Cancer Research Cancer Research Funding Available  Telomeres
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tissier, F.
Right arrow Articles by Bertherat, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tissier, F.
Right arrow Articles by Bertherat, J.
[Cancer Research 65, 7622-7627, September 1, 2005]
© 2005 American Association for Cancer Research


Molecular Biology, Pathobiology and Genetics

Mutations of ß-Catenin in Adrenocortical Tumors: Activation of the Wnt Signaling Pathway Is a Frequent Event in both Benign and Malignant Adrenocortical Tumors

Frédérique Tissier1,3, Catherine Cavard2, Lionel Groussin1,4, Karine Perlemoine1, Gwladys Fumey1, Anne-Marie Hagneré3, Fernande René-Corail1, Eric Jullian1,5, Christine Gicquel6,7, Xavier Bertagna1,4,7, Marie-Cécile Vacher-Lavenu3, Christine Perret2 and Jérôme Bertherat1,4,7

Departments of 1 Endocrinology and 2 Genetics, Development and Molecular Pathology, Institut Cochin, Institut National de la Santé et de la Recherche Médicale U567, Centre National de la Recherche Scientifique, Unité Mixte de Recherche 8104, IFR116, René Descartes-Paris 5 University; Departments of 3 Pathology and 4 Endocrinology, and 5 Oncogenetics Unit, Hopital Cochin, Assistance Publique-Hôpitaux de Paris, René Descartes-Paris 5 University; 6 Department of Physiology, Hopital Trousseau, Assistance Publique-Hôpitaux de Paris; and 7 COMETE Network, Paris, France

Requests for reprints: Jérôme Bertherat, Service des Maladies Endocriniennes et Métaboliques, Hôpital Cochin, 27 rue du Fg-St-Jacques, 75014, Paris, France. Phone: 15-841-1895; Fax: 14-633-8060; E-mail: jerome.bertherat{at}cch.ap-hop-paris.fr.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Adrenocortical cancer is a rare cancer with a very poor prognosis. The genetic alterations identified to date in adrenocortical tumors are limited. Activating mutations of the Wnt signaling pathway have been observed in more frequent cancers, particularly digestive tract tumors. We investigated whether Wnt pathway activation is involved in adrenocortical tumorigenesis. In a series of 39 adrenocortical tumors, immunohistochemistry revealed abnormal cytoplasmic and/or nuclear accumulation of ß-catenin in 10 of 26 adrenocortical adenomas and in 11 of 13 adrenocortical carcinomas. An activating somatic mutation of the ß-catenin gene was shown in 7 of 26 adrenocortical adenomas and in 4 of 13 adrenocortical carcinomas; these mutations were observed only in adrenocortical tumors with abnormal ß-catenin accumulation and most were point mutations altering the Ser45 of exon 3 (in the consensus GSK3-ß/CK1 phosphorylation site). Functional studies showed that the activating Ser45 ß-catenin mutation found in the adrenocortical cancer H295R cell line leads to constitutive activation of T-cell factor–dependent transcription. This is the first molecular defect to be reported with the same prevalence in both benign (27%) and malignant (31%) adrenocortical tumors. ß-Catenin mutations are also the most frequent genetic defect currently known in adrenocortical adenomas. In adrenocortical adenomas, ß-catenin alterations are more frequent in nonfunctioning tumors, suggesting that ß-catenin pathway activation might be mostly involved in the development of nonsecreting adrenocortical adenomas and adrenocortical carcinomas. The very frequent and substantial accumulation of ß-catenin in adrenocortical carcinomas suggests that other alterations might also be involved. This finding may contribute to new therapeutic approaches targeting the Wnt pathway in malignant adrenocortical tumors, for which limited medical therapy is available.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Adrenocortical tumors can be diagnosed as adrenocortical adenomas or adrenocortical carcinomas, which have a very poor prognosis (13). Most sporadic adrenal tumors are monoclonal, suggesting that a somatic genetic defect occurs early during tumorigenesis (4). Somatic mutations of the tumor suppressor gene TP53 were initially reported, mostly in adrenal carcinomas (5). More recently, we have reported somatic inactivating mutations of the tumor suppressor gene PRKAR1A in a subgroup of adrenocortical adenomas responsible for Cushing's syndrome (6). Consistent with the occurrence of adrenocortical tumors in the Li-Fraumeni and Beckwith-Wiedemann syndromes (7), allelic losses [loss of heterozygosity (LOH)] at the TP53 locus at 17p13 and the insulin-like growth factor II (IGF-II) locus at 11p15 have been observed in adrenocortical carcinomas (8). IGF-II overexpression is a major characteristic of adrenocortical carcinomas and has been suggested as a prognostic factor (9). However, the physiopathology of adrenocortical tumors is not well documented because very few genetic alterations have been identified in these tumors (10). Molecular studies have pinpointed activating mutations of the Wnt signaling pathway as the cause of many cancers (1113). ß-Catenin plays a central role in the Wnt signaling pathway. It has a structural role in cell-cell adhesion and is a transcription cofactor with T-cell factor/lymphoid enhancer factor (TCF/LEF) in the Wnt signaling pathway. In the absence of Wnt signaling, the level of ß-catenin is low: ß-catenin is phosphorylated at critical NH2-terminal residues by the GSK3-ß bound to a scaffolding complex of axin and adenomatous polyposis proteins (APC) and subsequently the phosphorylated protein is degraded by the ubiquitin-proteasome system (14). Wnt stimulation leads to the inactivation of GSK3-ß and thereby the stabilization of ß-catenin in the cytoplasm. Consequently, ß-catenin becomes available to bind the TCF/LEF family of transcription factors and to induce target gene expression (15). We report a study of the status of ß-catenin by immunohistochemistry, DNA sequencing, and functional study of the H295R cell line to assess its contribution to adrenocortical tumorigenesis.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Patients. Patients included in the study were investigated for a sporadic adrenocortical tumor (other than Conn's adenoma) in the Endocrinology Department of Cochin Hospital. None of the 39 patients presented features of any adrenocortical tumor–predisposing syndrome (Beckwith-Wiedemann, Carney complex, McCune-Albright, Multiple Endocrine Neoplasia type 1, or Li-Fraumeni syndrome). Clinical data, hormonal status, and tumor stage (McFarlane classification) were assessed as previously described (16, 17). Informed consent for the analysis of leukocyte and tumor DNA and for access to the data collected was obtained from all the patients, and the study was approved by an institutional review board (Comité Consultatif de Protection des Personnes dans la Recherche Biomédicale, Cochin Hospital, Paris). The allelic status at the 11p15 and 17p13 loci and IGF-II messenger abundance in tumors were determined as previously described (8). After surgery, patients were examined twice a year for 2 years and annually thereafter. Hormonal evaluation, chest X-ray, and computerized tomography scans of the abdomen and thorax were carried out at each evaluation for adrenocortical carcinoma. The patients were followed until their date of death, their last examination, or the end of the follow-up period. The minimal and the maximal follow-up periods were 12 and 159 months, respectively (mean 81.9 ± 32.3).

Human H295R cell line. The human adrenocortical cancer H295R cell line was grown as previously described (18) in DMEM/Ham's F-12 supplemented with 2% Ultroser G (Biosepra, Fremont, CA), 2 mmol/L glutamine, 5 µg/mL insulin, 5 µg/mL transferrin, 5 ng/mL selenium, 50 units/mL penicillin, and 50 mg/mL streptomycin.

Microscopy. The tumors were fixed in formalin, embedded in paraffin, and 4 µm sections were cut and stained with H&E-safran. The sections were examined to assess their Weiss score (0 to 9) on the basis of the presence or absence of the following nine histologic features: high mitotic rate, atypical mitoses, high nuclear grade, low percentage of clear cells, necrosis, diffuse tumor architecture, capsular invasion, sinusoidal invasion, and venous invasion (19).

Immunohistochemical staining. Sections, 4 µm thick, from formalin-fixed tissue embedded in paraffin were mounted on Superfrost/Plus glass slides. Immunohistochemistry for ß-catenin was done as previously described (15). For negative controls, some sections were incubated without the primary antibody. The slides were counterstained with Mayer hematoxylin. Immunostaining was assessed by an investigator blinded to McFarlane stage, Weiss score, and outcome. The entirety of ß-catenin–stained sections was examined. Immunohistochemical labeling was evaluated for the presence of membranous, cytoplasmic, and nuclear staining by a qualitative assessment, and cytoplasmic and/or nuclear staining was recorded as intracellular accumulation. The intensity of staining was not scored.

Nucleic acid extraction and mutation analysis of the ß-catenin gene. DNA was extracted from peripheral blood leukocytes using the Wizard Genomic DNA Purification KIT (Promega Corp., Madison, WI). Tumor DNA and RNA were purified by cesium chloride gradient ultracentrifugation as previously reported (20). cDNA was synthesized by Moloney murine leukemia virus-reverse transcriptase (Invitrogen, Groningen, the Netherlands) using 1 µg of total RNA in a final volume of 40 mL. For mutation analysis, exon 3 and the flanking intronic sequences of the ß-catenin gene were amplified by PCR from both tumoral and leukocyte DNA. The primers used were ßCATEX2F (GAAAATCCAGCGTGGACAATG) and ßCATEX4R (TCGAGTCATTGCATACTGTCC). Both strands of the amplified products were directly sequenced on an automated sequencer (ABI 3700; Perkin-Elmer, Boston, MA). To search for large ß-catenin gene deletions, exon 3 was also amplified from tumor cDNA using the primers ßCATF1 (GCGTGGACAATGGCTACTCAAG) and ßCATR2 (TTCAGCACTCTGCTTGTGGTCC). The primer ßCATR1 (TTCAGGGATTGCACGTGTGGC) was also used for sequencing for large ß-catenin gene deletion analysis. Mutations were confirmed twice on two independent experiments.

Cell line, transfection, and reporter assays. The human adrenocortical cancer H295R cell line was maintained as previously described (18).

Transient transfections were done when cells were 60% to 70% confluent in 12-well plates using Effectene transfection reagent (Qiagen GmbH, Hilden, Germany). The total amount of transfected DNA (1.25 µg per well) was kept constant by adding pcDNA3. A TK-Renilla plasmid (10 ng) was included in each transfection for monitoring of transfection efficiency. PTOPFLASH [containing two copies of the ß-catenin/T-cell factor (TCF)-binding sites], pFOPFLASH (containing two mutated copies of the ß-catenin/TCF-binding sites), and the expression plasmid encoding the dominant-negative form of TCF (p{Delta}NTCF4) were kindly provided by H. Clevers (Utrecht, the Netherlands); 0.25 µg of pTOPFLASH or pFOPFLASH plasmid and growing quantities of p{Delta}NTCF4 (from 50 ng to 1 µg) were added per well. All experiments were done in triplicate and repeated at least thrice. Cells were lysed 36 hours after transfection and the luciferase and renilla activities were assayed using Promega Dual Luciferase Reporter Assay (Promega). The activity of the reporter constructs was expressed as normalized relative light units.

Statistical analysis. The {chi}2 test was used to compare rates of ß-catenin delocalization or mutations between tumor groups. Statistical analyses were done using the StatView 5.0 program (SAS Institute, Cary, NC); significance was set at P < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Clinicopathologic results. The clinicopathologic results are summarized in Table 1. The 39 patients (34 females) were 25 to 79 years old (mean ± SD: 45.9 ± 15.1). Thirty-two patients (82%) presented an adrenal steroid excess (mainly cortisol and/or androgens). Thirty-two patients (82%) underwent curative surgery. Thirty patients (77%) had localized tumors (McFarlane stage I and II). Nine patients (23%) had disseminated tumors at diagnosis (McFarlane stage IV); four patients had tumors invading adjacent organs and five patients had distant metastases. All of the nine patients with obviously malignant tumors (stage IV) had a Weiss score of ≥3 and 26 patients (87%) with localized tumors (stage I and II) had a Weiss score of ≤2.


View this table:
[in this window]
[in a new window]

 
Table 1. Clinicopathologic and genetic features [11p15 uniparental disomy, 17p13 allelic loss (LOH), and overexpression of the IGF-II gene] in 39 patients with sporadic adrenocortical tumors

 
ß-Catenin expression. A hallmark of active ß-catenin signaling in the tumor is a cytoplasmic/nuclear staining for ß-catenin (13). We used immunohistochemistry to examine the cellular localization of ß-catenin in a cohort of 39 adrenocortical tumors and in human H295R adrenocortical cancer cell lines (Table 2). Cytoplasmic/nuclear staining was observed in 10 of the 26 adrenocortical adenomas (38%), but ß-catenin accumulation was focal and present in only a few tumor cells (Fig. 1). Interestingly, most adrenocortical adenomas showing an abnormal ß-catenin immunostaining were nonfunctioning adrenocortical tumors (i.e., not responsible for steroid oversecretion; Table 1): 5 of 6 (83%) of the nonfunctioning adrenocortical adenomas showed an abnormal ß-catenin immunostaining, in contrast to 5 of 20 (25%) of the secreting adrenocortical adenomas (responsible for glucocorticoid oversecretion; P < 0.01, {chi}2 test).


View this table:
[in this window]
[in a new window]

 
Table 2. Mutation analysis and immunohistochemical staining of ß-catenin in 39 patients with sporadic adrenocortical tumors and in human cell line H295R

 


View larger version (79K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. H&E-safran and immunohistochemical staining for ß-catenin in adrenocortical tumors and the human adrenocortical carcinoma cell line H295R. Adrenocortical tumor with a Weiss score of 0 (adrenocortical adenoma) and without ß-catenin mutation (A1: H&E-safran, 200x; A2: immunohistochemical staining of ß-catenin, 400x; arrow, membranous localization of ß-catenin). Adrenocortical tumor with a Weiss score of 0 (adrenocortical adenoma) and with a ß-catenin mutation (B1: H&E-safran, 400x; B2: immunohistochemical staining of ß-catenin, 400x). Adrenocortical tumor with a Weiss score of 8 (adrenocortical carcinoma) and with a ß-catenin mutation (C1: H&E-safran, 400x; C2: immunohistochemical staining of ß-catenin, 400x). Human cell line H295R (D1: immunohistochemical staining of ß-catenin, 400x; D2: negative control, 400x).

 
Eleven of the 13 adrenocortical carcinomas (77%) had a diffuse cytoplasmic/nuclear ß-catenin accumulation (Fig. 1). Thus, an abnormal cytoplasmic/nuclear localization of ß-catenin is frequent in adrenocortical tumor. However, the pattern differs between tumors. The abnormal ß-catenin immunostaining was focal in most adrenocortical adenomas and diffuse in adrenocortical carcinomas. Interestingly, the same abnormal nuclear and cytoplasmic ß-catenin localization was also observed in H295R cells (Fig. 1).

ß-Catenin genetic analysis. The results of ß-catenin genetic analysis in all the tumors and the H295R cells are summarized in Table 2. A molecular alteration of the ß-catenin gene was observed in 11 of 39 adrenocortical tumors (28%) and in H295R cells. Most of these mutations (8 of 12) were point mutation altering the Ser45 of exon 3 and resulting in an amino acid substitution. Deletion or insertion leading to alteration of exon 3 was observed in the other tumors. None of these genetic alterations were observed in leukocyte DNA of the patients, demonstrating their somatic origin.

Genetic alterations were observed both in adrenocortical adenomas and adrenocortical carcinomas. They were observed only in tumors showing an abnormal ß-catenin immunostaining pattern. Among the nonfunctioning adrenocortical adenomas, 4 of 6 (67%) harbor a somatic ß-catenin mutation, in contrast to 3 of 20 (15%) of the functioning adrenocortical adenomas, suggesting an association with the tumor phenotype (P = 0.01, {chi}2 test). Despite the higher frequency of ß-catenin immunostaining alterations in adrenocortical carcinomas than in adrenocortical adenomas, the frequency of mutation [7 of 26 (27%) in adrenocortical adenomas; 4 of 13 (31%) in adrenocortical carcinomas] was similar in the two groups of tumors. The adrenocortical cancer cell line H295R has a similar mutation leading to alteration of Ser45 of ß-catenin.

Activating ß-catenin mutation in the human adrenocortical cancer H295R cell line leads to efficient T-cell factor–dependent transcription. Stimulation of Wnt signaling in the human adrenocortical cancer H295R cell line was monitored by transfection with a TCF reporter (pTOPFLASH) and a control plasmid containing scrambled TCF-binding sites (pFOPFLASH). Constitutive activity of the TCF reporter is observed in the H295R cell line transfected with the pTOPFLASH. This robust expression can be significantly down-regulated by adding the plasmid p{Delta}NTCF4 encoding the dominant-negative form of TCF (Fig. 2). This result shows that activating ß-catenin mutation in H295R cell line leads to efficient and constitutive TCF-dependent transcription.



View larger version (13K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Study of ß-catenin/TCF activity in the H295R cell line. Histogram showing the relative luciferase activity. Cells were transfected with 0.25 µg of pTOPFLASH (or pFOPFLASH) and 50, 100, 200, 500, 750, and 1,000 ng of p{Delta}NTCF4 plasmid. Columns, mean; bars, SD. Experiments were repeated thrice with similar results.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Immunohistochemistry revealed abnormal cytoplasmic and/or nuclear accumulation of ß-catenin, an evidence of activation of the Wnt signaling pathway, in 21 of the 39 adrenocortical tumors studied. An activating somatic mutation of the ß-catenin gene was shown in 11 of these 21 adrenocortical tumors with abnormal ß-catenin cellular localization. Similarly, the H295R adrenocortical cancer cell line also showed ß-catenin protein accumulation associated with a point mutation of Ser45 in exon 3. Reporter assays showed that activating ß-catenin mutation in the human adrenocortical cancer H295R cell line leads to efficient TCF-dependent transcription.

This is the first study, as far as we know, demonstrating that Wnt signaling activation is frequent in adrenocortical tumorigenesis. Blaker et al. (21), who studied one adrenocortical adenoma in a patient with familial adenomatous polyposis coli, did not describe any ß-catenin mutation but found a somatic APC mutation. Semba et al. (22), in a study of adrenocortical tumors, mostly adenomas, did not find any nuclear accumulation of ß-catenin; because this study only considered nuclear accumulation as a marker of an active ß-catenin signaling pathway, exon 3 was not searched for genetic alterations.

Transcriptome analysis by microarray has shown that the potential target of the ß-catenin pathway, ENC-1, is up-regulated in adrenocortical carcinomas, suggesting that Wnt signaling may play a role in adrenocortical tumorigenesis (23). Interestingly, in our series, most (8 of 12) of the activating ß-catenin mutations involved the residue Ser45 (2426) in the consensus GSK3-ß/CK1 phosphorylation site. It would be interesting to elucidate the physiologic relevance of this mutation in adrenocortical tumorigenesis. In this study, transfections with a TCF reporter gene show constitutive overactivity of the ß-catenin signaling pathway in the H295R cell line. Because this cell line harbors a Ser45 ß-catenin mutation, this shows that in the adrenocortical cortex these genetic alterations lead to Wnt signaling pathway dysregulation and constitutive activation at the nuclear level.

The high rate [21 of 39 (54%)] of adrenocortical tumors with ß-catenin alterations suggests that activation of the Wnt signaling pathway is the most prevalent defect in adrenocortical tumorigenesis. Mutations activating ß-catenin are found in both adrenocortical adenomas and adrenocortical carcinomas. This is thus the first molecular defect to be reported with the same prevalence in both benign and malignant adrenocortical tumors. ß-Catenin mutations have previously been reported in benign tumors, in particular in gallbladder adenomas, and were more frequent than in carcinomas (27). In contrast, p53 mutations are found mainly in adrenocortical carcinomas and PRKAR1A mutations in adrenocortical adenomas. In adrenocortical adenomas, ß-catenin alterations seem more prevalent in nonfunctioning than in functioning tumors. This suggests that ß-catenin pathway activation might be involved in the development of nonsecreting adrenocortical adenomas and adrenocortical carcinomas. Similarly, loss of expression of the transcription factor cAMP-responsive element binding protein seems to be associated with less differentiated nonfunctioning or malignant adrenocortical tumors (28). In contrast, somatic mutations of G{alpha}s or PRKAR1A, associated with activation of the cyclic AMP pathway, are observed in benign secreting adrenocortical tumors (6, 10, 29, 30).

Abnormal cellular localization of ß-catenin is more frequent in adrenocortical carcinomas than in adrenocortical adenomas and was observed in more than 75% of adrenocortical carcinomas. This suggests that genetic alterations of other components of the Wnt signaling pathway, such as APC or axin, may also contribute to adrenocortical carcinomas (31, 32). Alternatively, the high frequency of ß-catenin activation in adrenocortical carcinomas could be the result of cross talk with other signaling pathways, as for instance the IGF system which is almost always activated in such tumors (8). This hypothesis is particularly pertinent for adenocarcinomas of the gastroesophageal junction that frequently show nuclear ß-catenin expression but very few APC and ß-catenin mutations (33). As ß-catenin mutation is the first molecular alteration identified in both adrenocortical adenomas and adrenocortical carcinomas, there may be a common pathophysiologic mechanism involving a multistep tumorigenesis process as speculated for other types of tumors (34). However, this multistep process would mainly concern nonfunctioning adrenal adenoma and adrenal carcinoma. The much more diffuse ß-catenin immunostaining observed in adrenocortical carcinomas than in adrenocortical adenomas suggests that the progression towards a malignant phenotype involves other events leading to severe Wnt signaling pathway dysregulation in cancers.

Finally, the diffuse pattern of ß-catenin immunostaining may serve as a diagnostic marker for malignancy in adrenocortical tumors, and indeed, this diagnosis is in some cases difficult with conventional pathologic methods.

In conclusion, this is the first study to show that Wnt signaling activation is frequent in adrenocortical tumors. It could be explained in half of the cases by somatic ß-catenin mutations. These alterations are present in both malignant and benign adrenocortical tumors, and, in benign cases, seems to favor the development of nonfunctioning tumors. Functional studies in the H295R cell line showed that these genetic alterations of ß-catenin lead to constitutive activity of the Wnt signaling pathway in adrenocortical tumors. Other genetic defects that could activate the Wnt signaling pathway are likely to be found in tumors that do not have a ß-catenin mutation. This finding contributes to the development of new therapeutic approaches targeting the Wnt pathway in malignant adrenocortical tumors for which currently available medical therapies are very limited.


    Acknowledgments
 
Grant support: Plan Hospitalier de Recherche Clinique (AOM 02068 to the Comete Network coordinated by Prof. P.F. Plouin) and the Ligue National Contre le Cancer (04-7571). F. Tissier was a recipient of a grant from Assistance Publique-Hôpitaux de Paris.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank H. Clevers for providing p{Delta}NTCF4 and Benoit Terris, Zhor Bouizar, Marthe Rizk-Rabin, Anne Audebourg, Jocelyne Daugabel, Patricia Dukakis, and Nicole Martineau for helpful discussion and/or their technical assistance.

Received 2/21/05. Revised 6/ 4/05. Accepted 6/17/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Allolio B, Hahner S, Weismann D, Fassnacht M. Management of adrenocortical carcinoma. Clin Endocrinol (Oxford) 2004;60:273–87.[CrossRef][Medline]
  2. Luton JP, Cerdas S, Billaud L, et al. Clinical features of adrenocortical carcinoma, prognostic factors, and the effect of mitotane therapy. N Engl J Med 1990;322:1195–201.[Abstract]
  3. Icard P, Goudet P, Charpenay C, et al. Adrenocortical carcinomas: surgical trends and results of a 253-patient series from the French Association of Endocrine Surgeons study group. World J Surg 2001;25:891–7.[CrossRef][Medline]
  4. Gicquel C, Bertagna X, Le Bouc Y. Recent advances in the pathogenesis of adrenocortical tumours. Eur J Endocrinol 1995;133:133–44.[Abstract/Free Full Text]
  5. Reincke M. Mutations in adrenocortical tumors. Horm Metab Res 1998;30:447–55.[Medline]
  6. Bertherat J, Groussin L, Sandrini F, et al. Molecular and functional analysis of PRKAR1A and its locus (17q22-24) in sporadic adrenocortical tumors: 17q losses, somatic mutations, and protein kinase A expression and activity. Cancer Res 2003;63:5308–19.[Abstract/Free Full Text]
  7. Hisada M, Garber JE, Fung CY, Fraumeni JF Jr, Li FP. Multiple primary cancers in families with Li-Fraumeni syndrome. J Natl Cancer Inst 1998;90:606–11.[Abstract/Free Full Text]
  8. Gicquel C, Bertagna X, Gaston V, et al. Molecular markers and long-term recurrences in a large cohort of patients with sporadic adrenocortical tumors. Cancer Res 2001;61:6762–7.[Abstract/Free Full Text]
  9. de Fraipont F, El Atifi M, Cherradi N, et al. Gene expression profiling of human adrenocortical tumors using cDNA microarrays identifies several candidate genes as markers of malignancy. J Clin Endocrinol Metab 2004;90:1819–29.
  10. Stratakis CA. Genetics of adrenocortical tumors: gatekeepers, landscapers and conductors in symphony. Trends Endocrinol Metab 2003;14:404–10.[CrossRef][Medline]
  11. Clements WM, Wang J, Sarnaik A, et al. ß-Catenin mutation is a frequent cause of Wnt pathway activation in gastric cancer. Cancer Res 2002;62:3503–6.[Abstract/Free Full Text]
  12. de la Coste A, Romagnolo B, Billuart P, et al. Somatic mutations of the ß-catenin gene are frequent in mouse and human hepatocellular carcinomas. Proc Natl Acad Sci U S A 1998;95:8847–51.[Abstract/Free Full Text]
  13. Giles RH, van Es JH, Clevers H. Caught up in a Wnt storm: Wnt signaling in cancer. Biochim Biophys Acta 2003;1653:1–24.[Medline]
  14. Kikuchi A. Tumor formation by genetic mutations in the components of the Wnt signaling pathway. Cancer Sci 2003;94:225–9.[CrossRef][Medline]
  15. Cadoret A, Ovejero C, Terris B, et al. New targets of ß-catenin signaling in the liver are involved in the glutamine metabolism. Oncogene 2002;21:8293–301.[CrossRef][Medline]
  16. Groussin L, Perlemoine K, Contesse V, et al. The ectopic expression of the gastric inhibitory polypeptide receptor is frequent in adrenocorticotropin-independent bilateral macronodular adrenal hyperplasia, but rare in unilateral tumors. J Clin Endocrinol Metab 2002;87:1980–5.[Abstract/Free Full Text]
  17. Macfarlane DA. Cancer of the adrenal cortex; the natural history, prognosis and treatment in a study of fifty-five cases. Ann R Coll Surg Engl 1958;23:155–86.[Medline]
  18. Groussin L, Massias JF, Bertagna X, Bertherat J. Loss of expression of the ubiquitous transcription factor cAMP response element-binding protein (CREB) and compensatory overexpression of the activator CREMtau in the human adrenocortical cancer cell line H295R. J Clin Endocrinol Metab 2000;85:345–54.[Abstract/Free Full Text]
  19. Weiss LM. Comparative histologic study of 43 metastasizing and nonmetastasizing adrenocortical tumors. Am J Surg Pathol 1984;8:163–9.[Medline]
  20. Groussin L, Kirschner LS, Vincent-Dejean C, et al. Molecular analysis of the cyclic AMP-dependent protein kinase A (PKA) regulatory subunit 1A (PRKAR1A) gene in patients with Carney complex and primary pigmented nodular adrenal disease (PPNAD) reveals novel mutations and clues for pathophysiology: augmented PKA signaling is associated with adrenocortical tumorigenesis in PPNAD. Am J Hum Genet 2002;71:1433–42.[CrossRef][Medline]
  21. Blaker H, Sutter C, Kadmon M, et al. Analysis of somatic APC mutations in rare extracolonic tumors of patients with familial adenomatous polyposis coli. Genes Chromosomes Cancer 2004;41:93–8.[CrossRef][Medline]
  22. Semba S, Kusumi R, Moriya T, Sasano H. Nuclear Accumulation of B-Catenin in Human Endocrine Tumors: Association with Ki-67 (MIB-1) Proliferative Activity. Endocr Pathol 2000;11:243–50.[CrossRef][Medline]
  23. Giordano TJ, Thomas DG, Kuick R, et al. Distinct transcriptional profiles of adrenocortical tumors uncovered by DNA microarray analysis. Am J Pathol 2003;162:521–31.[Abstract/Free Full Text]
  24. Polakis P. Wnt signaling and cancer. Genes Dev 2000;14:1837–51.[Free Full Text]
  25. Mirabelli-Primdahl L, Gryfe R, Kim H, et al. ß-Catenin mutations are specific for colorectal carcinomas with microsatellite instability but occur in endometrial carcinomas irrespective of mutator pathway. Cancer Res 1999;59:3346–51.[Abstract/Free Full Text]
  26. Fukuchi T, Sakamoto M, Tsuda H, Maruyama K, Nozawa S, Hirohashi S. ß-Catenin mutation in carcinoma of the uterine endometrium. Cancer Res 1998;58:3526–8.[Abstract/Free Full Text]
  27. Yanagisawa N, Mikami T, Saegusa M, Okayasu I. More frequent ß-catenin exon 3 mutations in gallbladder adenomas than in carcinomas indicate different lineages. Cancer Res 2001;61:19–22.[Abstract/Free Full Text]
  28. Rosenberg D, Groussin L, Jullian E, et al. Transcription factor 3',5'-cyclic adenosine 5'-monophosphate-responsive element-binding protein (CREB) is decreased during human adrenal cortex tumorigenesis and fetal development. J Clin Endocrinol Metab 2003;88:3958–65.[Abstract/Free Full Text]
  29. Weinstein LS, Shenker A, Gejman PV, Merino MJ, Friedman E, Spiegel AM. Activating mutations of the stimulatory G protein in the McCune-Albright syndrome. N Engl J Med 1991;325:1688–95.[Abstract]
  30. Kirschner LS, Carney JA, Pack SD, et al. Mutations of the gene encoding the protein kinase A type I-{alpha} regulatory subunit in patients with the Carney complex. Nat Genet 2000;26:89–92.[CrossRef][Medline]
  31. Satoh S, Daigo Y, Furukawa Y, et al. AXIN1 mutations in hepatocellular carcinomas, and growth suppression in cancer cells by virus-mediated transfer of AXIN1. Nat Genet 2000;24:245–50.[CrossRef][Medline]
  32. Morin PJ, Sparks AB, Korinek V, et al. Activation of ß-catenin-Tcf signaling in colon cancer by mutations in ß-catenin or APC. Science 1997;275:1787–90.[Abstract/Free Full Text]
  33. Koppert LB, van der Velden AW, van de Wetering M, et al. Frequent loss of the AXIN1 locus but absence of AXIN1 gene mutations in adenocarcinomas of the gastro-oesophageal junction with nuclear ß-catenin expression. Br J Cancer 2004;90:892–9.[CrossRef][Medline]
  34. Luft FC. Inherited colon cancer as an example of a multistep process model. J Mol Med 1996;74:487–8.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Jpn J Clin OncolHome page
H. Hosogi, S. Nagayama, N. Kanamoto, A. Yoshizawa, T. Suzuki, K. Nakao, and Y. Sakai
Biallelic APC Inactivation Was Responsible for Functional Adrenocortical Adenoma in Familial Adenomatous Polyposis with Novel Germline Mutation of the APC Gene: Report of a Case
Jpn. J. Clin. Oncol., August 14, 2009; (2009) hyp093v1.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
S. Schinner, H. S Willenberg, M. Schott, and W. A Scherbaum
Pathophysiological aspects of Wnt-signaling in endocrine disease
Eur. J. Endocrinol., May 1, 2009; 160(5): 731 - 737.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
A. C. Kim, F. M. Barlaskar, J. H. Heaton, T. Else, V. R. Kelly, K. T. Krill, J. O. Scheys, D. P. Simon, A. Trovato, W.-H. Yang, et al.
In Search of Adrenocortical Stem and Progenitor Cells
Endocr. Rev., May 1, 2009; 30(3): 241 - 263.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
L. Groussin, G. Bonardel, S. Silvera, F. Tissier, J. Coste, G. Abiven, R. Libe, M. Bienvenu, J.-L. Alberini, S. Salenave, et al.
18F-Fluorodeoxyglucose Positron Emission Tomography for the Diagnosis of Adrenocortical Tumors: A Prospective Study in 77 Operated Patients
J. Clin. Endocrinol. Metab., May 1, 2009; 94(5): 1713 - 1722.
[Abstract] [Full Text] [PDF]


Home page
Vet PatholHome page
M. Bielinska, H. Parviainen, S. Kiiveri, M. Heikinheimo, and D. B. Wilson
REVIEW PAPER: Origin and Molecular Pathology of Adrenocortical Neoplasms
Vet. Pathol., March 1, 2009; 46(2): 194 - 210.
[Abstract] [Full Text] [PDF]


Home page
Am Soc Clin Oncol Ed BookHome page
C. Rodriguez-Galindo, G. Zambetti, and R. C. Ribeiro
Epidemiology, Clinical Characteristics, and Treatment of Childhood Adrenocortical Tumors
ASCO Educational Book, January 1, 2009; 2009(1): 625 - 629.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
C. B d'Alva, G. Abiven-Lepage, V. Viallon, L. Groussin, M. A. Dugue, X. Bertagna, and J. Bertherat
Sex steroids in androgen-secreting adrenocortical tumors: clinical and hormonal features in comparison with non-tumoral causes of androgen excess
Eur. J. Endocrinol., November 1, 2008; 159(5): 641 - 647.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. Gaujoux, F. Tissier, L. Groussin, R. Libe, B. Ragazzon, P. Launay, A. Audebourg, B. Dousset, X. Bertagna, and J. Bertherat
Wnt/{beta}-Catenin and 3',5'-Cyclic Adenosine 5'-Monophosphate/Protein Kinase A Signaling Pathways Alterations and Somatic {beta}-Catenin Gene Mutations in the Progression of Adrenocortical Tumors
J. Clin. Endocrinol. Metab., October 1, 2008; 93(10): 4135 - 4140.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
M. Rizk-Rabin, G. Assie, F. Rene-Corail, K. Perlemoine, H. Hamzaoui, F. Tissier, M. Lieberherr, X. Bertagna, J. Bertherat, and Z. Bouizar
Differential Expression of Parathyroid Hormone-Related Protein in Adrenocortical Tumors: Autocrine/Paracrine Effects on the Growth and Signaling Pathways in H295R Cells
Cancer Epidemiol. Biomarkers Prev., September 1, 2008; 17(9): 2275 - 2285.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Doghman, J. Cazareth, and E. Lalli
The T cell factor/{beta}-Catenin Antagonist PKF115-584 Inhibits Proliferation of Adrenocortical Carcinoma Cells
J. Clin. Endocrinol. Metab., August 1, 2008; 93(8): 3222 - 3225.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
A. C. Kim, A. L. Reuter, M. Zubair, T. Else, K. Serecky, N. C. Bingham, G. G. Lavery, K. L. Parker, and G. D. Hammer
Targeted disruption of {beta}-catenin in Sf1-expressing cells impairs development and maintenance of the adrenal cortex
Development, August 1, 2008; 135(15): 2593 - 2602.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
M Volante, C Buttigliero, E Greco, A Berruti, and M Papotti
Pathological and molecular features of adrenocortical carcinoma: an update
J. Clin. Pathol., July 1, 2008; 61(7): 787 - 793.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. Libe, A. Fratticci, J. Coste, F. Tissier, A. Horvath, B. Ragazzon, F. Rene-Corail, L. Groussin, X. Bertagna, M. L. Raffin-Sanson, et al.
Phosphodiesterase 11A (PDE11A) and Genetic Predisposition to Adrenocortical Tumors
Clin. Cancer Res., June 15, 2008; 14(12): 4016 - 4024.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
C Vincent-Dejean, L Cazabat, L Groussin, K Perlemoine, G Fumey, F Tissier, X Bertagna, and J Bertherat
Identification of a clinically homogenous subgroup of benign cortisol-secreting adrenocortical tumors characterized by alterations of the protein kinase A (PKA) subunits and high PKA activity.
Eur. J. Endocrinol., June 1, 2008; 158(6): 829 - 839.
[Abstract] [Full Text] [PDF]


Home page
The OncologistHome page
P. S. H. Soon, K. L. McDonald, B. G. Robinson, and S. B. Sidhu
Molecular Markers and the Pathogenesis of Adrenocortical Cancer
Oncologist, May 1, 2008; 13(5): 548 - 561.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
A Stigliano, L Cerquetti, M Borro, G Gentile, B Bucci, S Misiti, P Piergrossi, E Brunetti, M Simmaco, and V Toscano
Modulation of proteomic profile in H295R adrenocortical cell line induced by mitotane
Endocr. Relat. Cancer, March 1, 2008; 15(1): 1 - 10.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
R. Libe, A. Fratticci, and J. Bertherat
Adrenocortical cancer: pathophysiology and clinical management
Endocr. Relat. Cancer, March 1, 2007; 14(1): 13 - 28.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. Libe, L. Groussin, F. Tissier, C. Elie, F. Rene-Corail, A. Fratticci, E. Jullian, P. Beck-Peccoz, X. Bertagna, C. Gicquel, et al.
Somatic TP53 Mutations Are Relatively Rare among Adrenocortical Cancers with the Frequent 17p13 Loss of Heterozygosity
Clin. Cancer Res., February 1, 2007; 13(3): 844 - 850.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
G. Abiven, J. Coste, L. Groussin, P. Anract, F. Tissier, P. Legmann, B. Dousset, X. Bertagna, and J. Bertherat
Clinical and Biological Features in the Prognosis of Adrenocortical Cancer: Poor Outcome of Cortisol-Secreting Tumors in a Series of 202 Consecutive Patients
J. Clin. Endocrinol. Metab., July 1, 2006; 91(7): 2650 - 2655.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tissier, F.
Right arrow Articles by Bertherat, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tissier, F.
Right arrow Articles by Bertherat, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online