Cancer Research Donn Young  Protein Translation and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kim, I.-A.
Right arrow Articles by Bernhard, E. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kim, I.-A.
Right arrow Articles by Bernhard, E. J.
[Cancer Research 65, 7902-7910, September 1, 2005]
© 2005 American Association for Cancer Research


Experimental Therapeutics, Molecular Targets, and Chemical Biology

Selective Inhibition of Ras, Phosphoinositide 3 Kinase, and Akt Isoforms Increases the Radiosensitivity of Human Carcinoma Cell Lines

In-Ah Kim1, Sun-Sik Bae2, Annemarie Fernandes1, JunMin Wu1, Ruth J. Muschel3, W. Gillies McKenna1, Morris J. Birnbaum2 and Eric J. Bernhard1

1 Department of Radiation Oncology and 2 Howard Hughes Medical Institute, University of Pennsylvania; and 3 Department of Pathology, Children's Hospital of Philadelphia, Philadelphia, Pennsylvania

Requests for reprints: Eric J. Bernhard, Department of Radiation Oncology, University of Pennsylvania, 185 John Morgan Building, Philadelphia, PA 19104-6072. E-mail: bernhard{at}mail.med.upenn.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ras activation promotes the survival of tumor cells after DNA damage. To reverse this survival advantage, Ras signaling has been targeted for inhibition. Other contributors to Ras-mediated DNA damage survival have been identified using pharmacologic inhibition of signaling, but this approach is limited by the specificity of the inhibitors used and their toxicity. To better define components of Ras signaling that could be inhibited in a clinical setting, RNA interference was used to selectively block expression of specific isoforms of Ras, phosphoinositide 3 (PI3) kinase, and Akt. Inhibition of oncogenic Ras expression decreased both phospho-Akt and phospho-p42/44 mitogen-activated protein (MAP) kinase levels and reduced clonogenic survival. Because pharmacologic inhibition of PI3 kinases and Akt radiosensitized cell lines with active Ras signaling, whereas inhibition of the MAP/extracellular signal–regulated kinase (ERK) kinase/ERK pathway did not, we examined the contribution of PI3 kinases and Akts to radiation survival. Selective inhibition the PI3 kinase P110{alpha} + p85ß isoforms reduced Akt phosphorylation and radiation survival. Similarly, inhibition of Akt-1 reduced tumor cell radiation survival. Inhibition of Akt-2 or Akt-3 had less effect. Retroviral transduction and overexpression of mouse Akt-1 was shown to rescue cells from inhibition of endogenous human Akt-1 expression. This study shows that Ras signaling to the PI3 kinase–Akt pathway is an important contributor to survival, whether Ras activation results from mutation of ras or overexpression of epidermal growth factor receptor. This study further shows that selective inhibition of the PI3 kinase P110{alpha} + p85ß isoforms or Akt-1 could be a viable approach to sensitizing many tumor cells to cytotoxic therapies.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ras activation and survival after DNA damage. Ras activation by mutation is frequent in certain human tumors (1, 2), whereas activation of Ras signaling by growth factor receptor deregulation or other mechanisms is common in other tumor types (3, 4). Activation of Ras signaling has been shown to increase the survival of tumor cells exposed to agents that cause DNA damage. Survival after irradiation of many transformed and tumor cell lines is increased by expression of oncogenic Ras (reviewed in ref. 5). Overexpression of the ras proto-oncogene, or receptor-mediated activation of wild-type Ras signaling, has also been shown to promote radiation survival (6, 7). Ras activation also increases survival after DNA damage induced by chemotherapeutic agents. Early studies in mouse fibroblasts showed that expression of oncogenic H-, K-, or N-Ras conferred resistance to cis-platinum (8). Enhanced survival was shown in breast carcinoma cells expressing oncogenic Ras after exposure to cis-platinum (9), paclitaxel, doxorubicin, and 5-fluorouracil (10), and myeloma cells exposed to doxorubicin (11). Nooter et al. (12) showed enhanced resistance to doxorubicin in a rhabdomyosarcoma cell line transfected with the H-ras oncogene. Jansen et al. (13) showed melanoma xenograft resistance to cis-platinum after transfection with oncogenic N-ras. However, resistance has not been reported by all investigators. Choi et al. (14) found that resistance was imparted by oncogenic H-ras, but not K-ras transfection of rodent cells, and equivocal results or no resistance was seen in some other experimental models (1517). However, the preponderance of evidence links Ras activation to enhanced survival of cells treated with DNA-damaging agents.

Disrupting Ras signaling has been shown to reverse the resistance imparted by Ras activation. Inhibition of Ras expression by antisense oligonucleotides has been reported to radiosensitize cells (18). Blocking posttranslational prenylation, which is required for Ras-mediated transformation, has also been shown to reduce radiation survival in a number of rodent and human tumor models that express oncogenic Ras (1922). Gana-Weisz et al. (23) showed that disruption of Ras membrane anchorage increased SW480 colon carcinoma and Panc-1 pancreatic carcinoma cell sensitivity to gemcitabine. Both of these cell lines express oncogenic K-Ras. These findings point to Ras signaling as an important factor in the response of tumors to a range of cytotoxic therapies. This hypothesis is supported by the results obtained in several clinical studies that have examined Ras activation and tumor responses. These studies have reported K-ras mutation as an independent prognostic factor pointing to poor progression-free survival in patients with stage III non–small cell lung cancer that were treated with surgery, radiation, and chemotherapy (24); non–small cell lung cancer treated with single agent paclitaxel (25); pancreatic cancer treated with radiotherapy (26); and colon cancer treated with CPT-11 (27). Not all clinical reports, however, have shown an association between ras mutation and resistance (2830).

Ras activation by epidermal growth factor receptor. Signals transmitted through wild-type Ras proteins by mutated or overexpressed tyrosine kinase receptors can also influence cell survival. The epidermal growth factor receptor (EGFR, also denoted as erbB1 or HER1) plays a pivotal role in the regulation of cell growth and differentiation. This receptor transmits growth regulatory signals on binding of EGF or transforming growth factor-{alpha}. A number of studies have shown a positive relationship between EGFR expression and tumor resistance to radiation (31). Conversely, EGFR signal inhibition enhances radiosensitivity. Milas et al. (32, 33) showed enhanced tumor radiosensitivity in head and neck carcinoma xenografts on mice after combined treatment with monoclonal anti-EGFR antibody (C225) and radiation. Bonner et al. (34) have shown that combining C225 and radiation results in enhanced apoptosis and decreased proliferation of squamous cell carcinoma lines. Harari and Huang (35, 36) have reported similar findings both in vitro and in vivo.

The mechanism by which EGFR signaling leads to altered radiosensitivity is only partially defined. EGFR receptors initiate cytoplasmic signaling through autophosphorylation of their intracellular domains (37). This signaling activates a number of effectors, including Ras and phosphoinositide 3 (PI3) kinase. Chakravarti et al. (38) showed that EGFR-mediated resistance to chemoradiation therapy in primary human glioblastoma was Ras dependent. Gupta et al. (7) showed that EGFR signaling in head and neck squamous cell carcinomas contributed to radiation survival, and that this could be reversed by inhibition of EGFR, Ras, or PI3 kinase. These results point to Ras signaling as a transducer of EGFR signals that are important for cell survival after DNA damage.

Ras activation and signaling to other proteins. Ras signaling activates both mitogen-activated protein (MAP)/extracellular signal–regulated kinase (ERK) kinase (MEK)/ERK and PI3 kinase/Akt pathways. Both of these pathways have been implicated in tumor cell survival after exposure to DNA-damaging agents. The MEK/ERK pathway has been implicated by some studies in mediating radiation survival in prostate cancer mammary carcinoma and glioma cells (3840); however, this finding has not been observed in all tumor models (10, 4145).

There are at least eight members of the PI3 kinase family that fall into three classes (46). The type I class comprises four members, p110{alpha}, p110ß, p110{delta}, and p110{gamma}, with their regulatory subunits (p85{alpha}, p85ß, p55, p50, and, in the case of p110{gamma} only, p101). The type I class is associated with growth factor receptor signaling. p110{alpha}, p110ß, and p110{delta} are effectors of Ras signaling, whereas p110{gamma} transduces the signal from G-protein–coupled receptors. P110{alpha} and p110ß are ubiquitously expressed, whereas p110{delta} and p110{gamma} are expressed in hematopoietic lineage cells. The PI3 kinase isoforms seem to have differential roles in tumor growth and survival as determined using microinjection of blocking antibodies specific to the {alpha}, ß, and {gamma} isoforms. P110ß seems to promote DNA synthesis, whereas p110{alpha} activity was shown to be antiapoptotic. Inhibition of P110{gamma} did not affect either parameter (47). Loss of either PI3 kinase {alpha} or ß results in embryonic lethality, although the stage at which embryos die is different for {alpha} versus ß knockouts (48, 49). Both PI3 kinase {alpha} and ß show increased activity in human tumors. This increase was reported to be stage independent and resulted from both increased PI3 kinase expression and from increased activity (47). For these reasons, we focused on the p110{alpha} and the p110ß isoforms and the p85 regulatory subunits.

PI3 kinase signals lead to activation of Akt/PKB (50). There are three major isoforms of Akt/PKB that have been found in mammalian cells; these are termed Akt1/PKB{alpha}, Akt2/PKBß, and Akt3/PKB{gamma}, which are encoded by three separate genes with >85% sequence identity. Despite a high degree of sequence homology, Akt-1 and Akt-2 seem to serve distinct cellular functions with regard to cell survival and metabolism (51). Akt1–/– mice are more sensitive to genotoxic stress and their thymocyte are more sensitive to apoptosis induced by {gamma}-irradiation, but these mice do not display a diabetic phenotype (52). In contrast, Akt-2 is more important in insulin signaling than Akt-1 (53). It thus seems that Akt isoforms have differing roles and may contribute differentially to the survival of cells after DNA damage. Activation of the PI3 kinase/Akt pathway has consistently been shown to enhance tumor cell survival (4, 7, 44, 45, 5457) and reduce apoptosis (reviewed in ref. 58). Inhibition of PI3 kinase leads to enhanced susceptibility to killing by both cytotoxins and radiation (10, 42, 44, 57, 5961).

In this report, we have investigated the contribution of the three Ras isoforms to survival promoted by EGFR activation. We also directly tested the contribution of oncogenic activation of H-Ras and K-Ras to radiation survival by targeting expression of these oncoproteins. Because both PI3 kinase and Akt participate in survival signaling, we tested the effects of knocking down expression of these proteins in cells with signaling activated by oncogenic Ras or by EGFR. In the case of Akt, we examined the three isoforms to determine their relative contributions to radiation survival. The approach used was to selectively reduce the expression of the various isoforms of these proteins using small interfering RNA (siRNA) to target their mRNA (62). The results show that selective inhibition of Ras signaling pathway components is effective in reducing tumor cell survival after DNA damage.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture. Cells were cultured at 37°C in water-saturated 5% CO2. Cultures were maintained in DMEM (Life Technologies, Inc., Gaithersburg, MD) supplemented with 10% fetal bovine serum (HyClone, Logan, UT), 100 units/mL penicillin, and 100 µg/mL streptomycin (Life Technologies). Routine PCR testing was used to establish that cultures were Mycoplasma-free. The SW480 human colon carcinoma and T24 bladder carcinoma cell lines were obtained from the American Type Culture Collection (Rockville, MD). The SQ20B cell line (63) was derived from a patient with recurrent laryngeal carcinoma and was obtained from Dr. Ralph Weichselbaum (University of Chicago, Chicago, IL). Normal human fibroblast cells (POC cells) were derived in our laboratory and used at early passage.

Synthetic small interfering RNA. Synthetic siRNA were based on specific target sequences and analyzed for specificity by BLAST homology search. Oligonucleotides were purchased from Dharmacon Research (Lafayette, CO) and annealed according to the specifications of the manufacturer using annealing buffer and RNase-free water provided with the oligonucleotides. Scrambled II and nonspecific oligo VIII (Dharmacon) were used to control for nonspecific siRNA effects. The target sequences for the siRNAs used in this study were as follows:


View this table:
[in this window]
[in a new window]

 
 
Pooled siRNA (SMART pools, Dharmacon), which combines four or more specific siRNA duplexes in a single pool, was also used to inhibit Akt-1, Akt-2, and Akt-3 where indicated.

Pharmacologic inhibitors. The PI3 kinase inhibitor LY294002 was obtained from Eli-Lilly Pharmaceuticals (Indianapolis, IN) and the MEK inhibitor U0126 was obtained from Sigma Chemical Co. (St. Louis, MO). Inhibitors were dissolved as concentrated stock solutions in DMSO, stored at –80°C, and diluted at the time of use in culture medium. Control cells were treated with medium containing an equal concentration of DMSO.

Transfection of small interfering RNA and clonogenic survival determination. One hundred thousand to 2 x 105 cells were plated into each well of six-well tissue culture plates. The next day (when the cells were 30-40% confluent), the culture medium was changed with antibiotic-free medium. Thirty to 60 µL of each annealed oligo duplex (25 mmol/L concentration) in 235 µL of reduced serum medium (Opti-MEM, Life Technologies) was transfected into cell using 15 to 30 µL of Oligofectamine (Life Technologies) according to the protocol of the manufacturer. In some experiments, sequential transfections separated by 48 hours were done to achieve more complete inhibition of targeted gene expression. This is indicated in the figure legends. Transfection efficiency was monitored by fluorescence microscopy and fluorescence-activated cell sorting analysis for intracellular uptake of Cy-5–labeled oligo at the initial part of this study and was consistently over 80%.

Two to 4 days after transfection of siRNA, cells were trypsinized, diluted to the appropriate cell density, and plated in 60 mm dishes for irradiation and colony formation. To test inhibition of MEK and PI3 kinase, inhibitor treatment was done on cells from log growth cultures treated 2 to 4 hours before irradiation with 10 µmol/L of inhibitors (U0126 or LY294002, respectively). Controls were treated with equal concentrations of drug carrier (DMSO). Prenyltransferase inhibition was initiated 24 hours before replating for irradiation and clonogenic survival. Cells were irradiated with a Mark I cesium irradiator (J.L Shepherd, San Fernando, CA) at a dose rate of 1.6 Gy/min. Colonies were stained and counted 14 to 21 days after irradiation. Plating efficiency in the absence of radiation was monitored for all inhibitor and siRNA treatments. Each point on the survival curves represents the mean surviving fraction from at least three dishes.

Radiation dose-modifying factors for siRNA or inhibitor treatment were calculated at 10% clonogenic survival from linear-quadratic curve equations used to plot the curves shown in the figures. The dose-modifying factors reported are the root values for control curves divided by the values for treated curves in each instance.

Western blot analysis. Cells were harvested using lysis buffer with phosphatase inhibitors (1 mol/L sodium fluoride, 0.1 mol/L sodium pyrophosphate, 0.1 mol/L sodium orthovanadate, 0.1 mol/L Tris, 10% SDS, 10% glycerol). Samples were boiled, sonicated, and clarified by centrifugation at 14,000 rpm and stored at –20°C until analyzed. The protein concentration in the samples was determined by Amido Black staining (64). Samples containing equal amounts of protein were separated on a 12.5% or 2% to 20% gradient polyacrylamide gel (Bio-Rad, Hercules, CA) and transferred to nitrocellulose membranes. Membranes were blocked in PBS containing 0.1% Tween 20 and 5% powdered milk before the addition of primary antibody. Membranes were probed with monoclonal antibody directed against H-ras (Quality Biotech, Camden, NJ) or with monoclonal antibody directed against c-K-ras or N-ras (Oncogene Research Product, Cambridge, MA). Polyclonal anti–phospho-MAP kinase (MAPK; phospho-Thr202-Tyr204), pan-MAPK, polyclonal anti–phospho-Akt (Ser473), and polyclonal pan-Akt were obtained from Cell Signaling (Beverly, MA) and used at a dilution of 1:1,000. Polyclonal anti–Akt-1 (Upstate Biotechnology, Lake Placid, NY) was used at a dilution of 1:1,000. Polyclonal anti-Akt-2 (65) was generated in Dr. Birnbaum's laboratory (University of Pennsylvania, Philadelphia, PA) and was used at a dilution of 1:5,000. Detection of antibody binding was done using the enhanced chemiluminescence detection kit from Amersham (Piscataway, NJ) using the appropriate secondary antibody supplied with the kit.

Northern blot analysis. Total RNA was isolated from siRNA-transfected cells using Trizol (Life Technologies) according to the method recommended by the manufacturer. RNA was separated by electrophoresis and transferred to a Duralon-UV membrane (Stratagene, Cedar Creek, TX). Blots were prehybridized in Zeta probe hybridization solution (10% dextran sulfate, 5x SSC, 4x Denhardt solution, 10 mmol/L Tris, and 1% SDS) for 3 hours. Membranes were probed with the coding portion of Akt-3. Probes were labeled with 32P using Ready-To-Go DNA labeling beads (Amersham Biosciences). Hybridization was done in Zeta probe hybridization solution containing 106 cpm/mL 32P-labeled probe at 42°C overnight. Blots were then washed to a stringency of 2x, 0.5x, 0.1x SSC (3 mol/L NaCl, 0.3 mol/L sodium citrate)/0.1% SDS for 20 minutes each at 65°C and exposed to X-ray films for 1 to 14 days.

Retroviral transduction of mouse Akt-1. Ecotropic BOSC cells were transiently transfected with pVSV G and pCgp, pantropic retrovital packaging constructs, and retroviral vector (pMIGR1-Akt1/PKB{alpha}). Cell-free viral supernatants were harvested at 24 hours and used to infect SW480, T24, and SQ20B cells. The pMIGR1-Akt/PKB{alpha} construct contains the Akt kinase as well as green fluorescent protein (GFP) separated by an internal ribosomal entry site; thus, relative expression can be assessed by GFP expression. To avoid cross-reactivity with siRNA targeted to human Akt-1, cDNA for mouse Akt-1 was used in this retroviral construct. The murine mRNA is mismatched with the human sequence at two internal C nucleotides within the siRNA sequence (AAGGAGGGCTGGCTGCACAAA). SW480, T24, and SQ20B cells were incubated with viral supernatant for 2 days. Infection efficiency was almost 100% judged by green fluorescence under fluorescent microscopy.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Selective inhibition of oncogenic Ras isoforms reduces tumor cell radiation survival. To directly show whether oncogenic H- and K-Ras activation contributes to cellular radiation resistance, we examined the radiation sensitivity of T24 and SW480 cells treated with siRNA specific for the mutant ras allele expressed in each cell line. Equivalent inhibition of H-RasV12 K-RasV12 expression was obtained using siRNA specific for each isoform (Fig. 1). Inhibition of oncogenic Ras expression was accompanied by reduced phosphorylation of Akt that was similar in both cell lines, whereas phosphorylation of MAPK was reduced to a greater extent in SW480 than in T24 cells, where inhibition was minimal. Inhibition of oncogenic Ras expression also decreased radiation survival in both cell lines to a similar degree. H-Ras inhibition in T24 resulted in a radiation dose-modifying factor of 1.25 at 10% clonogenic survival. Inhibition of K-Ras in SW480 cells resulted in a dose-modifying factor of 1.22.



View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Effects of selectively inhibiting oncogenic Ras isoforms on tumor cell radiation survival and signaling. A, T24 cells were treated with siRNA to H-rasV12 ({blacksquare}) or treated with a nonspecific control siRNA (oligo VIII, {circ}). Transfections were done twice at 48-hour intervals. Two days after the last transfection, cells were plated for survival and proteins harvested for analysis of Ras expression and MAPK and Akt phosphorylation status. The plating efficiencies of unirradiated siRNA-treated cells were 0.36 for oligo VIII and 0.26 for siRNA to H-ras. B, SW480 cells were treated as in (A), except that an siRNA specific to K-rasV12 was used. Plating efficiencies of unirradiated siRNA-treated SW480 cells were 0.20 for control siRNA and 0.38 for siRNA to K-ras. In all experiments, Ras expression and protein phosphorylation status were determined at the time of irradiation. Points, mean surviving fraction from at least three dishes. ß-actin was used to control for loading on Western blots. Experiments were repeated a minimum of three times.

 
Differential effects of PI3 kinase and MEK activity in tumor cell survival. As shown above, inhibition of Ras expression can down-regulate both MAPK and Akt phosphorylation. To better define which of the signal transduction pathways that activate these proteins had the greatest effect on radiation survival, we used pharmacologic inhibitors of MEK and PI3 kinase and tested for the effect of this inhibition on radiation survival. Inhibition of PI3 kinase with LY294002, but not MEK with PD98059, was previously shown to sensitize T24 cells (41, 44). Here, we tested whether inhibiting PI3 kinase and MEK would have the same effects on clonogenic survival in SW480 and SQ20B cells. SQ20B cells are relatively radioresistant as a result of wild-type Ras activation due to EGFR overexpression. Inhibition of PI3 kinase activity with LY294002 greatly reduced Akt phosphorylation in both SW480 and SQ20B cell lines (Fig. 2A and B) and caused a similar reduction in clonogenic survival (Fig. 2). The dose-modifying factor for LY294002 treatment was 1.28 in both cell lines. In contrast, although inhibition of MEK using the U0126 inhibitor was almost complete at the time of irradiation as determined by loss of MAPK phosphorylation, this inhibition had little effect on radiation survival in either cell line. The dose-modifying factor for U0126 treatment was below 1.1 in both cell lines. Thus, similar to cells with oncogenic H-Ras, in cells expressing oncogenic K-Ras and cells expressing wild-type Ras activated by EGFR overexpression, radiation survival seems to be influenced primarily by PI3 kinase pathway activity.



View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Survival effects of inhibiting PI3 kinase or MEK signaling pathway in cells with mutant K-Ras or EGFR-activated Ras signaling. Cells from log growth cultures of SW480 (A) or SQ20B (B) were trypsinized, plated for clonogenic assay, and treated for 2 to 4 hours with LY294002 (10 µmol/L) or U0126 (5 µmol/L) or with equal concentration of drug carrier (DMSO). Cultures were then irradiated and allowed to grow for 14 to 21 days, after which colonies were stained and counted. Points, mean surviving fraction from at least three dishes. Experiments were repeated thrice. The plating efficiencies for unirradiated SW480 cells were 0.65, 0.76, and 0.56 for DMSO- (controls), LY294002-, and U0126-treated cells, respectively. The plating efficiencies for SQ20B cells were 0.30 for controls, and 0.25 and 0.31 for LY294002 and U0126-treated cells, respectively. Phosphorylation states of ERK and Akt were determined by sampling of replicate inhibitor-treated and control cultures at the time of irradiation.

 
Inhibiting PI3 kinase expression reduces tumor radiation survival. Because pharmacologic inhibition of PI3 kinase activity reduced the clonogenic survival of irradiated cells, we next tested whether selective inhibition of individual PI3 kinase isoforms would have the same effect. Using siRNA, we selectively inhibited expression of either the p110{alpha} or p110ß or the p85{alpha} or p85ß subunits of PI3 kinase. These isoforms were chosen on the basis of their ubiquitous expression. Inhibition of individual chains showed only modest decreases in radiation survival in T24, SW480, and SQ20B cells (not shown). However, combining inhibition of p110{alpha} or p110ß expression with inhibition of p85ß expression resulted in consistent reductions in both clonogenic survival (Fig. 3A-C) and phospho-Akt (Fig. 3D). The radiation dose-modifying factor was greatest with inhibition of the p85ß subunit. In SQ20B cells, combining inhibition of p85ß with inhibition of either p110{alpha} or p110ß resulted in a dose-modifying factor of 1.28. In T24 cells, inhibition of p110{alpha} and p85ß gave a dose-modifying factor of 1.19 and inhibition of p110ß and p85ß gave a dose-modifying factor of 1.28. The dose-modifying factor in SW480 cells after inhibition of p110{alpha} and p85ß was 1.22 and after inhibition of p110ß and p85ß was 1.15. Combinations of siRNA to p110{alpha} or p110ß with p85{alpha} had less effect on clonogenic survival.



View larger version (23K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Inhibition of catalytic and regulatory subunit of PI3 kinase using siRNA. The effects on clonogenic survival of inhibiting PI3 kinase p85{alpha} or p85ß combined with inhibition of either p110{alpha} or p110ß subunits were tested in SQ20B (A), T24 (B), and SW480 (C). The plating efficiencies for unirradiated cells in clonogenic survival studies were 0.35 for control siRNA-treated SQ20B and between 0.13 and 0.14 for those treated with siRNA to PI3 kinase subunits. In T24, control cells had a plating efficiency of 0.19 and PI3 kinase siRNA-treated cells had plating efficiencies between 0.20 and 0.33. In SW480, control cells had a plating efficiency of 0.24 and PI3 kinase siRNA-treated cells had plating efficiencies between 0.17 and 0.42. Cell lysates from each cell line and treatment were prepared from replicate plates at the time of irradiation and probed for Akt phosphorylation (D).

 
The influence of Akt isoforms on radiation survival. Akt proteins have been implicated in cell survival after DNA damage and are activated by PI3 kinase. To determine whether Akt proteins have a role in enhanced radiation survival in cells with activated Ras and PI3 kinase signaling, and if so, which isoforms of Akt contribute to survival, we used siRNA to inhibit specifically each of the three Akt isoforms (Fig. 4). Specific siRNA to Akt-1 or Akt-2 selectively down-regulated the target isoform, as shown by Western blot. The inhibition by siRNA of Akt-3 expression was shown by Northern blot due to the absence of a specific antibody for this protein. Selective inhibition of Akt-1 or inhibition of all three Akt isoforms resulted in the most consistent down-regulation of total phospho-Akt (Fig. 4).



View larger version (50K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. Selective inhibition of Akt isoform expression. siRNA was used to inhibit selectively the expression of Akt-1, Akt-2, or Akt-3 Down-regulation of each isoform was shown by Western blot analysis (Akt-1 and Akt-2) or Northern blot analysis (Akt-3). Experiments were carried out with both single-sequence siRNA and with SMART pool siRNAs. The experiments shown for SQ20B (A) were done with single-sequence siRNA. The experiments shown for T24 (B) and SW480 cells (C) were done with SMART pool siRNAs. Experiments were done a minimum of three times in each cell line.

 
The effect on clonogenic survival of inhibiting the three Akt isoforms individually and in combination was also assessed (Fig. 5). Of the three isoforms of Akt, selective inhibition of Akt-1 had the greatest effect on radiation survival, although cotransfection of Akt-1, Akt-2, and Akt-3 siRNA further decreased radiation survival in all three lines. In contrast to treatment with siRNA to Akt-1, selective inhibition with siRNA to Akt-2 or siRNA to Akt-3 alone generally had little effect on survival. We monitored whether the radiosensitization observed in the siRNA-treated cells was associated with cell cycle redistribution occurring as a result of siRNA treatment. No changes in cell cycle distribution were noted at 48 hours after inhibition of Akt-1 or combined inhibition of Akt-1, Akt-2, and Akt-3. Subsequent to irradiation, however, 60% to 66% of siRNA-treated SQ20B and SW480 cells accumulated in G2 at 12 hours compared with 34% to 35% in control siRNA-treated cells (not shown). Thus, although siRNA treatment did not lead to cell cycle redistribution, it affected radiation-induced G2-M accumulation.



View larger version (26K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Radiation survival after selective inhibition of Akt isoform expression. Replicate cultures of SQ20B (A), T24 (B), and SW480 cells (C), from siRNA treatments shown in Fig. 4 were tested for clonogenic survival after irradiation. Experiments were done a minimum of three times in each cell line. The plating efficiencies for all SQ20B treatment groups (0.2-0.29) and for all T24 treatment groups (0.4-0.47) were equivalent. For SW480, the plating efficiency was between 0.2 and 0.28 for all groups except those treated with siRNA to Akt-3, which had a plating efficiency of 0.47.

 
An important question in any approach that potentiates tumor cell killing by radiation is whether the treatment also affects normal cell survival. Although Akt-1 inhibition sensitized the tumor cells, it had no effect on the radiosensitivity of normal human fibroblasts, which have a lower level of Akt phosphorylation than the tumor cell lines (Fig. 6). Simultaneous inhibition of all three isoforms of Akt did have a modest effect on the clonogenic survival of these normal cells; however, the dose-modifying factor was only 1.09. Results obtained in MR4-immortalized rat embryo fibroblasts (not shown) were similar with a dose-modifying factor of 1.05 after inhibition of all three Akt isoforms.



View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. Akt knockdown and radiation survival in normal human fibroblasts. Normal human fibroblasts were transfected with single-sequence siRNA to Akt-1, Akt-2, or Akt-3 or a combination of all three. Clonogenic survival (A), and western analysis of Akt activation and expression changes was carried out on replicate dishes. Data are representative of repeated experiments. The plating efficiency for all groups was between 0.03 and 0.04 irrespective of treatment.

 
Validation that siRNA inhibition of Akt-1 expression was responsible for radiosensitization was obtained by transducing SW480, T24, and SQ20B cell lines with retroviral vectors encoding mouse Akt-1. Mouse Akt-1 is not susceptible to knockdown by the siRNA used in these experiments due to differences in nucleotide sequence in the siRNA target region. Transduction caused a marked increase in the expression of Akt-1 (both the mouse and human form are recognized by the antibodies used for blotting Fig. 7A). Phospho-Akt was also markedly increased. Overexpression of Akt-1 did not enhance radiation survival over that observed in cells expressing endogenous levels of this protein. However, cells transduced with the murine Akt-1 vector and overexpressing this protein were not radiosensitized by siRNA to human Akt-1. In contrast, specific inhibition of endogenous (human) Akt-1 with siRNA radiosensitized cells transduced with a control vector, consistent with the observations in nontransduced cells (see also Fig. 5). These results show rescue from siRNA inhibition of endogenous Akt-1 by exogenous Akt-1 that was not susceptible to the human gene–specific siRNA. The results also show that there is a finite limit to the radiation survival advantage provided by Akt that cannot be surpassed by overexpression of the protein or its activated form.



View larger version (25K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 7. Rescue of retroviral mouse Akt-1 cDNA transfectant from selective inhibition of Akt-1 using siRNA. SQ20B, T24, and SW480 cells were transduced with retroviruses encoding mouse Akt-1 or a control vector containing only GFP as described in Materials and Methods. Transduced cells were then transfected with the siRNA to Akt-1 or combined siRNA to Akt-1, Akt-2, and Akt-3 and assessed for protein expression and radiation survival 48 hours later. Western blot exposures were timed for presentation of transduced cell Akt expression. Longer exposures (not shown) showed expression of Akt and phospho-Akt in SW480 cells. In each survival panel, circles represent GFP control vector transduced cells. Squares represent mouse Akt-1 transduced cells. Open symbols were treated with control siRNA. Closed symbols were treated with siRNA to Akt-1. The survival of mouse Akt-1–transduced cells treated with control siRNA (not shown) overlapped with the curves of control vector + control siRNA-treated cells. Experiments are representative of three replicates in SQ20B and T24 cells and were duplicated in SW480 cells. The plating efficiencies of SQ20B cells were between 0.36 and 0.31 for all groups transduced with control retroviral vector, 0.54 for control, and 0.36 for Akt-1 siRNA-treated cells transduced with mouse Akt-1. For T24 cells transduced with control vectors, the plating efficiencies were 0.21 for control siRNA and 0.46 for Akt-1 siRNA-treated cells. For T24 cells transduced with mouse Akt-1 vectors, the plating efficiencies were 0.10 for control siRNA and 0.17 for Akt-1 siRNA-treated cells. For SW480 cells transduced with control vectors, the plating efficiencies were 0.83 for control siRNA and 1.0 for Akt-1 siRNA-treated cells. For SW480 cells transduced with mouse Akt-1 vectors, the plating efficiency was 0.30 for both control siRNA and Akt-1 siRNA-treated cells.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The success or failure of cancer therapy can be influenced by the sensitivity of the tumor target and the limits imposed on treatment by the sensitivity of the normal surrounding tissues. In this report, we have investigated possible points in Ras signaling that could be targeted to selectively enhance the sensitivity of tumors to therapy.

The Ras survival pathway identified in prior studies (44, 45) and further defined in the present work is comprised of tyrosine kinase receptor (EGFR), Ras, PI3 kinase, and Akt. This pathway is an attractive target for molecularly targeted therapies as it is frequently activated by mutation of Ras or components of the pathway, and by deregulated growth factor receptor signaling to Ras.

Ras activity can contribute to the survival of tumor cells exposed to radiation or chemotherapy. The current report further defines the role of Ras in cell survival by examining the contribution of the different Ras isoforms to the survival of tumor cells after DNA damage induced by irradiation. We have shown that the three Ras isoforms, H-Ras, K-Ras, and N-Ras, can contribute to radiation survival when activated by oncogenic mutations. This had previously been implied, not only by a series of studies using ras oncogene transfection (cited above), but also by the results of studies into prenyltransferase inhibitor–mediated radiosensitization (reviewed in ref. 66). In these studies, inhibition of prenylation, which is required for Ras activity, resulted in tumor radiosensitization of tumors with oncogenic Ras (20, 21). The interpretation of these studies, however, as well as those utilizing lovostatin inhibition of Ras processing (19), is complicated by the large number of prenylated proteins affected by these inhibitors (6769). Our results also accord with prior findings from our group that the presence of oncogenic K-ras and N-ras alleles is associated with enhanced radiation survival in DLD-1 colon and HT1080 sarcoma lines, respectively (70). In these studies, the presence of oncogenic ras alleles was the only variable, but it was still formally possible that the derivation of tumor cell clones lacking activated ras could have engendered other changes affecting radiosensitivity. In the current report, specific and transient down-regulation of oncogenic ras allele expression resulted in radiosensitization.

The findings reported here further define the role of wild-type Ras in transmitting survival signals initiated at the EGFR. EGFR activation is clearly implicated as a contributor to radiation survival (33, 35, 71) through activation of Ras (38). Furthermore, there is evidence that the EGFR forms part of an endocrine loop for Ras activation (72). EGFR is the target of inhibition by antibodies and kinase inhibitors currently in clinical trials (reviewed in ref. 73). The work presented here shows that the pathways that promote survival after DNA damage in cells with oncogenic Ras activation also affect survival in SQ20B cells, which overexpress EGFR. This finding shows that using a common approach to the inhibition of Ras signaling is valid both for cells with Ras mutation and cells with Ras activation due to receptor tyrosine kinase activation.

Several approaches in targeting Ras signaling have been tested (reviewed in ref. 74), but the results to date in clinical trials have not been as good as was expected (75, 76). For this reason, we investigated not only Ras, but also other potential contributors to radiation survival whose activity is promoted by Ras signaling. Radiosensitization of tumor cells after inhibition of ras expression with siRNA was accompanied by decreased Akt phosphorylation in cells with mutations in H-ras and K-ras and by decreased MAPK phosphorylation in cells with mutations in K-ras. This decrease indicates reduced signaling through these proteins. Prior studies have proposed a role for both MAPK (40, 77) and PI3 kinase/Akt (10, 56, 61, 78) signaling in cell survival. We found that pharmacologic inhibition of PI3 kinase/Akt signaling in cells with ras oncogene expression or EGFR amplification reduced radiation survival irrespective of the mechanism of Ras activation or, in the case of oncogenic N-Ras or K-Ras, the activated allele of ras. In contrast, inhibition of MEK/ERK pathway had little effect in any of the cells tested here. The results of inhibiting MEK/ERK and PI3 kinase in T24 cells that express oncogenic H-Ras have been previously reported (41, 44). These results agree with the findings in the present report. Together, these studies point to the PI3 kinase pathway as a primary mediator of enhanced survival.

Because PI3 kinase signaling promotes survival, and Akt is activated by this signaling and has also been implicated in survival (reviewed in ref. 50), we probed the contribution of Akt to radiation survival. In these studies, siRNA-mediated specific inhibition of expression of the three Akt isoforms was used to probe for their contribution to radiation survival. The results show that survival signaling from all three Ras isoforms is in large part transmitted through Akt-1. These findings imply that Akt-1 is a reasonable target for radiosensitization strategies. Because Akt-2 is more important for insulin signaling (53), selective inhibition of Akt-1 may avoid toxicities from inhibition of insulin signaling that would be expected with inhibitors targeting all three Akt isoform. The observation that overexpression of Akt-1 in cells that already expressed active Akt signaling did not further promote radiation survival implies that there is a limit to the survival benefit that signaling from this protein can impart, and thus to the degree of radiosensitization that can be obtained through its inhibition. In accord with our findings, it has been shown that down-regulation of Akt-1 protein by antisense oligonucleotides induced apoptosis selectively in tumor cells but not in normal cells (79). Our findings are also in accord with those of Liang et al. (78), who showed that constitutively active Akt-1 and PI3 kinase–dependent activation of Akt-1 each increased cellular resistance to radiation in MCF7 breast cancer cells. Taken together, these studies present a strong case for the role of Akt-1 alone in inducing cellular resistance to ionizing radiation in cancer cells. Our findings are also in accord with those of Jetzt et al. (80), who recently reported that expression of an Akt-1 kinase–dead mutant led to selective induction of apoptosis in tumor cells expressing activated Akt and had minimal effect on normal and tumor cell expressing low levels of activated Akt. In our study, all three carcinoma cell lines with activated Akt showed increased radiosensitivity after Akt-1 or Akt-1, Akt-2, and Akt-3 inhibition. In contrast, primary human fibroblasts with low level of Akt activation did not show radiosensitization by selective inhibition of Akt-1 alone and only modest sensitization by inhibition of all three isoforms. The demonstration that normal cell survival is not affected by specific inhibition of Akt-1 is of importance to the potential application of this approach to therapy.

The results presented here imply that survival signaling initiated at the cell surface at EGFR or at the level of Ras can be blocked either at Ras or at Akt. The levels of radiosensitization obtained by inhibiting different points in this survival-signaling pathway seem similar, as evidenced by the similarity in the dose-modifying factors obtained by inhibiting expression of the different components in this pathway. Future experiments will determine whether additive effects can be obtained by combining signaling inhibition at different points in the pathway and whether inhibitors of Akt activity currently under development can be applied in the context of radiation treatment.


    Acknowledgments
 
Grant support: NIH grants CA73820 and CA75138.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Drs. Jonathan Backer, Amit Maity, and Gary Kao for helpful comments on this work.


    Footnotes
 
Note: I-A. Kim is currently in the Department of Radiation Oncology, Cancer Research Institute, Seoul National University, Seoul, South Korea.

Received 2/15/05. Revised 6/ 7/05. Accepted 6/21/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Barbacid M. Ras genes. Annu Rev Biochem 1987;56:779–827.[CrossRef][Medline]
  2. Bos JL. Ras oncogenes in human cancer: a review. Cancer Res 1989;49:4682–9.[Abstract/Free Full Text]
  3. Clark GJ, Der CJ. Aberrant function of the Ras signal transduction pathway in human breast cancer. Breast Cancer Res Treat 1995;35:133–44.[CrossRef][Medline]
  4. Sakata K, Kato S, Fox JC, Shigemori M, Morimatsu M. Autocrine signaling through Ras regulates cell survival activity in human glioma cells: potential cross-talk between Ras and the phosphatidylinositol 3-kinase-Akt pathway. J Neuropathol Exp Neurol 2002;61:975–83.[Medline]
  5. Kim IA, Fernandes AT, Gupta AK, McKenna WG, Bernhard EJ. The influence of Ras pathway signaling on tumor radiosensitivity. Cancer Metastasis Rev 2004;23:227–36.[CrossRef][Medline]
  6. Samid D, Miller AC, Rimoldi D, Gafner J, Clark EP. Increased radiation resistance in transformed and nontransformed cells with elevated ras proto-oncogene expression. Radiat Res 1991;126:244–50.[Medline]
  7. Gupta AK, McKenna WG, Weber CN, et al. Local recurrence in head and neck cancer: relationship to radiation resistance and signal transduction. Clin Cancer Res 2002;8:885–92.[Abstract/Free Full Text]
  8. Sklar MD. Increased resistance to cis-diamminedichloroplatinum(II) in NIH 3T3 cells transformed by ras oncogenes. Cancer Res 1988;48:793–7.[Abstract/Free Full Text]
  9. Levy E, Baroche C, Barret JM, et al. Activated ras oncogene and specifically acquired resistance to cisplatin in human mammary epithelial cells: induction of DNA cross-links and their repair. Carcinogenesis 1994;15:845–50.[Abstract/Free Full Text]
  10. Jin W, Wu L, Liang K, Liu B, Lu Y, Fan Z. Roles of the PI-3K and MEK pathways in Ras-mediated chemoresistance in breast cancer cells. Br J Cancer 2003;89:185–91.[CrossRef][Medline]
  11. Rowley M, Van Ness B. Activation of N-ras and K-ras induced by interleukin-6 in a myeloma cell line: implications for disease progression and therapeutic response. Oncogene 2002;21:8769–75.[CrossRef][Medline]
  12. Nooter K, Boersma AW, Oostrum RG, Burger H, Jochemsen AG, Stoter G. Constitutive expression of the c-H-ras oncogene inhibits doxorubicin-induced apoptosis and promotes cell survival in a rhabdomyosarcoma cell line. Br J Cancer 1995;71:556–61.[Medline]
  13. Jansen B, Schlagbauer-Wadl H, Eichler HG, et al. Activated N-ras contributes to the chemoresistance of human melanoma in severe combined immunodeficiency (SCID) mice by blocking apoptosis. Cancer Res 1997;57:362–5.[Abstract/Free Full Text]
  14. Choi JA, Park MT, Kang CM, et al. Opposite effects of Ha-Ras and Ki-Ras on radiation-induced apoptosis via differential activation of PI3K/Akt and Rac/p38 mitogen-activated protein kinase signaling pathways. Oncogene 2004;23:9–20.[CrossRef][Medline]
  15. Alapetite C, Baroche C, Remvikos Y, Goubin G, Moustacchi E. Studies on the influence of the presence of an activated ras oncogene on the in vitro radiosensitivity of human mammary epithelial cells. Int J Radiat Biol 1991;59:385–96.[Medline]
  16. Grant ML, Bruton RK, Byrd PJ, et al. Sensitivity to ionising radiation of transformed human cells containing mutant ras genes. Oncogene 1990;5:1159–64.[Medline]
  17. Harris JF, Chambers AF, Tam ASK. Some ras-transformed cells have increased radiosensitivity and decreased repair of sublethal readiation damage. Somat Cell Mol Genet 1990;16:39–48.[CrossRef][Medline]
  18. Pirollo KF, Hao Z, Rait A, Ho CW, Chang EH. Evidence supporting a signal transduction pathway leading to the radiation-resistant phenotype in human tumor cells. Biochem Biophys Res Commun 1997;230:196–201.[CrossRef][Medline]
  19. Miller AC, Kariko K, Myers CE, Clark EP, Samid D. Increased radioresistance of EJras-transformed human osteosarcoma cells and its modulation by lovastatin, an inhibitor of p21ras isoprenylation. Int J Cancer 1993;53:302–7.[Medline]
  20. Bernhard EJ, Kao G, Cox AD, et al. The farnesyltransferase inhibitor FTI-277 radiosensitizes H-ras-transformed rat embryo fibroblasts. Cancer Res 1996;56:1727–30.[Abstract/Free Full Text]
  21. Bernhard EJ, McKenna WG, Hamilton AD, et al. Inhibiting Ras prenylation increases the radiosensitivity of human tumor cell lines with activating mutations of ras oncogenes. Cancer Res 1998;58:1754–61.[Abstract/Free Full Text]
  22. Shi Y, Wu J, Mick R, et al. Farnesyltransferase inhibitor effects on prostate tumor microenvironment and radiation survival. Prostate 2005;62:69–82.[CrossRef][Medline]
  23. Gana-Weisz M, Halaschek-Wiener J, Jansen B, Elad G, Haklai R, Kloog Y. The Ras inhibitor S-trans, trans-farnesylthiosalicylic acid chemosensitizes human tumor cells without causing resistance. Clin Cancer Res 2002;8:555–65.[Abstract/Free Full Text]
  24. Broermann P, Junker K, Brandt BH, et al. Trimodality treatment in Stage III nonsmall cell lung carcinoma: prognostic impact of K-ras mutations after neoadjuvant therapy. Cancer 2002;94:2055–62.[CrossRef][Medline]
  25. Rosell R, Gonzalez-Larriba JL, Alberola V, et al. Single-agent paclitaxel by 3-hour infusion in the treatment of non-small cell lung cancer: links between p53 and K-ras gene status and chemosensitivity. Semin Oncol 1995;22:12–8.
  26. Dergham ST, Dugan MC, Kucway R, et al. Prevalence and clinical significance of combined K-ras mutation and p53 aberration in pancreatic adenocarcinoma. Int J Pancreatol 1997;21:127–43.[Medline]
  27. Nemunaitis J, Cox J, Meyer W, Courtney A, Mues G. Irinotecan hydrochloride (CPT-11) resistance identified by K-ras mutation in patients with progressive colon cancer after treatment with 5-fluorouracil (5-FU). Am J Clin Oncol 1997;20:527–9.[CrossRef][Medline]
  28. Markowitz S, Hines JD, Lutterbaugh J, et al. Mutant K-ras oncogenes in colon cancers do not predict patient's chemotherapy response or survival. Clin Cancer Res 1995;1:441–5.[Abstract/Free Full Text]
  29. Rodenhuis S, Boerrigter L, Top B, et al. Mutational activation of the K-ras oncogene and the effect of chemotherapy in advanced adenocarcinoma of the lung: a prospective study. J Clin Oncol 1997;15:285–91.[Abstract/Free Full Text]
  30. Moldvay J, Scheid P, Wild P, et al. Predictive survival markers in patients with surgically resected non-small cell lung carcinoma. Clin Cancer Res 2000;6:1125–34.[Abstract/Free Full Text]
  31. Sheridan MT, O'Dwyer T, Seymour CB, Mothersill CE. Potential indicators of radiosensitivity in squamous cell carcinoma of the head and neck. Radiat Oncol Investig 1997;5:180–6.[CrossRef][Medline]
  32. Milas L, Mason K, Hunter N, et al. In vivo enhancement of tumor radioresponse by C225 antiepidermal growth factor receptor antibody. Clin Cancer Res 2000;6:701–8.[Abstract/Free Full Text]
  33. Nasu S, Ang KK, Fan Z, Milas L. C225 antiepidermal growth factor receptor antibody enhances tumor radiocurability. Int J Radiat Oncol Biol Phys 2001;51:474–7.[CrossRef][Medline]
  34. Bonner JA, Raisch KP, Trummell HQ, et al. Enhanced apoptosis with combination C225/radiation treatment serves as the impetus for clinical investigation in head and neck cancers. J Clin Oncol 2000;18:47–53S.
  35. Harari PM, Huang SM. Head and neck cancer as a clinical model for molecular targeting of therapy: combining EGFR blockade with radiation. Int J Radiat Oncol Biol Phys 2001;49:427–33.[CrossRef][Medline]
  36. Huang SM, Li J, Armstrong EA, Harari PM. Modulation of radiation response and tumor-induced angiogenesis after epidermal growth factor receptor inhibition by ZD1839 (Iressa). Cancer Res 2002;62:4300–6.[Abstract/Free Full Text]
  37. Downward J, Parker P, Waterfield MD. Autophosphorylation sites on the epidermal growth factor receptor. Nature 1984;311:483–5.[CrossRef][Medline]
  38. Chakravarti A, Chakladar A, Delaney MA, Latham DE, Loeffler JS. The epidermal growth factor receptor pathway mediates resistance to sequential administration of radiation and chemotherapy in primary human glioblastoma cells in a RAS-dependent manner. Cancer Res 2002;62:4307–15.[Abstract/Free Full Text]
  39. Reardon DB, Contessa JN, Mikkelsen RB, et al. Dominant negative EGFR-CD533 and inhibition of MAPK modify JNK1 activation and enhance radiation toxicity of human mammary carcinoma cells. Oncogene 1999;18:4756–66.[CrossRef][Medline]
  40. Hagan M, Wang L, Hanley JR, Park JS, Dent P. Ionizing radiation-induced mitogen-activated protein (MAP) kinase activation in DU145 prostate carcinoma cells: MAP kinase inhibition enhances radiation-induced cell killing and G2/M-phase arrest. Radiat Res 2000;153:371–83.[CrossRef][Medline]
  41. Gupta AK, Bernhard EJ, Bakanauskas VJ, Wu J, Muschel RJ, McKenna WG. RAS-mediated radiation resistance is not linked to MAP kinase activation in two bladder carcinoma cell lines. Radiat Res 2000;154:64–72.[CrossRef][Medline]
  42. O'Gorman DM, McKenna SL, McGahon AJ, Knox KA, Cotter TG. Sensitisation of HL60 human leukaemic cells to cytotoxic drug-induced apoptosis by inhibition of PI3-kinase survival signals. Leukemia 2000;14:602–11.[CrossRef][Medline]
  43. Belka C, Knippers P, Rudner J, Faltin H, Bamberg M, Budach W. MEK1 and Erk1/2 kinases as targets for the modulation of radiation responses. Anticancer Res 2000;20:3243–9.[Medline]
  44. Gupta AK, Bakanauskas VJ, Cerniglia GJ, et al. The Ras radiation resistance pathway. Cancer Res 2001;61:4278–82.[Abstract/Free Full Text]
  45. Grana TM, Rusyn EV, Zhou H, Sartor CI, Cox AD. Ras mediates radioresistance through both phosphatidylinositol 3-kinase-dependent and Raf-dependent but mitogen-activated protein kinase/extracellular signal-regulated kinase kinase-independent signaling pathways. Cancer Res 2002;62:4142–50.[Abstract/Free Full Text]
  46. Anderson KE, Jackson SP. Class I phosphoinositide 3-kinases. Int J Biochem Cell Biol 2003;35:1028–33.[CrossRef][Medline]
  47. Benistant C, Chapuis H, Roche S. A specific function for phosphatidylinositol 3-kinase {alpha} (p85{alpha}-p110{alpha}) in cell survival and for phosphatidylinositol 3-kinase ß (p85{alpha}-p110ß) in de novo DNA synthesis of human colon carcinoma cells. Oncogene 2000;19:5083–90.[CrossRef][Medline]
  48. Bi L, Okabe I, Bernard DJ, Nussbaum RL. Early embryonic lethality in mice deficient in the p110ß catalytic subunit of PI 3-kinase. Mamm Genome 2002;13:169–72.[CrossRef][Medline]
  49. Bi L, Okabe I, Bernard DJ, Wynshaw-Boris A, Nussbaum RL. Proliferative defect and embryonic lethality in mice homozygous for a deletion in the p110{alpha} subunit of phosphoinositide 3-kinase. J Biol Chem 1999;274:10963–8.[Abstract/Free Full Text]
  50. Downward J. PI 3-kinase, Akt and cell survival. Semin Cell Dev Biol 2004;15:177–82.[CrossRef][Medline]
  51. Datta SR, Brunet A, Greenberg ME. Cellular survival: a play in three Akts. Genes Dev 1999;13:2905–27.[Free Full Text]
  52. Chen WS, Xu PZ, Gottlob K, et al. Growth retardation and increased apoptosis in mice with homozygous disruption of the Akt1 gene. Genes Dev 2001;15:2203–8.[Abstract/Free Full Text]
  53. Bae SS, Cho H, Mu J, Birnbaum MJ. Isoform-specific regulation of insulin-dependent glucose uptake by Akt/protein kinase B. J Biol Chem 2003;278:49530–6.[Abstract/Free Full Text]
  54. Gerber HP, McMurtrey A, Kowalski J, et al. Vascular endothelial growth factor regulates endothelial cell survival through the phosphatidylinositol 3'-kinase/Akt signal transduction pathway. Requirement for Flk-1/KDR activation. J Biol Chem 1998;273:30336–43.[Abstract/Free Full Text]
  55. Du W, Liu A, Prendergast GC. Activation of the PI3'K-AKT pathway masks the proapoptotic effects of farnesyltransferase inhibitors. Cancer Res 1999;59:4208–12.[Abstract/Free Full Text]
  56. Brognard J, Clark AS, Ni Y, Dennis PA. Akt/protein kinase B is constitutively active in non-small cell lung cancer cells and promotes cellular survival and resistance to chemotherapy and radiation. Cancer Res 2001;61:3986–97.[Abstract/Free Full Text]
  57. Gupta AK, Cerniglia GJ, Mick R, et al. Radiation sensitization of human cancer cells in vivo by inhibiting the activity of PI3K using LY294002. Int J Radiat Oncol Biol Phys 2003;56:846–53.[CrossRef][Medline]
  58. Downward J. Ras signalling and apoptosis. Curr Opin Genet Dev 1998;8:49–54.[CrossRef][Medline]
  59. Tachiiri S, Sasai K, Oya N, Hiraoka M. Enhanced cell killing by overexpression of dominant-negative phosphatidylinositol 3-kinase subunit, {Delta}p85, following genotoxic stresses. Jpn J Cancer Res 2000;91:1314–8.[Medline]
  60. Ng SSW, Tsao MS, Chow S, Hedley DW. Inhibition of phosphatidylinositide 3-kinase enhances gemcitabine-induced apoptosis in human pancreatic cancer cells. Cancer Res 2000;60:5451–5.[Abstract/Free Full Text]
  61. Bondar VM, Sweeney-Gotsch B, Andreeff M, Mills GB, McConkey DJ. Inhibition of the phosphatidylinositol 3'-kinase-AKT pathway induces apoptosis in pancreatic carcinoma cells in vitro and in vivo. Mol Cancer Ther 2002;1:989–97.[Abstract/Free Full Text]
  62. Dykxhoorn DM, Novina CD, Sharp PA. Killing the messenger: short RNAs that silence gene expression. Nat Rev Mol Cell Biol 2003;4:457–67.[CrossRef][Medline]
  63. Kasid U, Pfeifer A, Weichselbaum RR, Dritschilo A, Mark GE. The raf oncogene is associated with a radiation-resistant human laryngeal cancer. Science 1987;237:1039–41.[Abstract/Free Full Text]
  64. Henkel AW, Bieger SC. Quantification of proteins dissolved in an electrophoresis sample buffer. Anal Biochem 1994;223:329–31.[CrossRef][Medline]
  65. Summers SA, Whiteman EL, Cho H, Lipfert L, Birnbaum MJ. Differentiation-dependent suppression of platelet-derived growth factor signaling in cultured adipocytes. J Biol Chem 1999;274:23858–67.[Abstract/Free Full Text]
  66. Brunner TB, Gupta AK, Shi Y, et al. Farnesyltransferase inhibitors as radiation sensitizers. Int J Radiat Biol 2003;79:569–76.[CrossRef][Medline]
  67. Cates CA, Michael RL, Stayrook KR, et al. Prenylation of oncogenic human PTP(CAAX) protein tyrosine phosphatases. Cancer Lett 1996;110:49–55.[CrossRef][Medline]
  68. Sebti SM, Hamilton AD. Farnesyltransferase and geranylgeranyltransferase I inhibitors in cancer therapy: important mechanistic and bench to bedside issues. Oncogene 2000;9:2767–82.
  69. Tamanoi F, Kato-Stankiewicz J, Jiang C, Machado I, Thapar N. Farnesylated proteins and cell cycle progression. J Cell Biochem Suppl 2001 Suppl;37:64–70.
  70. Bernhard EJ, Stanbridge EJ, Gupta S, et al. Direct evidence for the contribution of activated N-ras and K-ras oncogenes to increased intrinsic radiation resistance in human tumor cell lines. Cancer Res 2000;60:6597–600.[Abstract/Free Full Text]
  71. Bianco C, Tortora G, Bianco R, et al. Enhancement of antitumor activity of ionizing radiation by combined treatment with the selective epidermal growth factor receptor-tyrosine kinase inhibitor ZD1839 (Iressa). Clin Cancer Res 2002;8:3250–8.[Abstract/Free Full Text]
  72. Grana TM, Sartor CI, Cox AD. Epidermal growth factor receptor autocrine signaling in RIE-1 cells transformed by the Ras oncogene enhances radiation resistance. Cancer Res 2003;63:7807–14.[Abstract/Free Full Text]
  73. Sartor CI. Epidermal growth factor family receptors and inhibitors: radiation response modulators. Semin Radiat Oncol 2003;13:22–30.[CrossRef][Medline]
  74. Cox AD, Der CJ. Ras family signaling: therapeutic targeting. Cancer Biol Ther 2002;1:599–606.[Medline]
  75. Karp JE, Kaufmann SH, Adjei AA, Lancet JE, Wright JJ, End DW. Current status of clinical trials of farnesyltransferase inhibitors. Curr Opin Oncol 2001;13:470–6.[CrossRef][Medline]
  76. Brunner TB, Hahn SM, Gupta AK, Muschel RJ, McKenna WG, Bernhard EJ. Farnesyltransferase inhibitors: an overview of the results of preclinical and clinical investigations. Cancer Res 2003;63:5656–68.[Abstract/Free Full Text]
  77. Cartee L, Vrana JA, Wang Z, et al. Inhibition of the mitogen activated protein kinase pathway potentiates radiation-induced cell killing via cell cycle arrest at the G2/M transition and independently of increased signaling by the JNK/c-Jun pathway. Int J Oncol 2000;16:413–22.[Medline]
  78. Liang K, Jin W, Knuefermann C, et al. Targeting the phosphatidylinositol 3-kinase/Akt pathway for enhancing breast cancer cells to radiotherapy. Mol Cancer Ther 2003;2:353–60.[Abstract/Free Full Text]
  79. Liu X, Shi Y, Han EK, et al. Downregulation of Akt1 inhibits anchorage-independent cell growth and induces apoptosis in cancer cells. Neoplasia 2001;3:278–86.[CrossRef][Medline]
  80. Jetzt A, Howe JA, Horn MT, et al. Adenoviral-mediated expression of a kinase-dead mutant of Akt induces apoptosis selectively in tumor cells and suppresses tumor growth in mice. Cancer Res 2003;63:6697–706.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Cancer Res.Home page
G. Konstantinidou, E. A. Bey, A. Rabellino, K. Schuster, M. S. Maira, A. F. Gazdar, A. Amici, D. A. Boothman, and P. P. Scaglioni
Dual Phosphoinositide 3-Kinase/Mammalian Target of Rapamycin Blockade Is an Effective Radiosensitizing Strategy for the Treatment of Non-Small Cell Lung Cancer Harboring K-RAS Mutations
Cancer Res., October 1, 2009; 69(19): 7644 - 7652.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
K.-H. Huang, S.-F. Huang, I-H. Chen, C.-T. Liao, H.-M. Wang, and L.-L. Hsieh
Methylation of RASSF1A, RASSF2A, and HIN-1 Is Associated with Poor Outcome after Radiotherapy, but not Surgery, in Oral Squamous Cell Carcinoma
Clin. Cancer Res., June 15, 2009; 15(12): 4174 - 4180.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
E. J. Chung, A. P. Brown, H. Asano, M. Mandler, W. E. Burgan, D. Carter, K. Camphausen, and D. Citrin
In vitro and In vivo Radiosensitization with AZD6244 (ARRY-142886), an Inhibitor of Mitogen-activated Protein Kinase/Extracellular Signal-regulated Kinase 1/2 Kinase
Clin. Cancer Res., May 1, 2009; 15(9): 3050 - 3057.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. Marston, V. Weston, J. Jesson, E. Maina, C. McConville, A. Agathanggelou, A. Skowronska, K. Mapp, K. Sameith, J. E. Powell, et al.
Stratification of pediatric ALL by in vitro cellular responses to DNA double-strand breaks provides insight into the molecular mechanisms underlying clinical response
Blood, January 1, 2009; 113(1): 117 - 126.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. Prevo, E. Deutsch, O. Sampson, J. Diplexcito, K. Cengel, J. Harper, P. O'Neill, W. G. McKenna, S. Patel, and E. J. Bernhard
Class I PI3 Kinase Inhibition by the Pyridinylfuranopyrimidine Inhibitor PI-103 Enhances Tumor Radiosensitivity
Cancer Res., July 15, 2008; 68(14): 5915 - 5923.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. C. Park, H. J. Zhang, E. S. Yao, C. J. Park, and M. J. Bissell
{beta}1 Integrin Inhibition Dramatically Enhances Radiotherapy Efficacy in Human Breast Cancer Xenografts
Cancer Res., June 1, 2008; 68(11): 4398 - 4405.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
J. S. Chen, L. J. Zhou, M. Entin-Meer, X. Yang, M. Donker, Z. A. Knight, W. Weiss, K. M. Shokat, D. Haas-Kogan, and D. Stokoe
Characterization of structurally distinct, isoform-selective phosphoinositide 3'-kinase inhibitors in combination with radiation in the treatment of glioblastoma
Mol. Cancer Ther., April 1, 2008; 7(4): 841 - 850.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
M. Toulany, M. Baumann, and H. P. Rodemann
Stimulated PI3K-AKT Signaling Mediated through Ligand or Radiation-Induced EGFR Depends Indirectly, but not Directly, on Constitutive K-Ras Activity
Mol. Cancer Res., August 1, 2007; 5(8): 863 - 872.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. D. Kao, Z. Jiang, A. M. Fernandes, A. K. Gupta, and A. Maity
Inhibition of Phosphatidylinositol-3-OH Kinase/Akt Signaling Impairs DNA Repair in Glioblastoma Cells following Ionizing Radiation
J. Biol. Chem., July 20, 2007; 282(29): 21206 - 21212.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Z. Jiang, N. Pore, G. J. Cerniglia, R. Mick, M.-M. Georgescu, E. J. Bernhard, S. M. Hahn, A. K. Gupta, and A. Maity
Phosphatase and Tensin Homologue Deficiency in Glioblastoma Confers Resistance to Radiation and Temozolomide that Is Reversed by the Protease Inhibitor Nelfinavir
Cancer Res., May 1, 2007; 67(9): 4467 - 4473.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Pervin, R. Singh, E. Hernandez, G. Wu, and G. Chaudhuri
Nitric Oxide in Physiologic Concentrations Targets the Translational Machinery to Increase the Proliferation of Human Breast Cancer Cells: Involvement of Mammalian Target of Rapamycin/eIF4E Pathway
Cancer Res., January 1, 2007; 67(1): 289 - 299.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. Pore, A. K. Gupta, G. J. Cerniglia, Z. Jiang, E. J. Bernhard, S. M. Evans, C. J. Koch, S. M. Hahn, and A. Maity
Nelfinavir Down-regulates Hypoxia-Inducible Factor 1{alpha} and VEGF Expression and Increases Tumor Oxygenation: Implications for Radiotherapy.
Cancer Res., September 15, 2006; 66(18): 9252 - 9259.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. Rasoulpour, K. DiPalma, B. Kolvek, and M. Hixon
Akt1 Suppresses Radiation-Induced Germ Cell Apoptosis in Vivo
Endocrinology, September 1, 2006; 147(9): 4213 - 4221.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Toulany, U. Kasten-Pisula, I. Brammer, S. Wang, J. Chen, K. Dittmann, M. Baumann, E. Dikomey, and H. P. Rodemann
Blockage of Epidermal Growth Factor Receptor-Phosphatidylinositol 3-Kinase-AKT Signaling Increases Radiosensitivity of K-RAS Mutated Human Tumor Cells In vitro by Affecting DNA Repair.
Clin. Cancer Res., July 1, 2006; 12(13): 4119 - 4126.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
L. de la Pena, W. E. Burgan, D. J. Carter, M. G. Hollingshead, M. Satyamitra, K. Camphausen, and P. J. Tofilon
Inhibition of Akt by the alkylphospholipid perifosine does not enhance the radiosensitivity of human glioma cells.
Mol. Cancer Ther., June 1, 2006; 5(6): 1504 - 1510.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. R. Vink, S. Lagerwerf, E. Mesman, J. H.M. Schellens, A. C. Begg, W. J. van Blitterswijk, and M. Verheij
Radiosensitization of Squamous Cell Carcinoma by the Alkylphospholipid Perifosine in Cell Culture and Xenografts
Clin. Cancer Res., March 1, 2006; 12(5): 1615 - 1622.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kim, I.-A.
Right arrow Articles by Bernhard, E. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kim, I.-A.
Right arrow Articles by Bernhard, E. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online