| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell and Tumor Biology |
Regulates the Apoptosis and Survival of Glioma Cells
1 Gonda (Goldschmied) Medical Diagnosis Research Center, Faculty of Life-Sciences, Bar-Ilan University, Ramat Gan, Israel and 2 The Hermelin Brain Tumor Center, Department of Neurosurgery, Henry Ford Hospital, Detroit, Michigan
Requests for reprints: Chaya Brodie, The Hermelin Brain Tumor Center, Department of Neurosurgery, Henry Ford Hospital, Detroit, MI 48202. Phone: 313-916-8619; Fax: 313-916-9855; E-mail: chaya{at}mail.biu.ac.il.
| Abstract |
|---|
|
|
|---|
in the apoptosis and survival of glioma cells using tumor necrosis factorrelated apoptosis inducing ligand (TRAIL)-stimulated cells and silencing of PKC
expression. Treatment of glioma cells with TRAIL induced activation, caspase-dependent cleavage, and down-regulation of PKC
within 3 to 5 hours of treatment. Overexpression of PKC
inhibited the apoptosis induced by TRAIL, acting downstream of caspase 8 and upstream of Bid cleavage and cytochrome c release from the mitochondria. A caspase-resistant PKC
mutant (D383A) was more protective than PKC
, suggesting that both the cleavage of PKC
and its down-regulation contributed to the apoptotic effect of TRAIL. To further study the role of PKC
in glioma cell apoptosis, we employed short interfering RNAs directed against the mRNA of PKC
and found that silencing of PKC
expression induced apoptosis of various glioma cell lines and primary glioma cultures. To delineate the molecular mechanisms involved in the apoptosis induced by silencing of PKC
, we examined the expression and phosphorylation of various apoptosis-related proteins. We found that knockdown of PKC
did not affect the expression of Bcl2 and Bax or the phosphorylation and expression of Erk1/2, c-Jun-NH2-kinase, p38, or STAT, whereas it selectively reduced the expression of AKT. Similarly, TRAIL reduced the expression of AKT in glioma cells and this decrease was abolished in cells overexpressing PKC
. Our results suggest that the cleavage of PKC
and its down-regulation play important roles in the apoptotic effect of TRAIL. Moreover, PKC
regulates AKT expression and is essential for the survival of glioma cells. | Introduction |
|---|
|
|
|---|
, ß1, ß2, and
), the novel PKCs (
,
,
, and
), and the atypical PKCs (PKC
and PKC
/
; ref. 2). Various PKC isoforms have been reported to regulate cell apoptosis in a stimulus- and isoform-dependent manner. Thus, PKC
and PKC
have been mainly associated with antiapoptotic effects in various systems (3, 4), whereas PKC
,
, and µ have been implicated as proapoptotic kinases (5, 6). The novel and atypical PKC isoforms have been reported to undergo caspase-dependent cleavage in response to various apoptotic stimuli and the accumulation of their constitutively active catalytic fragments has been associated with the regulation of cell apoptosis (7, 8).
PKC
has been implicated in the regulation of both cell survival and apoptosis in various cellular systems. Thus, overexpression of PKC
protected MCF-7 cells from tumor necrosis factor (TNF)-
-induced apoptosis (9) and promoted the survival of lung cancer cells (10). In contrast, PKC
has been shown to mediate neuronal death induced by oxidative stress (11) and the apoptosis of macrophages in response to lipopolysaccharide via c-Jun NH2-terminal kinase (JNK) activation (12). PKC
is overexpressed in gliomas (13, 14); however, its role in the regulation of glioma cell apoptosis has not been extensively studied.
TNF-related apoptosis inducing ligand (TRAIL; Apo2 ligand) belongs to the TNF superfamily (15). TRAIL induces apoptosis in transformed cells via binding to the death receptors TRAIL-R1 and TRAIL-R2 (16, 17). The mechanisms underlying TRAIL-induced apoptosis consist of the formation of the death-inducing signaling complex that is also common to other members of the death receptors (18). This leads to activation of caspase 8 at the death-inducing signaling complex followed by either activation of a mitochondrial-independent pathway via caspase 3 and 7 or activation of a mitochondrial-dependent pathway by activation of caspase 9 (19). In addition, recent studies reported that TRAIL activates the transcriptional nuclear factor
B (NF-
B) and JNK in various cellular systems (20) and that NF-
B (21) and phosphoinositide-3-kinase/AKT (22) are involved in the resistance of some transformed cells to the apoptotic effect of TRAIL. PKC signaling has also been shown to modulate TRAIL-induced apoptosis by inhibiting the recruitment of key DD-containing adaptor proteins to their membrane associated signaling complexes (23, 24).
Here, we studied the role of PKC
in the apoptosis and survival of glioma cells using the apoptotic stimulus TRAIL and silencing of PKC
. We found that TRAIL induced caspase-dependent cleavage and down-regulation of PKC
and that both the loss of full-length PKC
and its cleavage play important roles in the apoptotic function of TRAIL. Moreover, our results using short interfering RNAs (siRNA) further indicate that the expression of PKC
is essential for the survival of glioma cells and implicate AKT in this response.
| Materials and Methods |
|---|
|
|
|---|
antibodies were purchased from Santa Cruz (Santa Cruz, CA) or from Upstate Inc. (Charlottesville, VA). Both antibodies were directed against the COOH-terminal (V5 region) of PKC
. Human TRAIL was from Peprotech (Rocky Hill, NJ), and anti-active caspase 3, AKT, p38, JNK, Erk, STAT, AKT, Bax and Bcl2 antibodies were obtained from Cell Signaling Technology (Beverly, MA). Leupeptin, aprotinin, phenylmethylsulfonyl fluoride (PMSF) and sodium vanadate were obtained from Sigma Chemical Co. (St. Louis, MO). The caspase inhibitors, Z-DEVD-FMK, Z-VAD-FMK, Z-IETD-FMK, Z-LEHD-FMK and the PKC
peptide (ERMRPRKRQGSVRRRV) were obtained from Calbiochem (La Jolla, CA). Glioma cells and cell transfection. The glioma cell lines, A172, U87, U251 and LN-229, were grown on tissue culture dishes in medium consisting of DMEM containing 10% FCS, 2 mmol/L glutamine, penicillin (50 units/mL), and streptomycin (0.05 mg/mL).
Primary cultures were obtained from freshly resected tissues following 1 hour of surgical removal. Institutional Review Boardapproved informed consent was obtained from all patients or from the patient's guardian for use of tumor tissue collected at the time of tumor resection. Samples were first washed in PBS and then minced into small pieces in DMEM with 10% FCS and were further triturated to obtain maximal cell dispersion. Cells were plated in 25 cm2 tissue culture flasks and were grown for 7 to 10 days. Cultures were used up to passage 7.
Cells were transfected either with the control vectors or with the different PKC
expression vectors by electroporation using the Nucleofector device (Amaxa Biosystems, Germany). Transfection efficiency using nucleofection was about 80% to 90%.
Site-directed mutagenesis of PKC
. PKC
cloned into the pCMVtag2B plasmid served as a template vector for the site-directed mutagenesis. The caspase cleavage site of PKC
(D383A) was mutated using the QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) and the following primers: sense, (5') GTCGGCCACCGCTGGCCAGCTGG (3'); antisense, (5') CCAGCTGGCCAGCGGTGGCCGAC (3'). The mutation was confirmed by DNA sequencing.
Construction of PKC
green fluorescent protein fusion protein. cDNA encoding PKC
was fused into the NH2-terminalenhanced green fluorescent protein (GFP) vector pEGFP-N1 (Clontech, Palo Alto, CA). The original pEGFP-N1 vector was modified by the insertion of a MluI site in the plasmid polylinker as previously described (25). The clone containing the GFP-PKC
was constructed by the excision of PKC
from MTH-PKC plasmids by digestion with XhoI and MluI. The insert was then ligated into the modified GFP vector using the same restriction sites. DNA sequencing of the GFP-PKC constructs confirmed the intended reading frame.
Adenovirus preparation and infection. The AdEasy system was kindly provided by Dr. Vogelstein (The Johns Hopkins University School of Medicine, MD; ref. 26). PKC
and PKC
kinasedead mutants were first cloned into the pShuttle-CMV vector as previously described for PKC
(27). Cells were incubated with a multiplicity of infection of 5 at the appropriate recombinant adenovirus vectors for 1 hour. The medium was then replaced with fresh medium and the cells were used 24 to 48 hours post-infection.
Short interfering RNA transfection. siRNA duplexes were synthesized and purified by Dharmacon (Lafayette, CO). The siRNA sequence for targeting PKC
mRNA was 5'-GAUGAAGGAGGCGCUCAGTT-3'. A scrambled sequence was used as a negative control. In addition, we used a pool of four PKC
siRNA duplexes which were also obtained from Dharmacon. Transfection of siRNAs was done using 50 nmol/L PKC
or scrambled siRNAs and OligofectAMINE (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. PKC
protein levels were determined using Western blot analysis.
Measurements of cell apoptosis. Cell apoptosis was measured using propidium iodide staining and analysis by flow cytometry as previously described (25). Briefly, detached cells and trypsinized adherent cells were pooled, fixed in 70% ethanol for 1 hour on ice, washed with PBS and treated for 15 minutes with RNase (50 µmol/L) at room temperature. Cells were then stained with propidium iodide (5 µg/mL) and analyzed on a Becton Dickinson (Mountain View, CA) cell sorter. Cell apoptosis was also examined by Western blot analysis of PARP cleavage using anti-PARP antibody (BD PharMingen, San Diego, CA) and by trypan blue exclusion assay.
Preparation of cell homogenates and immunoblot analysis. Cell pellets were resuspended in 100 µL of lysis buffer [25 mmol/L Tris-HCl (pH 7.4), 50 mmol/L NaCl, 0.5% Na deoxycholate, 2% NP40, 0.2% SDS, 1 mmol/L PMSF, 50 µg/mL aprotinin, 50 µmol/L leupeptin, 0.5 mmol/L Na3VO4] on ice for 15 minutes. Sample buffer (2x) was added and the samples were boiled for 5 minutes. Lysates were resolved by SDS-PAGE and were transferred to nitrocellulose membranes. Following incubation with the primary antibody, specific reactive bands were detected using a goat anti-rabbit or goat anti-mouse IgG conjugated to horseradish peroxidase (Bio-Rad, Hercules, CA) and by enhanced chemiluminescence Western blotting detection kit (Amersham, Arlington Heights, IL). Equal loading was verified by Ponceau S staining or by using anti-actin or anti-tubulin antibodies.
Cytochrome c release. Cytochrome c release from the mitochondria was determined in the cytosolic fraction. Mitochondrial and cytosolic fractions were isolated using the ApoAlert Cell Fractionation Kit (Clontech, BD Biosciences) according to the manufacturer's instructions. Cytochrome c was identified in the cytosolic fraction using a rabbit anticytochrome c antibody.
Measurement of caspase 8 activity. Caspase 8 activity was measured using the QuantiPak assay kit obtained from Biomol (Plymouth Meeting, PA) using the fluorescent substrate Ac-IETD-AMC according to the manufacturer's recommendations.
Immunoprecipitation and immune complex PKC
kinase assay. Immunoprecipitation of PKC
and the PKC
kinase assay were done as previously described (28). Briefly, cells treated with TRAIL were lysed in lysis buffer [10 mmol/L Tris-HCl (pH 7.5), 2 mmol/L EDTA and EGTA, 0.5 mmol/L DTT, 200 µmol/L PMSF, 1 µg/mL aprotinin, 2 µg/mL leupeptin, 100 µmol/L sodium orthovanadate, and 0.2% Triton X-100]. Lysates were centrifuged at 4°C and supernatants were incubated with 4 µg of anti-PKC
antibody for 1 hour at 4°C followed by incubation with 100 µL of protein A/G PLUS-Agarose beads for an additional 4 hours. Immunoprecipitates were then used in a kinase assay that was carried out in 200 µL of reaction mixture containing 20 mmol/L HEPES (pH 7.4), 10 mmol/L MgCl2, 0.1 mmol/L EGTA, 0.1 mg/mL PKC
-specific substrate (ERMRPRKRQGSVRRRV), 200 µg/mL phosphatidylserine, 20 µg/mL diacylglycerol, 0.1 mmol/L ATP, and 0.1 µCi/reaction of
-P32-ATP. The reaction mixture was preincubated for 3 minutes in 30°C. Reactions were initiated by adding 25 µL of preincubated mixture to the immunoprecipitates and incubation at 30°C for 10 minutes. Reaction was terminated by spotting 10 µL of each supernatant onto the phosphocellulose filter papers (P-81). The filters were washed thrice in 0.5% phosphoric acid and counted for radioactivity. Cell pellets were separated by PAGE and immunoblotted for PKC
to normalize for the small differences in the amount of immunoprecipitated kinase.
Statistical analysis. The results are presented as the mean ± SE. Data were analyzed using ANOVA and a paired Student's t test to determine the level of significance between the different groups.
| Results |
|---|
|
|
|---|
in glioma cells. PKC
has been implicated in the regulation of cell apoptosis in various cellular systems (912). To examine the role of PKC
in glioma cell apoptosis, we first employed the apoptotic stimulus TRAIL and the A172 glioma cells which are highly sensitive to this ligand. TRAIL induced activation of PKC
, initial activation was observed after 15 minutes of treatment, and was further increased after 2 to 3 hours of treatment (Fig. 1A). The activation of PKC
was followed by translocation of PKC
to the plasma membrane within 15 minutes of treatment as was observed using PKC
tagged to GFP (Fig. 1B). In addition, TRAIL induced cleavage of PKC
and a gradual loss of the full-length isoforms (Fig. 1C). Low levels of the catalytic fragment of PKC
(43 kDa) were already observed after 1 hour, whereas higher levels of this fragment were observed after 2 to 3 hours of treatment. At this time, the expression of the full-length PKC
was significantly reduced, and by 5 hours, PKC
expression was barely detected (Fig. 1C). The accumulation of the catalytic fragment of PKC
preceded the cleavage of PARP, which was first detected after 3 hours of TRAIL treatment (Fig. 1C) and the onset of cell apoptosis as measured using propidium iodide staining and fluorescence-activated cell sorting analysis (data not shown).
|
by TRAIL, whereas the caspase 9 inhibitor, Z-LEHD elicited a partial inhibitory effect (Fig. 1D). Similarly, the caspase inhibitors significantly reduced the apoptosis induced by TRAIL as evidenced by PARP cleavage (data not shown).
Cleavage and down-regulation of PKC
in TRAIL-sensitive and resistant glioma cells. The cleavage and down-regulation of PKC
were further studied in various TRAIL-sensitive and resistant glioma cell lines and in primary glioma cultures (Fig. 2). TRAIL induced a decrease in the expression of the full-length PKC
and accumulation of the PKC
catalytic fragment in the TRAIL-sensitive cell lines (A172, U251, and U87) albeit to a different degree (Fig. 2B). Thus, the full-length PKC
was significantly decreased and high levels of the 43 kDa fragment accumulated in the A172 and U251 cells that exhibited high sensitivity to the apoptotic effect of TRAIL, whereas smaller changes were observed in the U87 cells that exhibited lower sensitivity to TRAIL (Fig. 2A and B). In contrast, no cleavage of PKC
was observed in the TRAIL-resistant cell line, LN-229 (Fig. 2A and B), even when the cells were examined after 24 hours of TRAIL treatment (data not shown), suggesting a role of the cleaved form of PKC
in the apoptotic effect of TRAIL.
|
were observed in the TRAIL-sensitive glioma cultures (HF 1308 and HF 1255), whereas no changes were observed in the TRAIL-resistant primary glioma cells (HF 1286 and HF1318) following 5 hours (Fig. 2C and D) or 24 hours of treatment (data not shown).
Overexpression of PKC
protects glioma cells from the apoptosis induced by TRAIL. Because the expression of PKC
was dramatically decreased in TRAIL-treated cells, we examined whether overexpression of PKC
can protect the A172 cells from apoptosis induced by TRAIL. For these experiments, we used both an adenovirus vector expressing PKC
and the tg2b-PKC
expression vector. As presented in Fig. 3A, both infection of the A172 cells with an adenovirus vector expressing PKC
and transfection of the cells resulted in overexpression of PKC
and treatment of the cells with TRAIL induced cleavage of the PKC
(Fig. 3A). Overexpression of PKC
decreased the apoptosis of the A172 cells in response to TRAIL as compared with control LacZ-Ad-infected cells or as compared with the control vectortransfected cells (Fig. 3B). Thus, PKC
decreased cell apoptosis by about 50% as compared with control vector cells.
|
did not inhibit the activation of caspase 8 by TRAIL (data not shown); however, it abolished the decrease in Bid expression (Fig. 3C) and the release of cytochrome c from the mitochondria to the cytosol (Fig. 3D), suggesting that PKC
acted downstream of caspase 8 activation and upstream of Bid cleavage and activation of the mitochondria pathway.
The PKC
caspase-resistant mutant (D383A) is more protective than PKC
against TRAIL-induced apoptosis. The partial protection of the exogenous PKC
against the apoptosis induced by TRAIL could be due to an apoptotic function of the cleaved overexpressed PKC
. To examine this possibility, we constructed a PKC
mutant in which the aspartic acid at the SSPD site was mutated to alanine (D383A mutant). Following transfection, the A172 cells expressed comparable levels of PKC
and the PKC
D383A mutant (Fig. 4A). Similar to the results described in Fig. 3, the wild-type PKC
underwent cleavage in response to TRAIL (Fig. 4A) and decreased the apoptosis of the cells by about 40% to 50% cells, as shown by measurements of cell apoptosis (Fig. 4B) and by the morphologic appearance of the cells (Fig. 4C). In contrast, the PKC
D383A did not undergo cleavage in response to TRAIL treatment (Fig. 4A) and overexpression of this mutant exerted a stronger protective effect against the apoptosis induced by TRAIL. Thus, in these cells, only 5% to 10% of the cells were apoptotic as compared with 55% to 60% apoptotic cells in the control vector cells (Fig. 4B and C). These results suggest that the PKC
D383A acted as a dominant-negative of PKC
and that the cleavage of PKC
contributed to the apoptosis induced by TRAIL. Similarly, we found that the expression of active caspase 3 induced by TRAIL was inhibited by PKC
and to a larger degree by the PKC
D338A mutant (Fig. 4D).
|
induces apoptosis of glioma cells. Our results thus far suggest that the loss of PKC
contributes to the apoptosis induced by TRAIL. We therefore examined whether the expression of PKC
was essential for the survival of glioma cells. For these experiments, we designed a siRNA targeting the human PKC
mRNA (
1 siRNA). In addition, we employed a pool of four PKC
siRNA duplexes (Dharmacon,
2 siRNA). Transfection of the A172 cells with either PKC
siRNAs decreased the expression of PKC
in the cells by 90% after 3 days of transfection (Fig. 5A), whereas it did not affect the levels of the other PKC isoforms expressed in the A172 cells (PKC
, ß,
,
,
and µ; data not shown). The PKC
siRNA transfected cells exhibited a high degree of cell apoptosis as compared with cells transfected with control scrambled siRNA as determined by propidium iodide staining and fluorescence-activated cell sorting analysis (Fig. 5A) or by histone ELISA (data not shown).
|
siRNAs significantly reduced the expression of PKC
in these cells (Fig. 5B and C) and increased cell death of the transfected cells as shown by propidium iodide staining (Fig. 5B), the morphologic appearance of the cells and by trypan blue exclusion assay (Fig. 5D).
Loss of PKC
induces a decrease in the expression of Akt. To explore the mechanisms by which knockdown of PKC
induces cell apoptosis in glioma cells, we examined the expression and phosphorylation of various apoptosis-related proteins in the A172 cells transfected with the PKC
siRNA. As presented in Fig. 6A, knockdown of PKC
specifically decreased the expression of PKC
, whereas no changes were observed in the expression of PKC
. The silencing of PKC
increased the expression of active caspase 3, whereas it did not affect the expression of the apoptosis-related proteins, Bax and BCl2, or the phosphorylation and expression of the kinases JNK, Erk, p38, and STAT1 (Fig. 6A). In contrast, the knockdown of PKC
expression significantly inhibited the phosphorylation and expression of AKT in these cells (Fig. 6A).
|
reduced the expression of AKT, we examined whether loss of PKC
expression in response to TRAIL treatment also reduced the expression of this protein. For these experiments, we used cells transfected with control vector and PKC
and treated them with TRAIL for 3 hours. As presented in Fig. 6B, treatment of control vector cells with TRAIL significantly decreased the expression of AKT in the cells after 3 hours of treatment (a time in which PKC
was cleaved and degraded). In contrast, no significant decrease in AKT expression was observed in cells overexpressing PKC
, suggesting the down-regulation of PKC
expression induced by TRAIL mediated the decrease in AKT expression. | Discussion |
|---|
|
|
|---|
in the apoptosis and survival of glioma cells using the apoptotic stimulus TRAIL and siRNAs directed against PKC
mRNA. We found that TRAIL induced activation of PKC
within 15 to 30 minutes of TRAIL treatment which was further increased after 3 hours. The early and late activation of PKC
are probably mediated by two distinct mechanisms; a cleavage-independent activation at the early time points and a cleavage-dependent activation at the later time point which could be attributed to the generation of a constitutively active catalytic fragment. Indeed, similar results of cleavage-dependent activation of PKC
were recently reported in TNF-
treated cells (9).
TRAIL also induced translocation of PKC
to the plasma membrane. The translocation of PKC is associated with the activation of this enzyme and it is considered as an important molecular event in the function of this kinase family (29). Translocation of PKC is mediated by binding to selective anchoring proteins or selective receptors for activated C-kinases (RACK; ref. 30) and several domains of PKC
have implicated its translocation and anchoring to the membrane (31). The mechanisms by which TRAIL induces translocation of PKC
and the role of this translocation in PKC
effects are currently not understood. However, membranal translocation of PKC
has been associated with the apoptotic effect of UV radiation (32).
TRAIL induced cleavage and down-regulation of PKC
and generation of a 43 kDa fragment in all the cells that were sensitive to TRAIL. In contrast, no cleavage of PKC
was observed in the TRAIL-resistant glioma cells, suggesting that the cleavage and loss of PKC
were involved in the apoptotic response of TRAIL. Various studies have shown that PKC isoforms are proteolytically cleaved in response to apoptotic stimuli and that the apoptotic effect of some of these isoforms is associated with the accumulation of the cleaved constitutive active catalytic fragment (6, 33). Indeed, cleavage of PKC
(26, 34), PKC
(35), PKCµ (7), and PKC
(36) have been reported in response to various apoptotic stimuli such as radiation, chemotherapeutic drugs and ligation of the FAS and TNF-
receptors, and caspase 3 has been implicated in the cleavage of these PKC isoforms (6, 7, 26, 34).
PKC
undergoes cleavage in response to serum deprivation (37), chemotherapeutic agents (38) and TNF-
treatment (9). Koriyama et al. (29) and Hoppe et al. (37) showed both in vitro and in vivo, that caspase 3 mediated the cleavage of PKC
in their cellular systems. In contrast, Basu et al. (9) reported that in the MCF-7 cells that lack functional caspase 3, the cleavage of PKC
is mediated by caspase 7. We found that TRAIL induced the generation of a 43 kDa fragment in all the glioma cells that were examined in this study, and no other catalytic fragments were detected. Using different caspase inhibitors, we found that the caspase 3 and caspase 8 inhibitors completely inhibited the cleavage of PKC
and the apoptosis induced by TRAIL, whereas partial inhibition was observed with the caspase 9 inhibitor. Thus, our data suggest that in glioma cells, TRAIL exerts apoptosis via activation of caspases 8 and 9 and that caspase 3 cleaves PKC
at the atypical cleavage site, SSPD in the hinge region.
We found that TRAIL induced a large decrease in the expression of the full-length PKC
in parallel to the increased generation of its cleaved catalytic fragment. PKC
has been associated with antiapoptotic functions in various cellular systems including lung cancer cells (10), T lymphocytes (39), and prostate cancer cells (40). We therefore hypothesized that the down-regulation of PKC
mediated the apoptotic effect of TRAIL. We found that overexpression of PKC
in the A172 cells inhibited the apoptosis induced by TRAIL, acting downstream from caspase 8 activation and upstream of Bid cleavage and activation of the mitochondrial pathway. Overexpression of PKC
inhibited the apoptosis induced by TRAIL by 50% to 60%, suggesting that the down-regulation of PKC
may not be the only factor involved in the apoptotic effect of TRAIL. A partial protective effect of PKC
on the apoptosis of glioma cell lines treated with TRAIL was also observed by Shinohara et al. (41).
The overexpressed PKC
underwent cleavage in TRAIL-treated cells, similar to the endogenous PKC
, suggesting that the partial protective effect of PKC
may be due to an apoptotic effect of the cleaved fragment. We found that a PKC
mutant in which aspartic acid 383 was mutated to alanine (D383A) and which did not undergo cleavage in response to TRAIL, was significantly more effective than the wild-type PKC
in protecting A172 cells from apoptosis induced by TRAIL. Thus, our results suggest that the cleavage of PKC
contributed to the apoptotic effect of TRAIL in glioma cells. The cleaved PKC
has been associated with both pro- and antiapoptotic effects in various cellular systems. Thus, apoptotic effects of the cleaved PKC
catalytic fragment were observed in the GH3B6 cells (38), whereas Basu et al. (9) reported that the catalytic domain of PKC
exerted an antiapoptotic effect in TNF-
-treated cells.
The down-regulation of PKC
in TRAIL-treated glioma cells raised the possibility that the expression of PKC
is essential for the survival of these cells. Using siRNAs directed against PKC
mRNA, we reduced PKC
expression in the cells by 90%. Silencing of PKC
expression induced cell apoptosis in all the glioma cell lines and primary cultures that were examined, further suggesting an important role of PKC
in the survival of glioma cells.
We found that the decrease in PKC
expression by either siRNAs or TRAIL induced a selective decrease in the expression of AKT, whereas the expression of other apoptosis-related proteins was not significantly affected. AKT (PKB) is a family of serine-threonine kinases that regulates cell survival in a variety of cellular systems including gliomas (42, 43). The survival effects of AKT are exerted by phosphorylating proteins such as BAD, caspase 9, and the forkhead transcription factors or by activating antiapoptotic pathways such as NF-
B (43). The activity of AKT is regulated by phosphorylation on Thr308 by PDK-1 and on Ser473 by an unidentified kinase referred to as PDK-2 (44). In addition, the activity of AKT is also regulated by its degradation via diverse mechanisms. Indeed, proteasome-dependent degradation of AKT has been reported in response to treatment of tumor cells with Hsp90-specific inhibitors (45), whereas caspase-dependent and independent degradation of AKT occurs in response to p53 inhibition of the a6ß4 integrin survival signaling (46), UV radiation (47), and inhibition of the vascular endothelial growth factor receptor pathway (48). The mechanisms by which loss of PKC
induced a decrease in the expression of AKT are currently not understood. One possibility is that down-regulation of PKC
induced activation of caspase 3 that results in the cleavage and degradation of AKT. Indeed, silencing of PKC
induced activation of caspase 3 and overexpression of PKC
decreased the activation of caspase 3 induced by TRAIL. Alternatively, down-regulation of the Hsp90 protein, which is required for the stability of AKT, is another possible mechanism because PKC has been associated with the regulation of Hsp90 under various conditions (49). Finally, the direct regulation of AKT expression by PKC
may be also considered because interaction between AKT and PKC
has been shown in various cellular systems (50).
In summary, the results of both TRAIL-induced apoptosis and PKC
silencing indicate that the expression of AKT is regulated by PKC
and that PKC
is essential for the survival of glioma cells. Our results also suggest that in TRAIL-treated cells, the cleaved PKC
contributes to the apoptotic effect of TRAIL, in addition to the loss of this isoform from the cells. Thus, in addition to delineating the role of PKC
in TRAIL-induced apoptosis, the results of this study have broader implications for the role of PKC
signaling in the regulation of AKT expression and for glioma cell function. We (13) and others (14) have recently reported that PKC
is highly expressed in glioblastomas. Thus, our results that PKC
is essential for the survival of glioma cells identify an important role of PKC
in these tumors.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Michelle Johnston and Donghong Ju for their excellent technical assistance and Sandra Rempel for critical review of the manuscript.
Received 3/29/05. Revised 5/22/05. Accepted 6/ 2/05.
| References |
|---|
|
|
|---|
in Bcl2 phosphorylation and suppression of apoptosis. J Biol Chem 1998;273:2543642.
activity is necessary for Bcr-Abl-mediated resistance to drug-induced apoptosis. J Biol Chem 1999;274:392730.
by an ICE/CED 3-like protease induces characteristics of apoptosis. J Exp Med 1996;184:2399404.
catalytic domain. J Invest Dermatol 2004;123:43443.[CrossRef][Medline]
by caspase-mediated processing and transduction of antiapoptotic signals. J Biol Chem 2002;277:418506.
promotes survival of lung cancer cells by suppressing apoptosis through dysregulation of the mitochondrial caspase pathway. J Biol Chem 2002;277:3530513.
in neuronal death induced by oxidative stress. Biochem Biophys Res Commun 2004;320:78994.[CrossRef][Medline]
is involved in JNK activation that mediates LPS-induced TNF-
, which induces apoptosis in macrophages. Am J Physiol Cell Physiol 2003;285:C123545.
and protein kinase C
play opposite roles in the proliferation and apoptosis of glioma cells. Cancer Res 2001;61:46129.
in astroglial brain tumor derived cell lines and primary tumor samples. Int J Oncol 1999;15:23743.[Medline]
B kinase and c-Jun N-terminal kinase. Mol Cell Biol 2000;20:663845.
B and protects against TRAIL-mediated apoptosis, yet retains an incomplete death domain. Immunity 1997;7:81320.[CrossRef][Medline]
is essential for its apoptotic effect in response to etoposide. Mol Cell Biol 2002;22:18295.
in reactivation of Kaposi's sarcoma-associated herpesvirus. J Virol 2004;78:1018792.
associates with and is involved in the phosphorylation of RasGRP3 in response to phorbol esters. Mol Pharmacol 2004;66:7684.
and
by caspase-3 in U937 cells during chemotherapeutic agent-induced apoptosis. Cell Signal 1999;11:8318.[CrossRef][Medline]
and -
. Mol Cancer Res 2004;2:12940.
and protein kinase C
to membrane is required for ultraviolet B-induced activation of mitogen-activated protein kinases and apoptosis. J Biol Chem 1999;274:1538994.
. Apoptosis 2003;8:1927.[CrossRef][Medline]
is essential for etoposide-induced apoptosis in salivary gland acinar cells. J Biol Chem 1999;274:1911523.
in induction of apoptosis. J Biol Chem 1997;272:2031720.
PKC but not
/
PKC by caspase-3 during UV-induced apoptosis. J Biol Chem 1999;274:1076570.
isoform during cell death in AKR-2B fibroblasts. Exp Cell Res 2001;266:6473.[CrossRef][Medline]
and
promote T-cell survival by a rsk-dependent phosphorylation and inactivation of BAD. J Biol Chem 2000;275:3724650.
interacts with Bax and promotes survival of human prostate cancer cells. Oncogene 2003;22:795868.[CrossRef][Medline]
against TNF-related apoptosis-inducing ligand (TRAIL)-induced apoptosis in glioma cells. Biochem Biophys Res Commun 2001;284:11627.[CrossRef][Medline]
6ß4 integrin survival signaling by promoting the caspase 3-dependent cleavage of AKT/PKB. J Cell Biol 1999;147:106372.
is a unique regulator for hsp90 ß gene in heat shock response. J Biol Chem 2003;278:511439.
to the protein kinase B/Akt survival pathway in recurrent prostate cancer cells. Oncogene 2004;23:865972.[CrossRef][Medline]This article has been cited by other articles:
![]() |
G. K. Lonne, K. C. Masoumi, J. Lennartsson, and C. Larsson Protein Kinase C{delta} Supports Survival of MDA-MB-231 Breast Cancer Cells by Suppressing the ERK1/2 Pathway J. Biol. Chem., November 27, 2009; 284(48): 33456 - 33465. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Koh, K. Sachidanandam, A. N. Stratman, A. Sacharidou, A. M. Mayo, E. A. Murphy, D. A. Cheresh, and G. E. Davis Formation of endothelial lumens requires a coordinated PKC{epsilon}-, Src-, Pak- and Raf-kinase-dependent signaling cascade downstream of Cdc42 activation J. Cell Sci., June 1, 2009; 122(11): 1812 - 1822. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. F. Steinberg Structural Basis of Protein Kinase C Isoform Function Physiol Rev, October 1, 2008; 88(4): 1341 - 1378. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-H. Kim, Y.-S. Kim, C.-H. Park, I.-Y. Chung, J.-M. Yoo, J.-G. Kim, B.-J. Lee, S.-S. Kang, G.-J. Cho, and W.-S. Choi Protein Kinase C-{delta} Mediates Neuronal Apoptosis in the Retinas of Diabetic Rats via the Akt Signaling Pathway Diabetes, August 1, 2008; 57(8): 2181 - 2190. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Steinberg, O. A. Harari, E. A. Lidington, J. J. Boyle, M. Nohadani, A. M. Samarel, M. Ohba, D. O. Haskard, and J. C. Mason A Protein Kinase C{epsilon}-Anti-apoptotic Kinase Signaling Complex Protects Human Vascular Endothelial Cells against Apoptosis through Induction of Bcl-2 J. Biol. Chem., November 2, 2007; 282(44): 32288 - 32297. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. M. Mhaidat, R. F. Thorne, X. D. Zhang, and P. Hersey Regulation of Docetaxel-Induced Apoptosis of Human Melanoma Cells by Different Isoforms of Protein Kinase C Mol. Cancer Res., October 1, 2007; 5(10): 1073 - 1081. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ardehali Signaling Mechanisms in Ischemic Preconditioning: Interaction of PKC{epsilon} and MitoKATP in the Inner Membrane of Mitochondria Circ. Res., October 13, 2006; 99(8): 798 - 800. [Full Text] [PDF] |
||||
![]() |
S. G. Laychock, S. M. Sessanna, M.-H. Lin, and L. D. Mastrandrea Sphingosine 1-Phosphate Affects Cytokine-Induced Apoptosis in Rat Pancreatic Islet {beta}-Cells Endocrinology, October 1, 2006; 147(10): 4705 - 4712. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Lu, J. Huang, and A. Basu Protein Kinase C{epsilon} Activates Protein Kinase B/Akt via DNA-PK to Protect against Tumor Necrosis Factor-{alpha}-induced Cell Death J. Biol. Chem., August 11, 2006; 281(32): 22799 - 22807. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Mangat, T. Singal, N. S. Dhalla, and P. S. Tappia Inhibition of phospholipase C-{gamma}1 augments the decrease in cardiomyocyte viability by H2O2 Am J Physiol Heart Circ Physiol, August 1, 2006; 291(2): H854 - H860. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |