is our limited knowledge of the molecular events that mediate radiation response.
The advent of the functional genomics era has had a significant effect on clinical oncology (4). It is now fairly well established that genomic profiling can distinguish clinical prognostic groups in breast cancer (58), lymphoma (9, 10), prostate cancer (11), and other malignancies (1216). Furthermore, it has been proposed that genomic profiling may lead to the development of classifiers that will predict prognosis based on genomic expression (17). Because classifiers correlate gene expression profiles with an end point, we hypothesized that a radiation sensitivity classifier or predictor could be developed based on cellular gene expression profiles derived from DNA microarrays. This hypothesis is based partly on the fact that the three main mechanisms, which have been proposed to play a role in clinical failure after radiation therapy (hypoxia, intrinsic radiosensitivity, and cellular proliferation), are known to induce genetic change (1824). Furthermore, we reasoned that the development of a genomic-based radiation sensitivity classifier could potentially lead to the identification of novel genes or targets involved in radiation response. If validated, the clinical potential of such an analytic approach would be significant, as it would allow a genome-wide high-throughput analysis of potential targets involved in radiation response.
| Materials and Methods |
|---|
|
|
|---|
Radiation survival assays (survival fraction at 2 Gy). The survival fraction at 2 Gy (SF2) of cell lines used in the classifier was obtained from the literature in 23 of the 35 cell lines in our analysis. For cell lines obtained from the literature, we used articles that reported on clonogenic assays that had been done without the use of any substrate (i.e., agar) and that required cells to be in log phase at the time of irradiation. We also required cell lines to have at least two reported values in the literature by different laboratories. We then determined the mean SF2 reported for each cell line and used this value for the generation of the classifier. The remaining 12 cell lines were done in our lab (MCF-7, MDA-MB-435, KM-12, HOP62, H23, BT549, MDA-MB-231, HCT-116, HT29, H460, OVCAR5, and PC3). Clonogenic survival assays after 2 Gy of radiation were done as previously described (19). Plating efficiency for each cell line was determined before SF2 determination. Cells were plated so that 50 to 100 colonies would form per plate and incubated overnight at 37°C to allow for adherence. Cells were then radiated with 2 Gy using a Cesium Irradiator (J.L. Sheperd, Model I 68A, San Fernando, CA). Exposure time was adjusted for decay every 3 months. After irradiation, cells were incubated for 10 to 14 days at 37°C before being stained with crystal violet. Only colonies with at least 50 cells were counted. SF2 was determined by the following formula:
![]() |
Microarrays. Gene expression profiles were from Affymetrix HU-6800 chips (7,129 genes) from a previously published study (25). These are publicly available as supplementary data to the published study. The gene expression data had been previously preprocessed using the Affymetrix MAS 4.0 algorithm in average difference units. Negative expression values were set to zero and the chips were normalized to the same mean intensity.
RNA isolation, cDNA synthesis, and quantitative real-time PCR. RNA isolation was done as previously described (26). Total RNA was extracted using TRIzol reagent (Life Technologies, Gaithersburg, MD) as recommended by the manufacturer. Briefly, cell lines were resuspended in 1 mL of TRIzol and incubated for 5 minutes at room temperature. After adding 0.25 mL of chloroform, samples were centrifuged at 12,000 x g for 15 minutes at 4°C. The aqueous phase was recovered, and RNA was precipitated with isopropanol (0.5 mL/mL of TRIzol used). The RNA pellet was washed with ice-cold 70% ethanol once and resuspended in diethylpyrocarbonate-treated water.
First-strand cDNA synthesis was done using the Omniscript RT kit (Qiagen, Valencia, CA) as recommended by the manufacturer. In brief, 2 µg of RNA were incubated with 1 µg of Oligo-dT primers in the presence of 500 nmol/L deoxynucleotide triphosphate, 10 units of RNase inhibitor (Qiagen), and 10 units of Omniscript RT in 1x reverse transcription buffer (Qiagen).
Sequencing primers and probes were designed using the PrimerSelect software (Applied Biosystems, Foster City, CA). Each primer set consisted of standard PCR primers designed to span gene exons to exclude any possible genomic DNA contamination. Detection and quantitation of each gene was accomplished using an amplicon-specific fluorescent oligonucleotide probe with a 5'-reporter dye (FAM) and a downstream 3'-quencher dye (BHQ-1). For the construction of standard curves, a cDNA serial dilution was used. Quantitative real-time PCR analyses were done using the ABI PRISM 7700 Sequence Detection System (Applied Biosystems). All samples were tested in 96-well optical reaction plates. PCR was carried out with the Platinum Quantitative PCR SuperMix-UDG (Invitrogen, Carlsbad, CA) using 2 µL of cDNA, 1x primers, and probe in a 25-µL final reaction mixture. After a 2-minute incubation at 50°C, PlatinumTaq was activated by a 10-minute incubation at 95°C followed by 40 PCR cycles consisting of 15 seconds of denaturation at 95°C and hybridization of probe and primers for 1 minute at 60°C. Data were analyzed using SDS software version 2.1 and exported into an Excel spreadsheet. Assays were done in triplicate and the housekeeping gene GAPDH was used to normalize mRNA values.
The sequences for each primer and probe were as follows: ribose 5-phosphate isomerase A (NM_144563)forward primer: 5'-GAACCTCGTCTGTATTCCCACTTC-3', reverse primer: 5'-GGGTCAAGCCATACTGCAGG-3', probe: 5'-FAM/CGTGTCCGGGAGGGCATCAA/BHQ-3'; G-protein signaling regulator 19 (NM_005873)forward primer: 5'-CAAGGAGGTGAGCCTGGACTC-3', reverse primer: 5'-GACGGCTCCTGCATCTTCTT-3', probe: 5'-FAM/CGTGTCCGGGAGGGCATCAA/BHQ-3'; and retinoblastoma binding protein 4 (RbAp48; NM_005610)forward primer: 5'-TCAAGATCAACCATGAAGGAGAAGT-3', reverse primer: 5'-TTTGTTGCGATGATACAAGGGT-3', probe: 5'-FAM/AACAGGGCCCGTTATATGCCCCAG/BHQ-3'.
Western blots. Assays were done as previously described by our group (27). Protein was isolated using lysis buffer which included radioimmunoprecipitation assay buffer [50 mmol/L Tris (pH 7.5), 150 mmol/L NaCl, 0.5% deoxycholate, 1% NP40, 2 mmol/L sodium vanadate], protease inhibitors (leupeptin, antipain, and aprotinin), and phenylmethylsulfonyl fluoride (1 mmol/L). Protein was quantitated using the Bradford assay. Ten micrograms of protein were loaded onto an SDS-PAGE gel, transferred onto nitrocellulose, and probed with the antibody of interest. Anti-RbAp48 was obtained from Upstate (Lake Placid, NY). Total Akt and P-Akt (serine-473) were obtained from Cell Signaling Technology (Beverly, MA). Membranes were then washed, reprobed with a horseradish peroxidase-conjugated secondary antibody (Amersham Biosciences, Piscataway, NJ), and developed with enhanced chemiluminescence (Amersham).
Cloning and transfection of RbAp48. PCR amplification of the cDNA was done using forward primer 5'-atggccgacaaggaagcagc-3' and reverse primer 5'-ctaggacccttgtccttctggat-3'. These primers generated a product of 1,278 bp. The PCR fragment was gel purified using Gel Extraction Kit (Qiagen) and cloned into pcDNA 3.1/V5-His-TOPO vector containing a neomycin-resistant gene (Invitrogen). Ultracompetent cells were transformed with the RbAp48 plasmid and an empty vector (mock). Selection was done with ampicillin. Clones were sequenced to determine that the desired sequences were present and in-frame. Stable RbAp48 transfectants were generated using the Superfect Reagent (Qiagen) following the recommendations of the manufacturer. G418 was used to select transfected colonies. Western blots were done to show overexpression of RbAp48.
Cell cycle analysis. Cells (1 x 106) were fixed in 70% ethanol at 20°C overnight. Cells were then centrifuged at 1,000 rpm for 5 minutes and washed once in PBS. Cells were then resuspended in 1 mL of propidium iodide/Triton X-100 staining solution with RNase A (0.1% Triton X-100, 200 µg/mL DNase-free RNase A, 20 µg/mL propidium iodide) and stained for 30 minutes at room temperature. Analysis was done by flow cytometry at the Flow Cytometry Core at the H. Lee Moffitt Cancer Center and Research Institute.
Statistical analysis and classifier design. We first defined the classification problem by considering the end point variable. Radiation sensitivity in this study was defined as a continuous variable.
The classifier consisted of two distinct components: gene selection and a multivariate linear regression model. The gene selection step was done using the significance analysis of microarrays (SAM) method. SAM tests the correlation between a continuous target variable (radiation response) and the expression levels for a gene. The method involves testing each of the genes one at a time and then performing permutation tests to estimate the false discovery rate that arises from individual testing of 7,129 genes. We selected the number of significant genes corresponding to a target false discovery rate of 5%.
The second step in constructing the classifier is the multivariate linear regression model. Genes selected by the SAM method were used to construct a predictive model of the SF2 values in the training set. Linear regression was used, as implemented by the Weka data mining software (28).
Evaluation of the classifier was done using leave-one-out cross-validation. This process involves repeatedly holding out a single sample from the data set, constructing a classifier on the remaining data, and using the classifier to predict the SF2 level of the held-out sample. An estimate of overall accuracy can be obtained from this approach. Leave-one-out cross-validation can also be used as a method of estimating the overall usefulness of selected genes in the classification. We adopted the technique described by Dyrskjot et al. (29), in which genes that are selected in most of the classifiers constructed (across all 35 leave-one-out iterations) are most likely to be informative.
A correct prediction was defined as any value within ±10% of the measured or reported SF2. This was intended to account for the known variability associated with clonogenic assays, which had been previously reported by Peters to be ±9% (2). However, in 3 of 12 cell lines measured in our laboratory (MDAMB-231, OVCAR5, and PC3), the range of measured SF2s was slightly higher, and thus for these three lines we accepted as correct any value within the actual measured range. Finally, the significance of the classifier results was assessed using a permutation test.
| Results |
|---|
|
|
|---|
|
Identification of gene signature predicting radiosensitivity. Table 1A and B shows the results of leave-one-out cross-validation on our classifier. The classifier correctly predicted SF2 values in 22 of 35 (62%) the cell lines. Thirteen samples were incorrectly classified. Of these, two samples missed their cutoff by <5%. These were cell lines KM-12 (predicted SF2 = 0.56, true SF2 = 0.42, cutoff = 0.52) and SF-539 (predicted SF2 = 0.677, true SF2 = 0.82, cutoff = 0.72). All three leukemia cell lines in our list (HL-60, CCRF-CEM, and MOLT-4) were incorrectly classified as well. However, for two of them (HL-60 and CCRF-CEM), the predicted SF2 was a negative number (0.014 and 0.133, respectively). Therefore, the classifier judged these two cell lines to be in the radiosensitive side of the spectrum, which is indeed true. However, this failed to meet the criteria that we originally defined and thus they were classified as incorrect predictions.
|
|
|
Quantitative PCR validates in silico genomic analysis. To validate our in silico genomic analysis, we determined the expression level of the three known genes selected by our analysis using quantitative real-time PCR. To perform these experiments of validation, for each candidate gene we selected cell lines that were on opposing ends of the radiation sensitivity and gene expression spectrum. As shown in Fig. 2A to C, there was excellent correlation between quantitative real-time PCR and microarrays for all three known genes selected by our analysis. A total of 26 cell lines were assayed (10 lines for RGS19, 8 lines for RbAp48, and 8 lines for R5PIA). Quantitative real-time PCR gene expression values for the gene of interest in 22 of the 26 cell lines fell within the expected range indicated by the Affymetrix HU-6800 chip.
Overexpression of RbAp48 induces radiosensitization. Because we were interested in exploring whether this analysis yielded biologically meaningful data, we decided to focus further experiments on RbAp48, one of the predictive genes identified by our classifier. RbAp48, a WD-40 protein, was first identified as a ubiquitous binding partner for the retinoblastoma protein (31). It has been proposed that RbAp48 is required for transcriptional repression of E2F-regulated genes (32). Furthermore, MSI1, an RbAp48 homologue in Saccharomyces cerevisiae, was shown to be a negative regulator of Ras (31). Because both proliferation and Ras have been implicated in pathways mediating radiation resistance, we hypothesized that RbAp48 could be mechanistically linked to radiation sensitivity.
We initially determined whether protein expression of RbAp48 mirrored its RNA expression. We did Western blots in the same group of cell lines that we had selected for quantitative real-time PCR. Figure 3 shows that RbAp48 protein expression correlated with its RNA expression. The radiosensitive cell lines (MOLT-4, CCRF-CEM, HCT-116, and KM-12) had a higher expression of the protein than radioresistant cell lines (MALME-3M, MDA-MB-231, H460, and HS-578T). To determine whether altering the expression level of RbAp48 would affect the radiophenotype of a cell line, we transfected RbAp48 into HS-578T, MDA-MB-231, and MALME-3M cells, two breast cancer and a melanoma cell line. As shown in Fig. 4A, overexpression of RbAp48 induced radiosensitization of all three cell lines when compared with an empty vector control. To further expand this observation, we did cell cycle analysis of HS-578T-RbAp48 overexpressors. As shown in Fig. 4B, a higher proportion (27%) of HS-578T-RbAp48 overexpressors were found in the G2-M, the most radiosensitive phase of the cell cycle, when compared with empty vector and wild-type controls (5% and 14%, respectively). Finally, because the Ras pathway has been proposed to play a role in radiation resistance through phosphorylation of Akt, we asked whether overexpression of RbAp48, a Ras antagonist, would alter the level of Akt phosphorylation. Figure 4C shows that overexpression of RbAp48 was correlated with dephosphorylation of Akt, suggesting that it achieves its radiosensitizing effect by opposing the Ras pathway. Taken together, these observations support a mechanistic link between RbAp48 and radiation sensitivity, thus validating the biological value of the classifier.
|
|
| Discussion |
|---|
|
|
|---|
The implications of our findings are significant. Although genomic profiling has been successfully used to distinguish prognostic groups in breast cancer (58), lymphoma (9, 10), prostate cancer (11), and other malignancies (1216), the use of microarray technology in the process of gene discovery has been hindered by the complexities inherent to the analysis of microarray experiments. We chose to use several different methods for filtering the data, including selecting predictive genes identified by SAM analysis and building a classifier to measure their predictive value as gene expression profiles were correlated with radiation sensitivity. We then identified those genes most commonly selected by the accurate classifier models as candidate genes for further study.
In our algorithm, potential predictive genes are initially identified by SAM analysis, as gene expression profiles are correlated with radiation sensitivity. In this step, radiation sensitivity was defined as a continuous variable; therefore, the algorithm identified genes that correlated with radiation response throughout the radiation sensitivity spectrum. Other published classifiers in the literature have defined their end point in a binary fashion (25). The problem with this approach is that it requires two classes to be defined (i.e., radiosensitive versus radioresistant), and thus an artificial threshold bias is introduced in the algorithm.
It should be noted that different classifiers were constructed for each round of the leave-one-out approach because different iterations produced different genes and classifiers. Therefore, a "consensus classifier" could be constructed using the genes most commonly selected during each round of the leave-one-out cross-validation. Therefore, the knowledge developed from this approach (predictive genes, classifier design, and freely available data set) would allow others to test new data against the classifier.
Our approach to radiation sensitivity gene analysis consistently selected three known genes and one unknown gene as predictive of radiation sensitivity. These genes include ribose 5-phosphate isomerase A, an enzyme involved in the pentose-phosphate pathway (33), retinoblastoma binding protein 4, also known as RbAp48 (34), G-protein signaling regulator 19 (35), and an unknown gene that encodes a zinc finger protein. Importantly, we validated the genomic expression for each of the known genes derived from microarrays by performing quantitative RT-PCR. This was critical in our approach because the genomic expression was obtained from the literature and further argues for the validity of in silico experiments. However, the key observation that biologically validates the analytic approach presented in this work is the identification of RbAp48 as a novel gene involved in radiation response. We showed that overexpression of RbAp48 induced radiosensitization of three cell lines (HS-578T, MALME-3M, and MDA-MB-231) when compared with empty vector controls. We further expanded this observation by showing that HS-578T-RbAp48 overexpressors had a higher proportion of cells in the G2-M phase of the cell cycle than empty vector controls and that overexpression of RbAp48 was correlated with dephosphorylation of Akt. All these observations, taken together, strongly support the mechanistic involvement of RbAp48 in radiation response and validate biologically our genomic radiation sensitivity classifier.
The observation of RbAp48-induced radiosensitization raises several questions about the mechanism mediating this effect. One potential hypothesis is that it may be exerting its effect by antagonizing Ras, which has been proposed to be a central mediator of radiation resistance through the Akt pathway (19, 20). Therefore, our observation showing dephosphorylation of Akt in RbAp48 overexpressors is consistent with this hypothesis. Another potential mechanism may involve chromatin assembly and remodeling. RbAp48 is part of chromatin assembly factor 1 (36), histone deacetylase complex 1 (32), histone deacetylase complex 3 (37), and histone acetylase transferase 1 (38). Therefore, RbAp48 seems to play a role in nearly every stage of chromatin metabolism from assembly and remodeling to modification. There is a growing body of literature that supports the involvement of inhibitors of histone deacetylation as radiation sensitizers (3942) and, therefore, this is another potential mechanism by which RbAp48 could be exerting its effect.
This work has several clinical implications. We establish for the first time that radiation sensitivity is predictable based on gene expression profiles. However, how to translate this idea into the clinic is debatable. One of the reasons for working in cell lines initially was that we could address radiation sensitivity isolated from other patient factors. However, radiation sensitivity is only one of the variables that determine whether a tumor is radiocurable. Furthermore, the value of radiation sensitivity tests in vitro and its correlation with clinical outcome are controversial (4348). However, it is reasonable to propose the use of this technology as a genomic approach to the identification of novel molecular markers of radiation sensitivity. Additional markers besides those discussed in this work could be identified by increasing the total number of genes analyzed in the microarray from 7,129 (Affymetrix HU-6800) to 40,000 transcripts (Affymetrix U-133 Plus) or by analyzing genes up-regulated or down-regulated after treatment with radiation. These markers would need to be validated in clinical trials and could then be used in combination with other clinical factors to further improve our ability to define clinical prognostic groups.
In conclusion, we have developed the first biologically validated radiation sensitivity genomic classifier. We introduce a novel approach to radiation sensitivity predictive gene analysis that incorporates a multivariate predictive step and defines radiation sensitivity as a continuous variable. Overexpression of RbAp48, one of the genes selected by our approach, led to radiosensitization of three cell lines (HS-578T, MALME-3M, and MDA-MB-231) as predicted by the classifier. We propose the use of this technology as a genomic approach to the identification of novel molecular markers of radiation sensitivity.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 2/25/05. Revised 4/29/05. Accepted 6/ 9/05.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
N. S. Nagaraj Evolving 'omics' technologies for diagnostics of head and neck cancer Briefings in Functional Genomics, March 9, 2009; (2009) elp004v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Lohavanichbutr, J. Houck, W. Fan, B. Yueh, E. Mendez, N. Futran, D. R. Doody, M. P. Upton, D. G. Farwell, S. M. Schwartz, et al. Genomewide Gene Expression Profiles of HPV-Positive and HPV-Negative Oropharyngeal Cancer: Potential Implications for Treatment Choices Arch Otolaryngol Head Neck Surg, February 1, 2009; 135(2): 180 - 188. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. R. Weichselbaum, H. Ishwaran, T. Yoon, D. S. A. Nuyten, S. W. Baker, N. Khodarev, A. W. Su, A. Y. Shaikh, P. Roach, B. Kreike, et al. An interferon-related gene signature for DNA damage resistance is a predictive marker for chemotherapy and radiation for breast cancer PNAS, November 25, 2008; 105(47): 18490 - 18495. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Amundson, K. T. Do, L. C. Vinikoor, R. A. Lee, C. A. Koch-Paiz, J. Ahn, M. Reimers, Y. Chen, D. A. Scudiero, J. N. Weinstein, et al. Integrating Global Gene Expression and Radiation Survival Parameters across the 60 Cell Lines of the National Cancer Institute Anticancer Drug Screen Cancer Res., January 15, 2008; 68(2): 415 - 424. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Scuto, H. Zhang, H. Zhao, M. Rivera, T. J. Yeatman, R. Jove, and J. F. Torres-Roca RbAp48 Regulates Cytoskeletal Organization and Morphology by Increasing K-Ras Activity and Signaling through Mitogen-Activated Protein Kinase Cancer Res., November 1, 2007; 67(21): 10317 - 10324. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Kong, X.-P. Yu, X.-H. Bai, W.-F. Zhang, Y. Zhang, W.-M. Zhao, J.-H. Jia, W. Tang, Y.-B. Zhou, and C.-j. Liu RbAp48 Is a Critical Mediator Controlling the Transforming Activity of Human Papillomavirus Type 16 in Cervical Cancer J. Biol. Chem., September 7, 2007; 282(36): 26381 - 26391. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-H. Tsai, J. A. Cook, G. V.R. Chandramouli, W. DeGraff, H. Yan, S. Zhao, C. N. Coleman, J. B. Mitchell, and E. Y. Chuang Gene Expression Profiling of Breast, Prostate, and Glioma Cells following Single versus Fractionated Doses of Radiation Cancer Res., April 15, 2007; 67(8): 3845 - 3852. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |