Cancer Research Meeting Calendar  Telomeres
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Okhrimenko, H.
Right arrow Articles by Brodie, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Okhrimenko, H.
Right arrow Articles by Brodie, C.
[Cancer Research 65, 7301-7309, August 15, 2005]
© 2005 American Association for Cancer Research


Cell and Tumor Biology

Protein Kinase C-{varepsilon} Regulates the Apoptosis and Survival of Glioma Cells

Hana Okhrimenko1, Wei Lu2, Cunli Xiang2, Nathan Hamburger2, Gila Kazimirsky1 and Chaya Brodie1,2

1 Gonda (Goldschmied) Medical Diagnosis Research Center, Faculty of Life-Sciences, Bar-Ilan University, Ramat Gan, Israel and 2 The Hermelin Brain Tumor Center, Department of Neurosurgery, Henry Ford Hospital, Detroit, Michigan

Requests for reprints: Chaya Brodie, The Hermelin Brain Tumor Center, Department of Neurosurgery, Henry Ford Hospital, Detroit, MI 48202. Phone: 313-916-8619; Fax: 313-916-9855; E-mail: chaya{at}mail.biu.ac.il.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, we examined the role of protein kinase C (PKC)-{varepsilon} in the apoptosis and survival of glioma cells using tumor necrosis factor–related apoptosis inducing ligand (TRAIL)-stimulated cells and silencing of PKC{varepsilon} expression. Treatment of glioma cells with TRAIL induced activation, caspase-dependent cleavage, and down-regulation of PKC{varepsilon} within 3 to 5 hours of treatment. Overexpression of PKC{varepsilon} inhibited the apoptosis induced by TRAIL, acting downstream of caspase 8 and upstream of Bid cleavage and cytochrome c release from the mitochondria. A caspase-resistant PKC{varepsilon} mutant (D383A) was more protective than PKC{varepsilon}, suggesting that both the cleavage of PKC{varepsilon} and its down-regulation contributed to the apoptotic effect of TRAIL. To further study the role of PKC{varepsilon} in glioma cell apoptosis, we employed short interfering RNAs directed against the mRNA of PKC{varepsilon} and found that silencing of PKC{varepsilon} expression induced apoptosis of various glioma cell lines and primary glioma cultures. To delineate the molecular mechanisms involved in the apoptosis induced by silencing of PKC{varepsilon}, we examined the expression and phosphorylation of various apoptosis-related proteins. We found that knockdown of PKC{varepsilon} did not affect the expression of Bcl2 and Bax or the phosphorylation and expression of Erk1/2, c-Jun-NH2-kinase, p38, or STAT, whereas it selectively reduced the expression of AKT. Similarly, TRAIL reduced the expression of AKT in glioma cells and this decrease was abolished in cells overexpressing PKC{varepsilon}. Our results suggest that the cleavage of PKC{varepsilon} and its down-regulation play important roles in the apoptotic effect of TRAIL. Moreover, PKC{varepsilon} regulates AKT expression and is essential for the survival of glioma cells.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Protein kinase C (PKC), a family of phospholipid-dependent serine-threonine kinases plays important roles in various cellular functions (1). PKC consists of at least 10 isoforms that are divided into the classic PKCs ({alpha}, ß1, ß2, and {gamma}), the novel PKCs ({delta}, {varepsilon}, {eta}, and {theta}), and the atypical PKCs (PKC{zeta} and PKC{iota}/{lambda}; ref. 2). Various PKC isoforms have been reported to regulate cell apoptosis in a stimulus- and isoform-dependent manner. Thus, PKC{alpha} and PKC{iota} have been mainly associated with antiapoptotic effects in various systems (3, 4), whereas PKC{delta}, {theta}, and µ have been implicated as proapoptotic kinases (5, 6). The novel and atypical PKC isoforms have been reported to undergo caspase-dependent cleavage in response to various apoptotic stimuli and the accumulation of their constitutively active catalytic fragments has been associated with the regulation of cell apoptosis (7, 8).

PKC{varepsilon} has been implicated in the regulation of both cell survival and apoptosis in various cellular systems. Thus, overexpression of PKC{varepsilon} protected MCF-7 cells from tumor necrosis factor (TNF)-{alpha}-induced apoptosis (9) and promoted the survival of lung cancer cells (10). In contrast, PKC{varepsilon} has been shown to mediate neuronal death induced by oxidative stress (11) and the apoptosis of macrophages in response to lipopolysaccharide via c-Jun NH2-terminal kinase (JNK) activation (12). PKC{varepsilon} is overexpressed in gliomas (13, 14); however, its role in the regulation of glioma cell apoptosis has not been extensively studied.

TNF-related apoptosis inducing ligand (TRAIL; Apo2 ligand) belongs to the TNF superfamily (15). TRAIL induces apoptosis in transformed cells via binding to the death receptors TRAIL-R1 and TRAIL-R2 (16, 17). The mechanisms underlying TRAIL-induced apoptosis consist of the formation of the death-inducing signaling complex that is also common to other members of the death receptors (18). This leads to activation of caspase 8 at the death-inducing signaling complex followed by either activation of a mitochondrial-independent pathway via caspase 3 and 7 or activation of a mitochondrial-dependent pathway by activation of caspase 9 (19). In addition, recent studies reported that TRAIL activates the transcriptional nuclear factor {kappa}B (NF-{kappa}B) and JNK in various cellular systems (20) and that NF-{kappa}B (21) and phosphoinositide-3-kinase/AKT (22) are involved in the resistance of some transformed cells to the apoptotic effect of TRAIL. PKC signaling has also been shown to modulate TRAIL-induced apoptosis by inhibiting the recruitment of key DD-containing adaptor proteins to their membrane associated signaling complexes (23, 24).

Here, we studied the role of PKC{varepsilon} in the apoptosis and survival of glioma cells using the apoptotic stimulus TRAIL and silencing of PKC{varepsilon}. We found that TRAIL induced caspase-dependent cleavage and down-regulation of PKC{varepsilon} and that both the loss of full-length PKC{varepsilon} and its cleavage play important roles in the apoptotic function of TRAIL. Moreover, our results using short interfering RNAs (siRNA) further indicate that the expression of PKC{varepsilon} is essential for the survival of glioma cells and implicate AKT in this response.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials. Polyclonal anti-PKC{varepsilon} antibodies were purchased from Santa Cruz (Santa Cruz, CA) or from Upstate Inc. (Charlottesville, VA). Both antibodies were directed against the COOH-terminal (V5 region) of PKC{varepsilon}. Human TRAIL was from Peprotech (Rocky Hill, NJ), and anti-active caspase 3, AKT, p38, JNK, Erk, STAT, AKT, Bax and Bcl2 antibodies were obtained from Cell Signaling Technology (Beverly, MA). Leupeptin, aprotinin, phenylmethylsulfonyl fluoride (PMSF) and sodium vanadate were obtained from Sigma Chemical Co. (St. Louis, MO). The caspase inhibitors, Z-DEVD-FMK, Z-VAD-FMK, Z-IETD-FMK, Z-LEHD-FMK and the PKC{varepsilon} peptide (ERMRPRKRQGSVRRRV) were obtained from Calbiochem (La Jolla, CA).

Glioma cells and cell transfection. The glioma cell lines, A172, U87, U251 and LN-229, were grown on tissue culture dishes in medium consisting of DMEM containing 10% FCS, 2 mmol/L glutamine, penicillin (50 units/mL), and streptomycin (0.05 mg/mL).

Primary cultures were obtained from freshly resected tissues following 1 hour of surgical removal. Institutional Review Board–approved informed consent was obtained from all patients or from the patient's guardian for use of tumor tissue collected at the time of tumor resection. Samples were first washed in PBS and then minced into small pieces in DMEM with 10% FCS and were further triturated to obtain maximal cell dispersion. Cells were plated in 25 cm2 tissue culture flasks and were grown for 7 to 10 days. Cultures were used up to passage 7.

Cells were transfected either with the control vectors or with the different PKC{varepsilon} expression vectors by electroporation using the Nucleofector device (Amaxa Biosystems, Germany). Transfection efficiency using nucleofection was about 80% to 90%.

Site-directed mutagenesis of PKC{varepsilon}. PKC{varepsilon} cloned into the pCMVtag2B plasmid served as a template vector for the site-directed mutagenesis. The caspase cleavage site of PKC{varepsilon} (D383A) was mutated using the QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) and the following primers: sense, (5') GTCGGCCACCGCTGGCCAGCTGG (3'); antisense, (5') CCAGCTGGCCAGCGGTGGCCGAC (3'). The mutation was confirmed by DNA sequencing.

Construction of PKC{varepsilon} green fluorescent protein fusion protein. cDNA encoding PKC{varepsilon} was fused into the NH2-terminal–enhanced green fluorescent protein (GFP) vector pEGFP-N1 (Clontech, Palo Alto, CA). The original pEGFP-N1 vector was modified by the insertion of a MluI site in the plasmid polylinker as previously described (25). The clone containing the GFP-PKC{varepsilon} was constructed by the excision of PKC{varepsilon} from MTH-PKC plasmids by digestion with XhoI and MluI. The insert was then ligated into the modified GFP vector using the same restriction sites. DNA sequencing of the GFP-PKC constructs confirmed the intended reading frame.

Adenovirus preparation and infection. The AdEasy system was kindly provided by Dr. Vogelstein (The Johns Hopkins University School of Medicine, MD; ref. 26). PKC{varepsilon} and PKC{varepsilon} kinase–dead mutants were first cloned into the pShuttle-CMV vector as previously described for PKC{delta} (27). Cells were incubated with a multiplicity of infection of 5 at the appropriate recombinant adenovirus vectors for 1 hour. The medium was then replaced with fresh medium and the cells were used 24 to 48 hours post-infection.

Short interfering RNA transfection. siRNA duplexes were synthesized and purified by Dharmacon (Lafayette, CO). The siRNA sequence for targeting PKC{varepsilon} mRNA was 5'-GAUGAAGGAGGCGCUCAGTT-3'. A scrambled sequence was used as a negative control. In addition, we used a pool of four PKC{varepsilon} siRNA duplexes which were also obtained from Dharmacon. Transfection of siRNAs was done using 50 nmol/L PKC{varepsilon} or scrambled siRNAs and OligofectAMINE (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. PKC{varepsilon} protein levels were determined using Western blot analysis.

Measurements of cell apoptosis. Cell apoptosis was measured using propidium iodide staining and analysis by flow cytometry as previously described (25). Briefly, detached cells and trypsinized adherent cells were pooled, fixed in 70% ethanol for 1 hour on ice, washed with PBS and treated for 15 minutes with RNase (50 µmol/L) at room temperature. Cells were then stained with propidium iodide (5 µg/mL) and analyzed on a Becton Dickinson (Mountain View, CA) cell sorter. Cell apoptosis was also examined by Western blot analysis of PARP cleavage using anti-PARP antibody (BD PharMingen, San Diego, CA) and by trypan blue exclusion assay.

Preparation of cell homogenates and immunoblot analysis. Cell pellets were resuspended in 100 µL of lysis buffer [25 mmol/L Tris-HCl (pH 7.4), 50 mmol/L NaCl, 0.5% Na deoxycholate, 2% NP40, 0.2% SDS, 1 mmol/L PMSF, 50 µg/mL aprotinin, 50 µmol/L leupeptin, 0.5 mmol/L Na3VO4] on ice for 15 minutes. Sample buffer (2x) was added and the samples were boiled for 5 minutes. Lysates were resolved by SDS-PAGE and were transferred to nitrocellulose membranes. Following incubation with the primary antibody, specific reactive bands were detected using a goat anti-rabbit or goat anti-mouse IgG conjugated to horseradish peroxidase (Bio-Rad, Hercules, CA) and by enhanced chemiluminescence Western blotting detection kit (Amersham, Arlington Heights, IL). Equal loading was verified by Ponceau S staining or by using anti-actin or anti-tubulin antibodies.

Cytochrome c release. Cytochrome c release from the mitochondria was determined in the cytosolic fraction. Mitochondrial and cytosolic fractions were isolated using the ApoAlert Cell Fractionation Kit (Clontech, BD Biosciences) according to the manufacturer's instructions. Cytochrome c was identified in the cytosolic fraction using a rabbit anti–cytochrome c antibody.

Measurement of caspase 8 activity. Caspase 8 activity was measured using the QuantiPak assay kit obtained from Biomol (Plymouth Meeting, PA) using the fluorescent substrate Ac-IETD-AMC according to the manufacturer's recommendations.

Immunoprecipitation and immune complex PKC{varepsilon} kinase assay. Immunoprecipitation of PKC{varepsilon} and the PKC{varepsilon} kinase assay were done as previously described (28). Briefly, cells treated with TRAIL were lysed in lysis buffer [10 mmol/L Tris-HCl (pH 7.5), 2 mmol/L EDTA and EGTA, 0.5 mmol/L DTT, 200 µmol/L PMSF, 1 µg/mL aprotinin, 2 µg/mL leupeptin, 100 µmol/L sodium orthovanadate, and 0.2% Triton X-100]. Lysates were centrifuged at 4°C and supernatants were incubated with 4 µg of anti-PKC{varepsilon} antibody for 1 hour at 4°C followed by incubation with 100 µL of protein A/G PLUS-Agarose beads for an additional 4 hours. Immunoprecipitates were then used in a kinase assay that was carried out in 200 µL of reaction mixture containing 20 mmol/L HEPES (pH 7.4), 10 mmol/L MgCl2, 0.1 mmol/L EGTA, 0.1 mg/mL PKC{varepsilon}-specific substrate (ERMRPRKRQGSVRRRV), 200 µg/mL phosphatidylserine, 20 µg/mL diacylglycerol, 0.1 mmol/L ATP, and 0.1 µCi/reaction of {gamma}-P32-ATP. The reaction mixture was preincubated for 3 minutes in 30°C. Reactions were initiated by adding 25 µL of preincubated mixture to the immunoprecipitates and incubation at 30°C for 10 minutes. Reaction was terminated by spotting 10 µL of each supernatant onto the phosphocellulose filter papers (P-81). The filters were washed thrice in 0.5% phosphoric acid and counted for radioactivity. Cell pellets were separated by PAGE and immunoblotted for PKC{varepsilon} to normalize for the small differences in the amount of immunoprecipitated kinase.

Statistical analysis. The results are presented as the mean ± SE. Data were analyzed using ANOVA and a paired Student's t test to determine the level of significance between the different groups.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TRAIL induces caspase-dependent cleavage and down-regulation of PKC{varepsilon} in glioma cells. PKC{varepsilon} has been implicated in the regulation of cell apoptosis in various cellular systems (912). To examine the role of PKC{varepsilon} in glioma cell apoptosis, we first employed the apoptotic stimulus TRAIL and the A172 glioma cells which are highly sensitive to this ligand. TRAIL induced activation of PKC{varepsilon}, initial activation was observed after 15 minutes of treatment, and was further increased after 2 to 3 hours of treatment (Fig. 1A). The activation of PKC{varepsilon} was followed by translocation of PKC{varepsilon} to the plasma membrane within 15 minutes of treatment as was observed using PKC{varepsilon} tagged to GFP (Fig. 1B). In addition, TRAIL induced cleavage of PKC{varepsilon} and a gradual loss of the full-length isoforms (Fig. 1C). Low levels of the catalytic fragment of PKC{varepsilon} (43 kDa) were already observed after 1 hour, whereas higher levels of this fragment were observed after 2 to 3 hours of treatment. At this time, the expression of the full-length PKC{varepsilon} was significantly reduced, and by 5 hours, PKC{varepsilon} expression was barely detected (Fig. 1C). The accumulation of the catalytic fragment of PKC{varepsilon} preceded the cleavage of PARP, which was first detected after 3 hours of TRAIL treatment (Fig. 1C) and the onset of cell apoptosis as measured using propidium iodide staining and fluorescence-activated cell sorting analysis (data not shown).



View larger version (35K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. TRAIL induces activation, cleavage, and down-regulation of PKC{varepsilon} in glioma cells. A172 cells were treated with TRAIL for 0 to 3 hours and the activity of PKC{varepsilon} was determined using an immune complex PKC{varepsilon} kinase assay. Samples were also subjected to immunoblot analysis for the determination of total PKC{varepsilon} levels (A). Translocation of PKC{varepsilon} in response to TRAIL was determined in A172 cells transfected with PKC{varepsilon}-GFP. Cells were stimulated with TRAIL (100 ng/mL) for various periods of time and were then visualized by confocal microscopy (B). Cleavage and expression of PKC{varepsilon} was determined in A172 cells treated with TRAIL for 0 to 5 hours by Western blot using an anti-PKC{varepsilon} antibody that recognizes the catalytic domain [anti-PKC{varepsilon} (C-15), Santa Cruz] and cell apoptosis was measured in parallel using PARP cleavage (C). The role of caspase 3, 8, and 9 in the cleavage of PKC{varepsilon} was determined using pretreatment of the cells with DEVD, ZVAD, Z-IRTD, or Z-LEHD (10 µmol/L) for 30 minutes followed by incubation with TRAIL for an additional 3 hours (D). Columns, means; bars, ± SE (A); results from one of four separate experiments which gave similar results (B, C, and D).

 
Pretreatment of the cells with the caspase inhibitors Z-VAD (pan-caspase), DEVD (caspases 3), and Z-IETD (caspase 8) for 30 minutes prior to TRAIL administration inhibited the cleavage of PKC{varepsilon} by TRAIL, whereas the caspase 9 inhibitor, Z-LEHD elicited a partial inhibitory effect (Fig. 1D). Similarly, the caspase inhibitors significantly reduced the apoptosis induced by TRAIL as evidenced by PARP cleavage (data not shown).

Cleavage and down-regulation of PKC{varepsilon} in TRAIL-sensitive and resistant glioma cells. The cleavage and down-regulation of PKC{varepsilon} were further studied in various TRAIL-sensitive and resistant glioma cell lines and in primary glioma cultures (Fig. 2). TRAIL induced a decrease in the expression of the full-length PKC{varepsilon} and accumulation of the PKC{varepsilon} catalytic fragment in the TRAIL-sensitive cell lines (A172, U251, and U87) albeit to a different degree (Fig. 2B). Thus, the full-length PKC{varepsilon} was significantly decreased and high levels of the 43 kDa fragment accumulated in the A172 and U251 cells that exhibited high sensitivity to the apoptotic effect of TRAIL, whereas smaller changes were observed in the U87 cells that exhibited lower sensitivity to TRAIL (Fig. 2A and B). In contrast, no cleavage of PKC{varepsilon} was observed in the TRAIL-resistant cell line, LN-229 (Fig. 2A and B), even when the cells were examined after 24 hours of TRAIL treatment (data not shown), suggesting a role of the cleaved form of PKC{varepsilon} in the apoptotic effect of TRAIL.



View larger version (45K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Cleavage and down-regulation of PKC{varepsilon} in TRAIL-sensitive and -resistant glioma cells. Various glioma cell lines (A and B) and primary glioma cultures (C and D) were treated with 100 ng/mL TRAIL for 5 hours. Cell apoptosis was determined using propidium iodide staining and fluorescence-activated cell sorting analysis (A) or by trypan blue exclusion assay (C) and the expression and cleavage of PKC{varepsilon} was determined using Western blot analysis (B and D). The morphology of the cells was monitored under a phase contrast light microscope (C). Columns, means; bars, ± SE (A); results from one representative experiment out of four similar experiments (B, C, and D).

 
Similar results were observed with the primary glioma cells. An increase in the catalytic fragment and a decrease in the full-length PKC{varepsilon} were observed in the TRAIL-sensitive glioma cultures (HF 1308 and HF 1255), whereas no changes were observed in the TRAIL-resistant primary glioma cells (HF 1286 and HF1318) following 5 hours (Fig. 2C and D) or 24 hours of treatment (data not shown).

Overexpression of PKC{varepsilon} protects glioma cells from the apoptosis induced by TRAIL. Because the expression of PKC{varepsilon} was dramatically decreased in TRAIL-treated cells, we examined whether overexpression of PKC{varepsilon} can protect the A172 cells from apoptosis induced by TRAIL. For these experiments, we used both an adenovirus vector expressing PKC{varepsilon} and the tg2b-PKC{varepsilon} expression vector. As presented in Fig. 3A, both infection of the A172 cells with an adenovirus vector expressing PKC{varepsilon} and transfection of the cells resulted in overexpression of PKC{varepsilon} and treatment of the cells with TRAIL induced cleavage of the PKC{varepsilon} (Fig. 3A). Overexpression of PKC{varepsilon} decreased the apoptosis of the A172 cells in response to TRAIL as compared with control LacZ-Ad-infected cells or as compared with the control vector–transfected cells (Fig. 3B). Thus, PKC{varepsilon} decreased cell apoptosis by about 50% as compared with control vector cells.



View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Overexpression of PKC{varepsilon} protects A172 cells from TRAIL-induced apoptosis. A172 cells were infected with adenovirus vectors expressing PKC{varepsilon} (PKC{varepsilon}-AdV) and LacZ (CV, LacZ-AdV; A and B) or transfected with control vector or tg2b-PKC{varepsilon} (A and B). Following 24 hours, the cells were treated with TRAIL for 5 hours, cleavage of PKC{varepsilon} was determined using Western blot analysis (A) and cell apoptosis was determined using propidium iodide staining and fluorescence-activated cell sorting analysis (B). Bid expression was determined after 90 minutes (C) and cytochrome c release was determined after 2 hours of treatment (D) as described in Materials and Methods. The results are representative of four similar experiments (A, B, C, and D); columns, means; bars, ± SE (B).

 
Overexpression of PKC{varepsilon} did not inhibit the activation of caspase 8 by TRAIL (data not shown); however, it abolished the decrease in Bid expression (Fig. 3C) and the release of cytochrome c from the mitochondria to the cytosol (Fig. 3D), suggesting that PKC{varepsilon} acted downstream of caspase 8 activation and upstream of Bid cleavage and activation of the mitochondria pathway.

The PKC{varepsilon} caspase-resistant mutant (D383A) is more protective than PKC{varepsilon} against TRAIL-induced apoptosis. The partial protection of the exogenous PKC{varepsilon} against the apoptosis induced by TRAIL could be due to an apoptotic function of the cleaved overexpressed PKC{varepsilon}. To examine this possibility, we constructed a PKC{varepsilon} mutant in which the aspartic acid at the SSPD site was mutated to alanine (D383A mutant). Following transfection, the A172 cells expressed comparable levels of PKC{varepsilon} and the PKC{varepsilon} D383A mutant (Fig. 4A). Similar to the results described in Fig. 3, the wild-type PKC{varepsilon} underwent cleavage in response to TRAIL (Fig. 4A) and decreased the apoptosis of the cells by about 40% to 50% cells, as shown by measurements of cell apoptosis (Fig. 4B) and by the morphologic appearance of the cells (Fig. 4C). In contrast, the PKC{varepsilon} D383A did not undergo cleavage in response to TRAIL treatment (Fig. 4A) and overexpression of this mutant exerted a stronger protective effect against the apoptosis induced by TRAIL. Thus, in these cells, only 5% to 10% of the cells were apoptotic as compared with 55% to 60% apoptotic cells in the control vector cells (Fig. 4B and C). These results suggest that the PKC{varepsilon} D383A acted as a dominant-negative of PKC{varepsilon} and that the cleavage of PKC{varepsilon} contributed to the apoptosis induced by TRAIL. Similarly, we found that the expression of active caspase 3 induced by TRAIL was inhibited by PKC{varepsilon} and to a larger degree by the PKC{varepsilon} D338A mutant (Fig. 4D).



View larger version (31K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. Cleavage of PKC{varepsilon} plays a role in the apoptotic effect of TRAIL. A172 cells were transfected with control vector, PKC{varepsilon}, or PKC{varepsilon}D383A. Following 48 hours, the cells were treated with TRAIL for 5 hours and the cleavage of PKC{varepsilon} was determined using Western blot analysis (A). Cell apoptosis was determined using propidium iodide staining and fluorescence-activated cell sorting analysis (B). The cells were also visualized using a phase contrast microscope (C). The levels of active caspase 3 were determined using Western blot analysis (D). The results are representative of four similar experiments (A, C, and D); columns, means; bars, ± SE (B).

 
Silencing of PKC{varepsilon} induces apoptosis of glioma cells. Our results thus far suggest that the loss of PKC{varepsilon} contributes to the apoptosis induced by TRAIL. We therefore examined whether the expression of PKC{varepsilon} was essential for the survival of glioma cells. For these experiments, we designed a siRNA targeting the human PKC{varepsilon} mRNA ({varepsilon}1 siRNA). In addition, we employed a pool of four PKC{varepsilon} siRNA duplexes (Dharmacon, {varepsilon}2 siRNA). Transfection of the A172 cells with either PKC{varepsilon} siRNAs decreased the expression of PKC{varepsilon} in the cells by 90% after 3 days of transfection (Fig. 5A), whereas it did not affect the levels of the other PKC isoforms expressed in the A172 cells (PKC{alpha}, ß, {gamma}, {delta}, {zeta} and µ; data not shown). The PKC{varepsilon} siRNA transfected cells exhibited a high degree of cell apoptosis as compared with cells transfected with control scrambled siRNA as determined by propidium iodide staining and fluorescence-activated cell sorting analysis (Fig. 5A) or by histone ELISA (data not shown).



View larger version (55K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Silencing of PKC{varepsilon} expression induces apoptosis in glioma cells. The glioma cell lines, A172 (A) LN-443, U251, and U87 (B) and the primary glioma cultures HF1308 and HF1255 (C and D) were transfected with 50 nmol/L scrambled siRNA (CsiRNA) and siRNAs targeting the mRNA of PKC{varepsilon} (PKC{varepsilon} siRNAs). Following 72 hours, the expression of PKC{varepsilon} was determined using Western blot analysis (A, B, and C) and cell apoptosis was determined using propidium iodide staining and fluorescence-activated cell sorting analysis (A and B) or trypan blue exclusion and phase contrast microscopy (D). The results represent one of four separate experiments, which gave similar results (A and B) or are the means ± SE of five independent experiments (A and B; FACS analysis).

 
Similar results were obtained with the LN-443, U251, and U87 glioma cell lines (Fig. 5B) and with the two primary glioma cell cultures, HF1308 and HF 1255 (Fig. 5C and D). Transfection of these cells with the PKC{varepsilon} siRNAs significantly reduced the expression of PKC{varepsilon} in these cells (Fig. 5B and C) and increased cell death of the transfected cells as shown by propidium iodide staining (Fig. 5B), the morphologic appearance of the cells and by trypan blue exclusion assay (Fig. 5D).

Loss of PKC{varepsilon} induces a decrease in the expression of Akt. To explore the mechanisms by which knockdown of PKC{varepsilon} induces cell apoptosis in glioma cells, we examined the expression and phosphorylation of various apoptosis-related proteins in the A172 cells transfected with the PKC{varepsilon} siRNA. As presented in Fig. 6A, knockdown of PKC{varepsilon} specifically decreased the expression of PKC{varepsilon}, whereas no changes were observed in the expression of PKC{delta}. The silencing of PKC{varepsilon} increased the expression of active caspase 3, whereas it did not affect the expression of the apoptosis-related proteins, Bax and BCl2, or the phosphorylation and expression of the kinases JNK, Erk, p38, and STAT1 (Fig. 6A). In contrast, the knockdown of PKC{varepsilon} expression significantly inhibited the phosphorylation and expression of AKT in these cells (Fig. 6A).



View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. Loss of PKC{varepsilon} reduces the expression of AKT in glioma cells. A172 cells were transfected with 50 nmol/L scrambled siRNA or with siRNAs targeting the mRNA of PKC{varepsilon} (PKC{varepsilon} siRNA). Following 72 hours, the expression of PKC{varepsilon}, PKC{delta}, active caspase 3, Bax and Bcl2 as well as the expression and phosphorylation of AKT, Erk1/2, p38, JNK, and STAT1 were determined using Western blot analysis (A). To examine the role of PKC{varepsilon} in AKT expression in TRAIL-treated cells, A172 cells overexpressing control vector or PKC{varepsilon} were treated with TRAIL (100 mg/mL) for 1 to 3 hours and the expression of AKT was measured using Western blot analysis (B). The results represent one of four separate experiments, which gave similar results.

 
Because silencing of PKC{varepsilon} reduced the expression of AKT, we examined whether loss of PKC{varepsilon} expression in response to TRAIL treatment also reduced the expression of this protein. For these experiments, we used cells transfected with control vector and PKC{varepsilon} and treated them with TRAIL for 3 hours. As presented in Fig. 6B, treatment of control vector cells with TRAIL significantly decreased the expression of AKT in the cells after 3 hours of treatment (a time in which PKC{varepsilon} was cleaved and degraded). In contrast, no significant decrease in AKT expression was observed in cells overexpressing PKC{varepsilon}, suggesting the down-regulation of PKC{varepsilon} expression induced by TRAIL mediated the decrease in AKT expression.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, we explored the role of PKC{varepsilon} in the apoptosis and survival of glioma cells using the apoptotic stimulus TRAIL and siRNAs directed against PKC{varepsilon} mRNA. We found that TRAIL induced activation of PKC{varepsilon} within 15 to 30 minutes of TRAIL treatment which was further increased after 3 hours. The early and late activation of PKC{varepsilon} are probably mediated by two distinct mechanisms; a cleavage-independent activation at the early time points and a cleavage-dependent activation at the later time point which could be attributed to the generation of a constitutively active catalytic fragment. Indeed, similar results of cleavage-dependent activation of PKC{varepsilon} were recently reported in TNF-{alpha} treated cells (9).

TRAIL also induced translocation of PKC{varepsilon} to the plasma membrane. The translocation of PKC is associated with the activation of this enzyme and it is considered as an important molecular event in the function of this kinase family (29). Translocation of PKC is mediated by binding to selective anchoring proteins or selective receptors for activated C-kinases (RACK; ref. 30) and several domains of PKC{varepsilon} have implicated its translocation and anchoring to the membrane (31). The mechanisms by which TRAIL induces translocation of PKC{varepsilon} and the role of this translocation in PKC{varepsilon} effects are currently not understood. However, membranal translocation of PKC{varepsilon} has been associated with the apoptotic effect of UV radiation (32).

TRAIL induced cleavage and down-regulation of PKC{varepsilon} and generation of a 43 kDa fragment in all the cells that were sensitive to TRAIL. In contrast, no cleavage of PKC{varepsilon} was observed in the TRAIL-resistant glioma cells, suggesting that the cleavage and loss of PKC{varepsilon} were involved in the apoptotic response of TRAIL. Various studies have shown that PKC isoforms are proteolytically cleaved in response to apoptotic stimuli and that the apoptotic effect of some of these isoforms is associated with the accumulation of the cleaved constitutive active catalytic fragment (6, 33). Indeed, cleavage of PKC{delta} (26, 34), PKC{theta} (35), PKCµ (7), and PKC{zeta} (36) have been reported in response to various apoptotic stimuli such as radiation, chemotherapeutic drugs and ligation of the FAS and TNF-{alpha} receptors, and caspase 3 has been implicated in the cleavage of these PKC isoforms (6, 7, 26, 34).

PKC{varepsilon} undergoes cleavage in response to serum deprivation (37), chemotherapeutic agents (38) and TNF-{alpha} treatment (9). Koriyama et al. (29) and Hoppe et al. (37) showed both in vitro and in vivo, that caspase 3 mediated the cleavage of PKC{varepsilon} in their cellular systems. In contrast, Basu et al. (9) reported that in the MCF-7 cells that lack functional caspase 3, the cleavage of PKC{varepsilon} is mediated by caspase 7. We found that TRAIL induced the generation of a 43 kDa fragment in all the glioma cells that were examined in this study, and no other catalytic fragments were detected. Using different caspase inhibitors, we found that the caspase 3 and caspase 8 inhibitors completely inhibited the cleavage of PKC{varepsilon} and the apoptosis induced by TRAIL, whereas partial inhibition was observed with the caspase 9 inhibitor. Thus, our data suggest that in glioma cells, TRAIL exerts apoptosis via activation of caspases 8 and 9 and that caspase 3 cleaves PKC{varepsilon} at the atypical cleavage site, SSPD in the hinge region.

We found that TRAIL induced a large decrease in the expression of the full-length PKC{varepsilon} in parallel to the increased generation of its cleaved catalytic fragment. PKC{varepsilon} has been associated with antiapoptotic functions in various cellular systems including lung cancer cells (10), T lymphocytes (39), and prostate cancer cells (40). We therefore hypothesized that the down-regulation of PKC{varepsilon} mediated the apoptotic effect of TRAIL. We found that overexpression of PKC{varepsilon} in the A172 cells inhibited the apoptosis induced by TRAIL, acting downstream from caspase 8 activation and upstream of Bid cleavage and activation of the mitochondrial pathway. Overexpression of PKC{varepsilon} inhibited the apoptosis induced by TRAIL by 50% to 60%, suggesting that the down-regulation of PKC{varepsilon} may not be the only factor involved in the apoptotic effect of TRAIL. A partial protective effect of PKC{varepsilon} on the apoptosis of glioma cell lines treated with TRAIL was also observed by Shinohara et al. (41).

The overexpressed PKC{varepsilon} underwent cleavage in TRAIL-treated cells, similar to the endogenous PKC{varepsilon}, suggesting that the partial protective effect of PKC{varepsilon} may be due to an apoptotic effect of the cleaved fragment. We found that a PKC{varepsilon} mutant in which aspartic acid 383 was mutated to alanine (D383A) and which did not undergo cleavage in response to TRAIL, was significantly more effective than the wild-type PKC{varepsilon} in protecting A172 cells from apoptosis induced by TRAIL. Thus, our results suggest that the cleavage of PKC{varepsilon} contributed to the apoptotic effect of TRAIL in glioma cells. The cleaved PKC{varepsilon} has been associated with both pro- and antiapoptotic effects in various cellular systems. Thus, apoptotic effects of the cleaved PKC{varepsilon} catalytic fragment were observed in the GH3B6 cells (38), whereas Basu et al. (9) reported that the catalytic domain of PKC{varepsilon} exerted an antiapoptotic effect in TNF-{alpha}-treated cells.

The down-regulation of PKC{varepsilon} in TRAIL-treated glioma cells raised the possibility that the expression of PKC{varepsilon} is essential for the survival of these cells. Using siRNAs directed against PKC{varepsilon} mRNA, we reduced PKC{varepsilon} expression in the cells by 90%. Silencing of PKC{varepsilon} expression induced cell apoptosis in all the glioma cell lines and primary cultures that were examined, further suggesting an important role of PKC{varepsilon} in the survival of glioma cells.

We found that the decrease in PKC{varepsilon} expression by either siRNAs or TRAIL induced a selective decrease in the expression of AKT, whereas the expression of other apoptosis-related proteins was not significantly affected. AKT (PKB) is a family of serine-threonine kinases that regulates cell survival in a variety of cellular systems including gliomas (42, 43). The survival effects of AKT are exerted by phosphorylating proteins such as BAD, caspase 9, and the forkhead transcription factors or by activating antiapoptotic pathways such as NF-{kappa}B (43). The activity of AKT is regulated by phosphorylation on Thr308 by PDK-1 and on Ser473 by an unidentified kinase referred to as PDK-2 (44). In addition, the activity of AKT is also regulated by its degradation via diverse mechanisms. Indeed, proteasome-dependent degradation of AKT has been reported in response to treatment of tumor cells with Hsp90-specific inhibitors (45), whereas caspase-dependent and independent degradation of AKT occurs in response to p53 inhibition of the a6ß4 integrin survival signaling (46), UV radiation (47), and inhibition of the vascular endothelial growth factor receptor pathway (48). The mechanisms by which loss of PKC{varepsilon} induced a decrease in the expression of AKT are currently not understood. One possibility is that down-regulation of PKC{varepsilon} induced activation of caspase 3 that results in the cleavage and degradation of AKT. Indeed, silencing of PKC{varepsilon} induced activation of caspase 3 and overexpression of PKC{varepsilon} decreased the activation of caspase 3 induced by TRAIL. Alternatively, down-regulation of the Hsp90 protein, which is required for the stability of AKT, is another possible mechanism because PKC has been associated with the regulation of Hsp90 under various conditions (49). Finally, the direct regulation of AKT expression by PKC{varepsilon} may be also considered because interaction between AKT and PKC{varepsilon} has been shown in various cellular systems (50).

In summary, the results of both TRAIL-induced apoptosis and PKC{varepsilon} silencing indicate that the expression of AKT is regulated by PKC{varepsilon} and that PKC{varepsilon} is essential for the survival of glioma cells. Our results also suggest that in TRAIL-treated cells, the cleaved PKC{varepsilon} contributes to the apoptotic effect of TRAIL, in addition to the loss of this isoform from the cells. Thus, in addition to delineating the role of PKC{varepsilon} in TRAIL-induced apoptosis, the results of this study have broader implications for the role of PKC{varepsilon} signaling in the regulation of AKT expression and for glioma cell function. We (13) and others (14) have recently reported that PKC{varepsilon} is highly expressed in glioblastomas. Thus, our results that PKC{varepsilon} is essential for the survival of glioma cells identify an important role of PKC{varepsilon} in these tumors.


    Acknowledgments
 
Grant support: James S. McDonnell Foundation, 21st Century Scientist Award/Brain Cancer Research, and by NIH grant RO1 CA109196.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Michelle Johnston and Donghong Ju for their excellent technical assistance and Sandra Rempel for critical review of the manuscript.

Received 3/29/05. Revised 5/22/05. Accepted 6/ 2/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Nishizuka Y. The molecular heterogeneity of protein kinase C and its implications for cellular regulation. Nature 1988;334:661–5.[CrossRef][Medline]
  2. Hug H, Sarre TF. Protein kinase C isoenzymes: divergence in signal transduction? Biochem J 1993;291:329–43.
  3. Gutcher I, Webb PR, Anderson NG. The isoform-specific regulation of apoptosis by protein kinase C. Cell Mol Life Sci 2003;60:1061–70.[Medline]
  4. Ruvolo PP, Deng X, Carr BK, May WS. A functional role for mitochondrial protein kinase C{alpha} in Bcl2 phosphorylation and suppression of apoptosis. J Biol Chem 1998;273:25436–42.[Abstract/Free Full Text]
  5. Jamieson L, Carpenter L, Biden TJ, Fields AP. Protein kinase C{iota} activity is necessary for Bcr-Abl-mediated resistance to drug-induced apoptosis. J Biol Chem 1999;274:3927–30.[Abstract/Free Full Text]
  6. Ghayur T, Hugunin M, Talanian RV, et al. Proteolytic activation of protein kinase C{delta} by an ICE/CED 3-like protease induces characteristics of apoptosis. J Exp Med 1996;184:2399–404.[Abstract/Free Full Text]
  7. Endo K, Oki E, Biedermann V, et al. Proteolytic cleavage and activation of protein kinase C [µ] by caspase-3 in the apoptotic response of cells to 1-ß-D-arabinofuranosylcytosine and other genotoxic agents. J Biol Chem 2000;275:18476–81.[Abstract/Free Full Text]
  8. Sitailo LA, Tibudan SS, Denning MF. Bax activation and induction of apoptosis in human keratinocytes by the protein kinase C{delta} catalytic domain. J Invest Dermatol 2004;123:434–43.[CrossRef][Medline]
  9. Basu A, Lu D, Sun B, Moor AN, Akkaraju GR, Huang J. Proteolytic activation of protein kinase C-{varepsilon} by caspase-mediated processing and transduction of antiapoptotic signals. J Biol Chem 2002;277:41850–6.[Abstract/Free Full Text]
  10. Ding L, Wang H, Lang W, Xiao L. Protein kinase C-{varepsilon} promotes survival of lung cancer cells by suppressing apoptosis through dysregulation of the mitochondrial caspase pathway. J Biol Chem 2002;277:35305–13.[Abstract/Free Full Text]
  11. Jung YS, Ryu BR, Lee BK, et al. Role for PKC-{varepsilon} in neuronal death induced by oxidative stress. Biochem Biophys Res Commun 2004;320:789–94.[CrossRef][Medline]
  12. Comalada M, Xaus J, Valledor AF, Lopez-Lopez C, Pennington DJ, Celada A. PKC {varepsilon} is involved in JNK activation that mediates LPS-induced TNF-{alpha}, which induces apoptosis in macrophages. Am J Physiol Cell Physiol 2003;285:C1235–45.[Abstract/Free Full Text]
  13. Mandil R, Ashkenazi E, Blass M, et al. Protein kinase C{alpha} and protein kinase C{delta} play opposite roles in the proliferation and apoptosis of glioma cells. Cancer Res 2001;61:4612–9.[Abstract/Free Full Text]
  14. Sharif TR, Sharif M. Overexpression of protein kinase C{varepsilon} in astroglial brain tumor derived cell lines and primary tumor samples. Int J Oncol 1999;15:237–43.[Medline]
  15. Pitti RM, Marsters SA, Ruppert S, Donahue CJ, Moore A, Ashkenazi A. Induction of apoptosis by Apo-2 ligand, a new member of the tumor necrosis factor cytokine family. J Biol Chem 1996;271:12687–90.[Abstract/Free Full Text]
  16. Pan G, Ni J, Wei YF, Yu G, Gentz R, Dixit VM. An antagonist decoy receptor and a death domain-containing receptor for TRAIL. Science 1997;277:815–8.[Abstract/Free Full Text]
  17. Pan G, O'Rourke K, Chinnaiyan AM, et al. The receptor for the cytotoxic ligand TRAIL. Science 1997;276:111–3.[Abstract/Free Full Text]
  18. Kischkel FC, Hellbardt S, Behrmann I, et al. Cytotoxicity-dependent APO-1 (Fas/CD95)-associated proteins form a death-inducing signaling complex (DISC) with the receptor. EMBO J 1995;14:5579–88.[Medline]
  19. Wang S, El Deiry WS. TRAIL and apoptosis induction by TNF-family death receptors. Oncogene 2003;22:8628–33.[CrossRef][Medline]
  20. Lin Y, Devin A, Cook A, et al. The death domain kinase RIP is essential for TRAIL (Apo2L)-induced activation of I{kappa}B kinase and c-Jun N-terminal kinase. Mol Cell Biol 2000;20:6638–45.[Abstract/Free Full Text]
  21. Degli-Esposti MA, Dougall WC, Smolak PJ, Waugh JY, Smith CA, Goodwin RG. The novel receptor TRAIL-R4 induces NF-{kappa}B and protects against TRAIL-mediated apoptosis, yet retains an incomplete death domain. Immunity 1997;7:813–20.[CrossRef][Medline]
  22. Chen X, Thakkar H, Tyan F, et al. Constitutively active Akt is an important regulator of TRAIL sensitivity in prostate cancer. Oncogene 2001;20:6073–83.[CrossRef][Medline]
  23. Harper N, Hughes MA, Farrow SN, Cohen GM, MacFarlane M. Protein kinase C modulates tumor necrosis factor-related apoptosis-inducing ligand-induced apoptosis by targeting the apical events of death receptor signaling. J Biol Chem 2003;278:44338–47.[Abstract/Free Full Text]
  24. Meng XW, Heldebrant MP, Kaufmann SH. Phorbol 12-myristate 13-acetate inhibits death receptor-mediated apoptosis in Jurkat cells by disrupting recruitment of Fas-associated polypeptide with death domain. J Biol Chem 2002;277:3776–83.[Abstract/Free Full Text]
  25. Blass M, Kronfeld I, Kazimirsky G, Blumberg PM, Brodie C. Tyrosine phosphorylation of protein kinase C{delta} is essential for its apoptotic effect in response to etoposide. Mol Cell Biol 2002;22:182–95.[Abstract/Free Full Text]
  26. He TC, Zhou S, da Costa LT, Yu J, Kinzler KW, Vogelstein B. A simplified system for generating recombinant adenoviruses. Proc Natl Acad Sci U S A 1998;95:2509–14.[Abstract/Free Full Text]
  27. Deutsch E, Cohen A, Kazimirsky G, et al. Role of protein kinase C{delta} in reactivation of Kaposi's sarcoma-associated herpesvirus. J Virol 2004;78:10187–92.[Abstract/Free Full Text]
  28. Brodie C, Steinhart R, Kazimirsky G, et al. PKC{delta} associates with and is involved in the phosphorylation of RasGRP3 in response to phorbol esters. Mol Pharmacol 2004;66:76–84.[Abstract/Free Full Text]
  29. Koriyama H, Kouchi Z, Umeda T, et al. Proteolytic activation of protein kinase C{delta} and {varepsilon} by caspase-3 in U937 cells during chemotherapeutic agent-induced apoptosis. Cell Signal 1999;11:831–8.[CrossRef][Medline]
  30. Ron D, Kazanietz MG. New insights into the regulation of protein kinase C and novel phorbol ester receptors. FASEB J 1999;13:1658–76.[Abstract/Free Full Text]
  31. Wang QJ, Lu G, Schlapkohl WA, et al. The V5 domain of protein kinase C plays a critical role in determining the isoform-specific localization, translocation, and biological function of protein kinase C-{delta} and -{varepsilon}. Mol Cancer Res 2004;2:129–40.[Abstract/Free Full Text]
  32. Chen N, Ma W, Huang C, Dong Z. Translocation of protein kinase C{varepsilon} and protein kinase C{delta} to membrane is required for ultraviolet B-induced activation of mitogen-activated protein kinases and apoptosis. J Biol Chem 1999;274:15389–94.[Abstract/Free Full Text]
  33. Brodie C, Blumberg PM. Regulation of cell apoptosis by protein kinase C{delta}. Apoptosis 2003;8:19–27.[CrossRef][Medline]
  34. Reyland ME, Anderson SM, Matassa AA, Barzen KA, Quissell DO. Protein kinase C{delta} is essential for etoposide-induced apoptosis in salivary gland acinar cells. J Biol Chem 1999;274:19115–23.[Abstract/Free Full Text]
  35. Datta R, Kojima H, Yoshida K, Kufe D. Caspase-3-mediated cleavage of protein kinase C{tau} in induction of apoptosis. J Biol Chem 1997;272:20317–20.[Abstract/Free Full Text]
  36. Frutos S, Moscat J, Diaz-Meco MT. Cleavage of {zeta}PKC but not {lambda}/{iota}PKC by caspase-3 during UV-induced apoptosis. J Biol Chem 1999;274:10765–70.[Abstract/Free Full Text]
  37. Hoppe J, Hoppe V, Schafer R. Selective degradation of the PKC-{varepsilon} isoform during cell death in AKR-2B fibroblasts. Exp Cell Res 2001;266:64–73.[CrossRef][Medline]
  38. Leverrier S, Vallentin A, Joubert D. Positive feedback of protein kinase C proteolytic activation during apoptosis. Biochem J 2002;368:905–13.[CrossRef][Medline]
  39. Bertolotto C, Maulon L, Filippa N, Baier G, Auberger P. Protein kinase C{tau} and {varepsilon} promote T-cell survival by a rsk-dependent phosphorylation and inactivation of BAD. J Biol Chem 2000;275:37246–50.[Abstract/Free Full Text]
  40. McJilton MA, Van Sikes C, Wescott GG, et al. Protein kinase C{varepsilon} interacts with Bax and promotes survival of human prostate cancer cells. Oncogene 2003;22:7958–68.[CrossRef][Medline]
  41. Shinohara H, Kayagaki N, Yagita H, et al. A protective role of PKC{varepsilon} against TNF-related apoptosis-inducing ligand (TRAIL)-induced apoptosis in glioma cells. Biochem Biophys Res Commun 2001;284:1162–7.[CrossRef][Medline]
  42. Marte BM, Downward J. PKB/Akt: connecting phosphoinositide 3-kinase to cell survival and beyond. Trends Biochem Sci 1997;22:355–8.[CrossRef][Medline]
  43. Franke TF, Hornik CP, Segev L, Shostak GA, Sugimoto C. PI3K/Akt and apoptosis: size matters. Oncogene 2003;22:8983–98.[CrossRef][Medline]
  44. Vanhaesebroeck B, Alessi DR. The PI3K-PDK1 connection: more than just a road to PKB. Biochem J 2000;346:561–76.
  45. Basso AD, Solit DB, Chiosis G, Giri B, Tsichlis P, Rosen N. Akt forms an intracellular complex with heat shock protein 90 (Hsp90) and Cdc37 and is destabilized by inhibitors of Hsp90 function. J Biol Chem 2002;277:39858–66.[Abstract/Free Full Text]
  46. Bachelder RE, Ribick MJ, Marchetti A, et al. p53 inhibits {alpha}6ß4 integrin survival signaling by promoting the caspase 3-dependent cleavage of AKT/PKB. J Cell Biol 1999;147:1063–72.[Abstract/Free Full Text]
  47. Widmann C, Gibson S, Johnson GL. Caspase-dependent cleavage of signaling proteins during apoptosis. A turn-off mechanism for anti-apoptotic signals. J Biol Chem 1998;273:7141–7.[Abstract/Free Full Text]
  48. Riesterer O, Zingg D, Hummerjohann J, Bodis S, Pruschy M. Degradation of PKB/Akt protein by inhibition of the VEGF receptor/mTOR pathway in endothelial cells. Oncogene 2004;23:4624–35.[CrossRef][Medline]
  49. Wu JM, Xiao L, Cheng XK, Cui LX, Wu NH, Shen YF. PKC{varepsilon} is a unique regulator for hsp90 ß gene in heat shock response. J Biol Chem 2003;278:51143–9.[Abstract/Free Full Text]
  50. Wu D, Thakore CU, Wescott GG, McCubrey JA, Terrian DM. Integrin signaling links protein kinase C{varepsilon} to the protein kinase B/Akt survival pathway in recurrent prostate cancer cells. Oncogene 2004;23:8659–72.[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
G. K. Lonne, K. C. Masoumi, J. Lennartsson, and C. Larsson
Protein Kinase C{delta} Supports Survival of MDA-MB-231 Breast Cancer Cells by Suppressing the ERK1/2 Pathway
J. Biol. Chem., November 27, 2009; 284(48): 33456 - 33465.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
W. Koh, K. Sachidanandam, A. N. Stratman, A. Sacharidou, A. M. Mayo, E. A. Murphy, D. A. Cheresh, and G. E. Davis
Formation of endothelial lumens requires a coordinated PKC{epsilon}-, Src-, Pak- and Raf-kinase-dependent signaling cascade downstream of Cdc42 activation
J. Cell Sci., June 1, 2009; 122(11): 1812 - 1822.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
S. F. Steinberg
Structural Basis of Protein Kinase C Isoform Function
Physiol Rev, October 1, 2008; 88(4): 1341 - 1378.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
Y.-H. Kim, Y.-S. Kim, C.-H. Park, I.-Y. Chung, J.-M. Yoo, J.-G. Kim, B.-J. Lee, S.-S. Kang, G.-J. Cho, and W.-S. Choi
Protein Kinase C-{delta} Mediates Neuronal Apoptosis in the Retinas of Diabetic Rats via the Akt Signaling Pathway
Diabetes, August 1, 2008; 57(8): 2181 - 2190.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Steinberg, O. A. Harari, E. A. Lidington, J. J. Boyle, M. Nohadani, A. M. Samarel, M. Ohba, D. O. Haskard, and J. C. Mason
A Protein Kinase C{epsilon}-Anti-apoptotic Kinase Signaling Complex Protects Human Vascular Endothelial Cells against Apoptosis through Induction of Bcl-2
J. Biol. Chem., November 2, 2007; 282(44): 32288 - 32297.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
N. M. Mhaidat, R. F. Thorne, X. D. Zhang, and P. Hersey
Regulation of Docetaxel-Induced Apoptosis of Human Melanoma Cells by Different Isoforms of Protein Kinase C
Mol. Cancer Res., October 1, 2007; 5(10): 1073 - 1081.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
H. Ardehali
Signaling Mechanisms in Ischemic Preconditioning: Interaction of PKC{epsilon} and MitoKATP in the Inner Membrane of Mitochondria
Circ. Res., October 13, 2006; 99(8): 798 - 800.
[Full Text] [PDF]


Home page
EndocrinologyHome page
S. G. Laychock, S. M. Sessanna, M.-H. Lin, and L. D. Mastrandrea
Sphingosine 1-Phosphate Affects Cytokine-Induced Apoptosis in Rat Pancreatic Islet {beta}-Cells
Endocrinology, October 1, 2006; 147(10): 4705 - 4712.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Lu, J. Huang, and A. Basu
Protein Kinase C{epsilon} Activates Protein Kinase B/Akt via DNA-PK to Protect against Tumor Necrosis Factor-{alpha}-induced Cell Death
J. Biol. Chem., August 11, 2006; 281(32): 22799 - 22807.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
R. Mangat, T. Singal, N. S. Dhalla, and P. S. Tappia
Inhibition of phospholipase C-{gamma}1 augments the decrease in cardiomyocyte viability by H2O2
Am J Physiol Heart Circ Physiol, August 1, 2006; 291(2): H854 - H860.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Okhrimenko, H.
Right arrow Articles by Brodie, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Okhrimenko, H.
Right arrow Articles by Brodie, C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online