| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology, Pathobiology and Genetics |
Departments of 1 Endocrinology and 2 Genetics, Development and Molecular Pathology, Institut Cochin, Institut National de la Santé et de la Recherche Médicale U567, Centre National de la Recherche Scientifique, Unité Mixte de Recherche 8104, IFR116, René Descartes-Paris 5 University; Departments of 3 Pathology and 4 Endocrinology, and 5 Oncogenetics Unit, Hopital Cochin, Assistance Publique-Hôpitaux de Paris, René Descartes-Paris 5 University; 6 Department of Physiology, Hopital Trousseau, Assistance Publique-Hôpitaux de Paris; and 7 COMETE Network, Paris, France
Requests for reprints: Jérôme Bertherat, Service des Maladies Endocriniennes et Métaboliques, Hôpital Cochin, 27 rue du Fg-St-Jacques, 75014, Paris, France. Phone: 15-841-1895; Fax: 14-633-8060; E-mail: jerome.bertherat{at}cch.ap-hop-paris.fr.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
| Materials and Methods |
|---|
|
|
|---|
Human H295R cell line. The human adrenocortical cancer H295R cell line was grown as previously described (18) in DMEM/Ham's F-12 supplemented with 2% Ultroser G (Biosepra, Fremont, CA), 2 mmol/L glutamine, 5 µg/mL insulin, 5 µg/mL transferrin, 5 ng/mL selenium, 50 units/mL penicillin, and 50 mg/mL streptomycin.
Microscopy. The tumors were fixed in formalin, embedded in paraffin, and 4 µm sections were cut and stained with H&E-safran. The sections were examined to assess their Weiss score (0 to 9) on the basis of the presence or absence of the following nine histologic features: high mitotic rate, atypical mitoses, high nuclear grade, low percentage of clear cells, necrosis, diffuse tumor architecture, capsular invasion, sinusoidal invasion, and venous invasion (19).
Immunohistochemical staining. Sections, 4 µm thick, from formalin-fixed tissue embedded in paraffin were mounted on Superfrost/Plus glass slides. Immunohistochemistry for ß-catenin was done as previously described (15). For negative controls, some sections were incubated without the primary antibody. The slides were counterstained with Mayer hematoxylin. Immunostaining was assessed by an investigator blinded to McFarlane stage, Weiss score, and outcome. The entirety of ß-cateninstained sections was examined. Immunohistochemical labeling was evaluated for the presence of membranous, cytoplasmic, and nuclear staining by a qualitative assessment, and cytoplasmic and/or nuclear staining was recorded as intracellular accumulation. The intensity of staining was not scored.
Nucleic acid extraction and mutation analysis of the ß-catenin gene. DNA was extracted from peripheral blood leukocytes using the Wizard Genomic DNA Purification KIT (Promega Corp., Madison, WI). Tumor DNA and RNA were purified by cesium chloride gradient ultracentrifugation as previously reported (20). cDNA was synthesized by Moloney murine leukemia virus-reverse transcriptase (Invitrogen, Groningen, the Netherlands) using 1 µg of total RNA in a final volume of 40 mL. For mutation analysis, exon 3 and the flanking intronic sequences of the ß-catenin gene were amplified by PCR from both tumoral and leukocyte DNA. The primers used were ßCATEX2F (GAAAATCCAGCGTGGACAATG) and ßCATEX4R (TCGAGTCATTGCATACTGTCC). Both strands of the amplified products were directly sequenced on an automated sequencer (ABI 3700; Perkin-Elmer, Boston, MA). To search for large ß-catenin gene deletions, exon 3 was also amplified from tumor cDNA using the primers ßCATF1 (GCGTGGACAATGGCTACTCAAG) and ßCATR2 (TTCAGCACTCTGCTTGTGGTCC). The primer ßCATR1 (TTCAGGGATTGCACGTGTGGC) was also used for sequencing for large ß-catenin gene deletion analysis. Mutations were confirmed twice on two independent experiments.
Cell line, transfection, and reporter assays. The human adrenocortical cancer H295R cell line was maintained as previously described (18).
Transient transfections were done when cells were 60% to 70% confluent in 12-well plates using Effectene transfection reagent (Qiagen GmbH, Hilden, Germany). The total amount of transfected DNA (1.25 µg per well) was kept constant by adding pcDNA3. A TK-Renilla plasmid (10 ng) was included in each transfection for monitoring of transfection efficiency. PTOPFLASH [containing two copies of the ß-catenin/T-cell factor (TCF)-binding sites], pFOPFLASH (containing two mutated copies of the ß-catenin/TCF-binding sites), and the expression plasmid encoding the dominant-negative form of TCF (p
NTCF4) were kindly provided by H. Clevers (Utrecht, the Netherlands); 0.25 µg of pTOPFLASH or pFOPFLASH plasmid and growing quantities of p
NTCF4 (from 50 ng to 1 µg) were added per well. All experiments were done in triplicate and repeated at least thrice. Cells were lysed 36 hours after transfection and the luciferase and renilla activities were assayed using Promega Dual Luciferase Reporter Assay (Promega). The activity of the reporter constructs was expressed as normalized relative light units.
Statistical analysis. The
2 test was used to compare rates of ß-catenin delocalization or mutations between tumor groups. Statistical analyses were done using the StatView 5.0 program (SAS Institute, Cary, NC); significance was set at P < 0.05.
| Results |
|---|
|
|
|---|
3 and 26 patients (87%) with localized tumors (stage I and II) had a Weiss score of
2.
|
2 test).
|
|
ß-Catenin genetic analysis. The results of ß-catenin genetic analysis in all the tumors and the H295R cells are summarized in Table 2. A molecular alteration of the ß-catenin gene was observed in 11 of 39 adrenocortical tumors (28%) and in H295R cells. Most of these mutations (8 of 12) were point mutation altering the Ser45 of exon 3 and resulting in an amino acid substitution. Deletion or insertion leading to alteration of exon 3 was observed in the other tumors. None of these genetic alterations were observed in leukocyte DNA of the patients, demonstrating their somatic origin.
Genetic alterations were observed both in adrenocortical adenomas and adrenocortical carcinomas. They were observed only in tumors showing an abnormal ß-catenin immunostaining pattern. Among the nonfunctioning adrenocortical adenomas, 4 of 6 (67%) harbor a somatic ß-catenin mutation, in contrast to 3 of 20 (15%) of the functioning adrenocortical adenomas, suggesting an association with the tumor phenotype (P = 0.01,
2 test). Despite the higher frequency of ß-catenin immunostaining alterations in adrenocortical carcinomas than in adrenocortical adenomas, the frequency of mutation [7 of 26 (27%) in adrenocortical adenomas; 4 of 13 (31%) in adrenocortical carcinomas] was similar in the two groups of tumors. The adrenocortical cancer cell line H295R has a similar mutation leading to alteration of Ser45 of ß-catenin.
Activating ß-catenin mutation in the human adrenocortical cancer H295R cell line leads to efficient T-cell factordependent transcription. Stimulation of Wnt signaling in the human adrenocortical cancer H295R cell line was monitored by transfection with a TCF reporter (pTOPFLASH) and a control plasmid containing scrambled TCF-binding sites (pFOPFLASH). Constitutive activity of the TCF reporter is observed in the H295R cell line transfected with the pTOPFLASH. This robust expression can be significantly down-regulated by adding the plasmid p
NTCF4 encoding the dominant-negative form of TCF (Fig. 2). This result shows that activating ß-catenin mutation in H295R cell line leads to efficient and constitutive TCF-dependent transcription.
|
| Discussion |
|---|
|
|
|---|
This is the first study, as far as we know, demonstrating that Wnt signaling activation is frequent in adrenocortical tumorigenesis. Blaker et al. (21), who studied one adrenocortical adenoma in a patient with familial adenomatous polyposis coli, did not describe any ß-catenin mutation but found a somatic APC mutation. Semba et al. (22), in a study of adrenocortical tumors, mostly adenomas, did not find any nuclear accumulation of ß-catenin; because this study only considered nuclear accumulation as a marker of an active ß-catenin signaling pathway, exon 3 was not searched for genetic alterations.
Transcriptome analysis by microarray has shown that the potential target of the ß-catenin pathway, ENC-1, is up-regulated in adrenocortical carcinomas, suggesting that Wnt signaling may play a role in adrenocortical tumorigenesis (23). Interestingly, in our series, most (8 of 12) of the activating ß-catenin mutations involved the residue Ser45 (2426) in the consensus GSK3-ß/CK1 phosphorylation site. It would be interesting to elucidate the physiologic relevance of this mutation in adrenocortical tumorigenesis. In this study, transfections with a TCF reporter gene show constitutive overactivity of the ß-catenin signaling pathway in the H295R cell line. Because this cell line harbors a Ser45 ß-catenin mutation, this shows that in the adrenocortical cortex these genetic alterations lead to Wnt signaling pathway dysregulation and constitutive activation at the nuclear level.
The high rate [21 of 39 (54%)] of adrenocortical tumors with ß-catenin alterations suggests that activation of the Wnt signaling pathway is the most prevalent defect in adrenocortical tumorigenesis. Mutations activating ß-catenin are found in both adrenocortical adenomas and adrenocortical carcinomas. This is thus the first molecular defect to be reported with the same prevalence in both benign and malignant adrenocortical tumors. ß-Catenin mutations have previously been reported in benign tumors, in particular in gallbladder adenomas, and were more frequent than in carcinomas (27). In contrast, p53 mutations are found mainly in adrenocortical carcinomas and PRKAR1A mutations in adrenocortical adenomas. In adrenocortical adenomas, ß-catenin alterations seem more prevalent in nonfunctioning than in functioning tumors. This suggests that ß-catenin pathway activation might be involved in the development of nonsecreting adrenocortical adenomas and adrenocortical carcinomas. Similarly, loss of expression of the transcription factor cAMP-responsive element binding protein seems to be associated with less differentiated nonfunctioning or malignant adrenocortical tumors (28). In contrast, somatic mutations of G
s or PRKAR1A, associated with activation of the cyclic AMP pathway, are observed in benign secreting adrenocortical tumors (6, 10, 29, 30).
Abnormal cellular localization of ß-catenin is more frequent in adrenocortical carcinomas than in adrenocortical adenomas and was observed in more than 75% of adrenocortical carcinomas. This suggests that genetic alterations of other components of the Wnt signaling pathway, such as APC or axin, may also contribute to adrenocortical carcinomas (31, 32). Alternatively, the high frequency of ß-catenin activation in adrenocortical carcinomas could be the result of cross talk with other signaling pathways, as for instance the IGF system which is almost always activated in such tumors (8). This hypothesis is particularly pertinent for adenocarcinomas of the gastroesophageal junction that frequently show nuclear ß-catenin expression but very few APC and ß-catenin mutations (33). As ß-catenin mutation is the first molecular alteration identified in both adrenocortical adenomas and adrenocortical carcinomas, there may be a common pathophysiologic mechanism involving a multistep tumorigenesis process as speculated for other types of tumors (34). However, this multistep process would mainly concern nonfunctioning adrenal adenoma and adrenal carcinoma. The much more diffuse ß-catenin immunostaining observed in adrenocortical carcinomas than in adrenocortical adenomas suggests that the progression towards a malignant phenotype involves other events leading to severe Wnt signaling pathway dysregulation in cancers.
Finally, the diffuse pattern of ß-catenin immunostaining may serve as a diagnostic marker for malignancy in adrenocortical tumors, and indeed, this diagnosis is in some cases difficult with conventional pathologic methods.
In conclusion, this is the first study to show that Wnt signaling activation is frequent in adrenocortical tumors. It could be explained in half of the cases by somatic ß-catenin mutations. These alterations are present in both malignant and benign adrenocortical tumors, and, in benign cases, seems to favor the development of nonfunctioning tumors. Functional studies in the H295R cell line showed that these genetic alterations of ß-catenin lead to constitutive activity of the Wnt signaling pathway in adrenocortical tumors. Other genetic defects that could activate the Wnt signaling pathway are likely to be found in tumors that do not have a ß-catenin mutation. This finding contributes to the development of new therapeutic approaches targeting the Wnt pathway in malignant adrenocortical tumors for which currently available medical therapies are very limited.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank H. Clevers for providing p
NTCF4 and Benoit Terris, Zhor Bouizar, Marthe Rizk-Rabin, Anne Audebourg, Jocelyne Daugabel, Patricia Dukakis, and Nicole Martineau for helpful discussion and/or their technical assistance.
Received 2/21/05. Revised 6/ 4/05. Accepted 6/17/05.
| References |
|---|
|
|
|---|
regulatory subunit in patients with the Carney complex. Nat Genet 2000;26:8992.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
H. Hosogi, S. Nagayama, N. Kanamoto, A. Yoshizawa, T. Suzuki, K. Nakao, and Y. Sakai Biallelic APC Inactivation Was Responsible for Functional Adrenocortical Adenoma in Familial Adenomatous Polyposis with Novel Germline Mutation of the APC Gene: Report of a Case Jpn. J. Clin. Oncol., August 14, 2009; (2009) hyp093v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Schinner, H. S Willenberg, M. Schott, and W. A Scherbaum Pathophysiological aspects of Wnt-signaling in endocrine disease Eur. J. Endocrinol., May 1, 2009; 160(5): 731 - 737. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Kim, F. M. Barlaskar, J. H. Heaton, T. Else, V. R. Kelly, K. T. Krill, J. O. Scheys, D. P. Simon, A. Trovato, W.-H. Yang, et al. In Search of Adrenocortical Stem and Progenitor Cells Endocr. Rev., May 1, 2009; 30(3): 241 - 263. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Groussin, G. Bonardel, S. Silvera, F. Tissier, J. Coste, G. Abiven, R. Libe, M. Bienvenu, J.-L. Alberini, S. Salenave, et al. 18F-Fluorodeoxyglucose Positron Emission Tomography for the Diagnosis of Adrenocortical Tumors: A Prospective Study in 77 Operated Patients J. Clin. Endocrinol. Metab., May 1, 2009; 94(5): 1713 - 1722. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bielinska, H. Parviainen, S. Kiiveri, M. Heikinheimo, and D. B. Wilson REVIEW PAPER: Origin and Molecular Pathology of Adrenocortical Neoplasms Vet. Pathol., March 1, 2009; 46(2): 194 - 210. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Rodriguez-Galindo, G. Zambetti, and R. C. Ribeiro Epidemiology, Clinical Characteristics, and Treatment of Childhood Adrenocortical Tumors ASCO Educational Book, January 1, 2009; 2009(1): 625 - 629. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. B d'Alva, G. Abiven-Lepage, V. Viallon, L. Groussin, M. A. Dugue, X. Bertagna, and J. Bertherat Sex steroids in androgen-secreting adrenocortical tumors: clinical and hormonal features in comparison with non-tumoral causes of androgen excess Eur. J. Endocrinol., November 1, 2008; 159(5): 641 - 647. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Gaujoux, F. Tissier, L. Groussin, R. Libe, B. Ragazzon, P. Launay, A. Audebourg, B. Dousset, X. Bertagna, and J. Bertherat Wnt/{beta}-Catenin and 3',5'-Cyclic Adenosine 5'-Monophosphate/Protein Kinase A Signaling Pathways Alterations and Somatic {beta}-Catenin Gene Mutations in the Progression of Adrenocortical Tumors J. Clin. Endocrinol. Metab., October 1, 2008; 93(10): 4135 - 4140. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Rizk-Rabin, G. Assie, F. Rene-Corail, K. Perlemoine, H. Hamzaoui, F. Tissier, M. Lieberherr, X. Bertagna, J. Bertherat, and Z. Bouizar Differential Expression of Parathyroid Hormone-Related Protein in Adrenocortical Tumors: Autocrine/Paracrine Effects on the Growth and Signaling Pathways in H295R Cells Cancer Epidemiol. Biomarkers Prev., September 1, 2008; 17(9): 2275 - 2285. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Doghman, J. Cazareth, and E. Lalli The T cell factor/{beta}-Catenin Antagonist PKF115-584 Inhibits Proliferation of Adrenocortical Carcinoma Cells J. Clin. Endocrinol. Metab., August 1, 2008; 93(8): 3222 - 3225. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Kim, A. L. Reuter, M. Zubair, T. Else, K. Serecky, N. C. Bingham, G. G. Lavery, K. L. Parker, and G. D. Hammer Targeted disruption of {beta}-catenin in Sf1-expressing cells impairs development and maintenance of the adrenal cortex Development, August 1, 2008; 135(15): 2593 - 2602. [Abstract] [Full Text] [PDF] |
||||
![]() |
M Volante, C Buttigliero, E Greco, A Berruti, and M Papotti Pathological and molecular features of adrenocortical carcinoma: an update J. Clin. Pathol., July 1, 2008; 61(7): 787 - 793. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Libe, A. Fratticci, J. Coste, F. Tissier, A. Horvath, B. Ragazzon, F. Rene-Corail, L. Groussin, X. Bertagna, M. L. Raffin-Sanson, et al. Phosphodiesterase 11A (PDE11A) and Genetic Predisposition to Adrenocortical Tumors Clin. Cancer Res., June 15, 2008; 14(12): 4016 - 4024. [Abstract] [Full Text] [PDF] |
||||
![]() |
C Vincent-Dejean, L Cazabat, L Groussin, K Perlemoine, G Fumey, F Tissier, X Bertagna, and J Bertherat Identification of a clinically homogenous subgroup of benign cortisol-secreting adrenocortical tumors characterized by alterations of the protein kinase A (PKA) subunits and high PKA activity. Eur. J. Endocrinol., June 1, 2008; 158(6): 829 - 839. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. S. H. Soon, K. L. McDonald, B. G. Robinson, and S. B. Sidhu Molecular Markers and the Pathogenesis of Adrenocortical Cancer Oncologist, May 1, 2008; 13(5): 548 - 561. [Abstract] [Full Text] [PDF] |
||||
![]() |
A Stigliano, L Cerquetti, M Borro, G Gentile, B Bucci, S Misiti, P Piergrossi, E Brunetti, M Simmaco, and V Toscano Modulation of proteomic profile in H295R adrenocortical cell line induced by mitotane Endocr. Relat. Cancer, March 1, 2008; 15(1): 1 - 10. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Libe, A. Fratticci, and J. Bertherat Adrenocortical cancer: pathophysiology and clinical management Endocr. Relat. Cancer, March 1, 2007; 14(1): 13 - 28. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Libe, L. Groussin, F. Tissier, C. Elie, F. Rene-Corail, A. Fratticci, E. Jullian, P. Beck-Peccoz, X. Bertagna, C. Gicquel, et al. Somatic TP53 Mutations Are Relatively Rare among Adrenocortical Cancers with the Frequent 17p13 Loss of Heterozygosity Clin. Cancer Res., February 1, 2007; 13(3): 844 - 850. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Abiven, J. Coste, L. Groussin, P. Anract, F. Tissier, P. Legmann, B. Dousset, X. Bertagna, and J. Bertherat Clinical and Biological Features in the Prognosis of Adrenocortical Cancer: Poor Outcome of Cortisol-Secreting Tumors in a Series of 202 Consecutive Patients J. Clin. Endocrinol. Metab., July 1, 2006; 91(7): 2650 - 2655. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |