| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology, Pathobiology and Genetics |
Subunits Induce Functional Haploinsufficiency and Tumorigenicity
1 Department of Medical Oncology, Dana-Farber Cancer Institute and Departments of Medicine, Brigham and Women's Hospital and 2 Department of Pathology, Harvard Medical School, Boston, Massachusetts; 3 Broad Institute of Harvard and Massachusetts Institute of Technology, Cambridge, Massachusetts; and 4 Department of Toxicology, School of Public Health, Zhongshan University, Guangzhou, P.R. China
Requests for reprints: William C. Hahn, Dana-Farber Cancer Institute, 44 Binney Street, Dana 710C, Boston, MA 02115. Phone: 617-632-2641; Fax: 617-632-2375; E-mail: william_hahn{at}dfci.harvard.edu.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
subunit expression contributes to the experimental transformation of human cells. To investigate the role of cancer-associated PP2A A
subunit mutants in transformation, we introduced several PP2A A mutants into immortalized but nontumorigenic human cells. These PP2A A mutants exhibited defects in binding to other PP2A subunits and impaired phosphatase activity. Although overexpression of these mutants failed to render immortalized cells tumorigenic, partial suppression of endogenous PP2A A expression activated the AKT pathway and permitted cells to form tumors in immunodeficient mice. These findings suggest that cancer-associated A mutations contribute to cancer development by inducing functional haploinsufficiency, disturbing PP2A holoenzyme composition, and altering the enzymatic activity of PP2A. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, converted immortal HEK cells expressing large T, hTERT, and H-RAS (HEK TER cells) into tumorigenic cells (8). These findings suggest that disruption of PP2A AC-B56 complexes contributes directly to human cell transformation. PP2A is a family of serine-threonine phosphatases implicated in the regulation of numerous signaling pathways (9). Each PP2A complex is composed of an A subunit bound to a catalytic C subunit and a regulatory B subunit. The PP2A B subunits determine PP2A substrate specificity and subcellular localization (9–11). The PP2A A and C subunits each exist as two isoforms. The B subunit isoforms are classified into four families with alternative nomenclatures: B (also known as B55 or PR55), B' (also known as B56 or PR61), B'' (consisting of PR72, PR130, PR59, and PR48), and B''' (putative; consisting of PR93/SG2NA and PR110/Striatin; ref. 12). Each of the B subunits binds to the A subunits to form distinct ABC holoenzyme complexes (13, 14). The diversity of PP2A heterotrimers suggests that particular regulatory subunits mediate specific physiologic functions; however, the roles of specific PP2A heterotrimers in the regulation of cell growth remain undefined.
The two PP2A A subunit isoforms, A (PPP2R1A) and Aß (PPP2R1B), are 86% identical (15). Each isoform consists of 15 nonidentical repeats, and each repeat is composed of two -helices connected by an intrarepeat loop (16). The B subunits bind within repeats 1 to 10, whereas the C subunit binds to repeats 11 to 15 (16). These PP2A A subunit isoforms exhibit differential expression patterns in normal tissues and in tumor cell lines, as well as different affinities for the PP2A C and B subunits and viral tumor antigens, suggesting that each of these isoforms have unique functions (17). At least four PP2A A isoform somatic mutants have been identified in human tumors, including a glutamic acid-to-aspartic acid (E64D) substitution in a lung carcinoma, a glutamic acid-to-glycine substitution (E64G) in a breast carcinoma, an arginine-to-tryptophan substitution (R418W) in a malignant melanoma, and a frame-shift mutation at nucleotide position 652 in a breast carcinoma (18). Each of these PP2A A mutants are defective in their binding to specific B and/or C subunits (19) but involve only one PP2A A allele. In addition to these A point mutations, decreased expression of A has been reported in 43% of human brain tumors (20) and in the human breast cancer cell line MCF-7 (21).
To determine whether these PP2A A subunit mutations contribute to human cell transformation, we examined the effects of overexpressing specific A mutants and suppressing endogenous A expression on PP2A phosphatase activity, anchorage-independent growth, and tumor formation in immortalized but nontumorigenic HEK TER cells. Here we show that mutants of the PP2A A subunit associated with human tumors contribute to transformation by disrupting the constituency of specific PP2A complexes.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, we did PCR using the pGRE5-2(T)63 vector (generously provided by D. Pallas, Emory University), the sense oligonucleotide GGCGGCGGATCCATGGACTACAAAGACGATGACGACAAGGCGGCGGCCGACGGCGACGAC, and the antisense oligonucleotide GGCGGCGAATTCTCAGGCGAGAGACAGAA CAGTCAG, which introduces a FLAG epitope tag (underlined) to the NH2-terminal end of PP2A A. This fragment was subcloned into the retroviral vector pMIG (22) to generate pMIG-A, and A was verified by sequencing. The A mutants E64D, E64G, and R418W were generated using the QuickChange Multi Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA). The B55-specific (SHB55) and B56-specific (SHB56) short hairpin RNAs (shRNA) have been described (8). The vectors pMKO.1-puro-SHA and pMKO.1-puro-SHA1 were generated by introducing oligonucleotides corresponding to nucleotides 1798 to 1818 and 300 to 320 of PP2A A followed by a 6-bp loop and the corresponding antisense sequence, followed by five thymidines into pMKO.1-puro (23). The FLAG-epitope tagged versions of the wild-type or mutant PP2A A subunits resistant to the PP2A A-specific shRNA (SHA) were generated by site-directed mutagenesis and cloned into pMIG to create pMIG-RA, pMIG-RE64D, pMIG-RE64G, and pMIG-RR418W.
Retroviral infections. Wild-type and mutant versions of PP2A A were introduced into HEK cells expressing large T, hTERT, and H-RAS (HEK TER) using amphotropic retroviruses to generate the cell lines HEK A, E64D, E64G, and R418W as described (4). HEK cells expressing PP2A A-specific constructs are named HEK followed by the particular expression construct. HEK LowA1 cells were generated by infecting HEK TER cells with SHA-containing retrovirus produced from 5 x 105 293T packaging cells. To generate cells in which PP2A A was suppressed, HEK TER cells were infected with viral supernatants containing increasing titers of the SHA vector and selected with puromycin (0.5 µg/mL). To generate cell lines that coexpress half the endogenous level of PP2A A and a mutant PP2A A allele, we expressed versions of wild-type and mutant PP2A A resistant to this shRNA vector in HEK LowA1 cells, which yielded HEK RA-LowA1, RE64D-LowA1, RE64G-LowA1, and RR418W-LowA1 cells. The HEK RA-LowA5, RE64D-LowA5, RE64G-LowA5, and RR418W-LowA5 cell lines were generated similarly.
Immunoblotting and immunoprecipitation. Cells were suspended in 50 mmol/L Tris-HCl (pH 7.5), 150 mmol/L NaCl, 1 mmol/L EDTA, protease inhibitor cocktail (Roche, Mannheim, Germany), and 0.5% NP40. Soluble proteins (100 µg) were subjected to 10% SDS-PAGE before immunoblotting. To detect c-Myc, we lysed cells directly on plates using 2x SDS buffer. The antibodies used included PP2A A 6F9 (Covance, Richmond, CA); C (BD Biosciences, San Diego, CA), B56 (Upstate, Lake Placid, NY); B56ß and c-Myc (9E10; Santa Cruz Biotechnology, Santa Cruz, CA); FLAG M2, FLAG M5, and ß-actin (Sigma-Aldrich Co., St. Louis, MO); and mitogen-activated protein kinase (MAPK), phosphorylated MAPK (Thr202/Tyr204), AKT, and phosphorylated AKT (Ser473; Cell Signaling, Beverly, MA). Affinity-purified polyclonal antibodies were raised against PP2A B55, B56, B56
, and SV40 small t peptides as described (8). The B56
polyclonal antibody was obtained by immunizing rabbits with a peptide (ELKRGLRRDGIIPT) corresponding to amino acids 454 to 467. For immunoprecipitation, cells were lysed in a 0.3% CHAPS lysis buffer. Cell lysates (2-5 mg) were incubated with the FLAG M5 or A (clone 6F9) antibody overnight at 4°C followed by the addition of protein G-Sepharose beads (Amersham, Piscataway, NJ) for 2 hours at 4°C. The protein G beads were eluted in 2x SDS sample buffer followed by SDS-PAGE and immunoblotting.
Phosphatase activity. The protein phosphatase activity in PP2A A or FLAG immune complexes was determined as described (8).
Cell cycle and apoptosis analysis. Cells were fixed in 70% ethanol overnight and stained with propidium iodide (PI), and cell cycle distribution was determined using flow cytometry. To detect apoptotic cells, attached and floating cells were harvested, washed with PBS and resuspended in binding buffer containing FITC-conjugated Annexin V (Calbiochem, La Jolla, CA). Apoptotic cells were quantitated by fluorescence-activated cell sorting and analyzed by CellQuest software.
Anchorage-independent growth and tumor formation. For anchorage-independent growth, 105 cells were plated in triplicate into 0.4% Noble agar supplemented with 10% heat-inactivated fetal bovine serum. Anchorage-independent colonies were counted using a microscope 4 weeks after seeding (10x magnification). For tumorigenicity assays, 2 x 106 cells were injected s.c. into immunodeficient mice as described (1). The number of tumors formed was determined 40 days after injection. BALB/AnNTac-Foxn1nu/nu mice were purchased from Taconic (Albany, NY).
Proliferation assays. To measure cell proliferation, 1 x 104 cells were plated in triplicate, and the cells were harvested at 24, 48, 72, and 96 hours. The number of viable cells was determined using a Z2 Particle Count and Size Analyzer (Beckman-Coulter, Miami, FL). For population doubling experiments, a seeding density of 1 x 104 cells in 10-cm plates was used. Triplicate plates were counted every 4 days.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
mutants. The reported cancer-associated PP2A mutations involve the A and Aß subunits (18, 24–26) and affect only one A allele. To determine whether these tumor-associated PP2A A mutants contribute to the transformed phenotype in a dominant manner, we generated FLAG epitope-tagged versions of several PP2A A mutants and introduced them into HEK TER cells, creating HEK TERV (control vector), A (wild type), E64D, E64G, and R418W cell lines. We detected these introduced PP2A A mutants using both FLAG epitope- and A-specific antibodies (Fig. 1A, top). In cells expressing the PP2A A mutants, we noted that the expression of PP2A B55, B56, and C subunits was up-regulated 38%, 53%, and 44%, respectively, whereas the expression of B56 remained unchanged.
|
mutants fail to bind other PP2A subunits in vitro (19), we examined whether these A mutants retained the ability to bind the B and C subunits. When we isolated immune complexes using an antibody specific for the FLAG epitope tag, we found that the FLAG epitope-tagged, wild-type PP2A A bound C and each of the B subunits (Fig. 1A, bottom). In contrast, whereas immune complexes formed with the E64D mutant contained similar amounts of the PP2A C, B56ß, and B56 subunits, we found decreased amounts of the B55 subunit and did not detect the B56, B56, and B56 subunits. The E64G mutant exhibited decreased binding to PP2A C and B56 subunits and failed to coprecipitate the B55, B56, B56ß, B56, and B56 subunits, whereas R418W mutant immune complexes contained decreased amounts of the B55 subunit and undetectable levels of the B56 subunits and the C subunit (Fig. 1A, bottom). We speculate that the partial stabilization of PP2A B55, B56, and C induced by the PP2A A mutants (Fig. 1A) may be due to residual subunit binding of these mutants or to an altered equilibrium between endogenous A and the other B family subunits. These findings corroborate prior in vitro studies (19) and show that these A mutants have functional defects forming PP2A complexes in human cells.
We next examined the effect of expressing these PP2A A mutants on PP2A-attributable phosphatase activity. We found that FLAG immune complexes containing mutant E64D possessed 48% of the phosphatase activity of complexes containing wild-type A, whereas mutants E64G and R418W showed no mutant-specific activity (Fig. 1B, black columns). Thus, these mutants exhibit markedly deficient phosphatase activity. We also assessed the phosphatase activity detected in PP2A A immune complexes, which represents the activity of both endogenous and introduced PP2A A subunits. Compared with cells overexpressing the wild-type PP2A A subunit, we detected 24%, 48%, and 54% less total PP2A activity in cells expressing the PP2A A mutants E64D, E64G, and R418W, respectively (Fig. 1B, gray columns). However, when compared with cells expressing control vector, total PP2A activity was increased 86% and 38% in cells expressing wild-type A and mutant E64D, respectively, but no changes were found in cells expressing mutants E64G or R418W (Fig. 1B, gray columns). Thus, whereas these PP2A A mutants exhibit impaired PP2A activity and binding of C and B subunits, the introduction of A mutants did not inhibit endogenous PP2A phosphatase activity.
Consistent with these observations, we found that introduction of either wild-type A or mutant E64D, E64G, or R418W alleles failed to affect short- or long-term cell proliferation rates (Fig. 1C). Moreover, we failed to observe anchorage-independent growth or tumor formation in these cell lines (Fig. 1D). Thus, these A mutants not only fail to form functional PP2A complexes but also fail to transform HEK TER cells, which express normal levels of the wild-type A subunit.
Effects of suppressing PP2A A expression. Because these cancer-associated PP2A A mutants failed to transform human cells, we speculated that such mutants might act as nonfunctional alleles that decrease the overall level of functional PP2A A. To assess the effect of suppressing A subunit expression on cell transformation, we generated a vector that drives the expression of a shRNA that targets PP2A A (SHA) or a control vector encoding a shRNA specific for GFP (SHGFP). By infecting cells with increasing titers of retroviruses expressing SHA, we succeeded in generating stable cell lines expressing a range of A protein level (52%, 48%, 37%, 15%, and 16% of cells expressing a control vector; Fig. 2A). We named those cells as LowA1 (52%), LowA2 (48%), LowA3 (37%), LowA4 (15%), and LowA5 (16%). We found that the level of A suppression correlated with a similar level of reduction of C, B55, B56, B56, and B56 protein levels (Fig. 2A) as well as with the level of overall PP2A-specific phosphatase activity (Fig. 2B). This coordinate decrease in PP2A subunits upon suppression of A suggested that these subunits are unstable when not bound to PP2A A.
|
(LowA4 and LowA5 cells) proliferated poorly. To determine whether these cells were growth arrested, we analyzed the cell cycle distribution of such cultures. We found that a high percentage of LowA5 cells were arrested in G1 and that a significant percentage of these cells (21%) exhibited a sub-G1 peak of DNA content (Fig. 2C, left), suggesting that such cells were apoptotic. We confirmed that this population represented apoptotic cells by costaining cells with Annexin V and PI (Fig. 2D). Under these conditions, we found that 19% of the LowA5 cells stained for Annexin V, whereas only 4% of SHGFP and LowA1 cells stained for Annexin V (Fig. 2D). Furthermore, the three cell lines in which PP2A A levels were suppressed below 37% of normal levels (LowA3, LowA4, and LowA5) showed a decreased rate of cell proliferation (Fig. 3A), failed to grow in an anchorage-independent manner and were unable to form tumors in immunodeficient hosts (Fig. 3B). Together, these findings indicate that suppression of PP2A A to levels less than one third of wild-type levels leads to apoptosis.
|
5, cells in which PP2A A was suppressed to 
50% of wild-type levels proliferated 21% (LowA1) and 22% (LowA2) faster than control cells (Fig. 3A). Such cells also grew in an anchorage-independent manner and formed tumors in immunodeficient mice (Fig. 3B), indicating that partial suppression of PP2A A induces functional consequences similar to that observed after the introduction of small t or the suppression of PP2A B56. To eliminate the possibility that the transformed phenotype of LowA1 and LowA2 cells was due to off-target effects of RNA interference, we generated a second PP2A A-specific shRNA (SHA1) that targets a different region of the PP2A A transcript. When introduced into HEK TER cells, the SHA1 vector suppressed PP2A A levels by 51% (Fig. 3C), and such cells also grew in soft agar (Fig. 3D). These observations show that the degree of PP2A A subunit suppression induces different functional outcomes.
Cancer-associated PP2A A mutants fail to reverse A suppression-induced tumorigenicity. To investigate whether PP2A A levels were directly responsible for the tumorigenic phenotype, we examined whether restoring A in suppressed cells could reverse the transformed phenotype by generating an allele of PP2A A that is resistant to the effects of PP2A A-specific shRNA (SHA) by virtue of silent substitutions into the coding sequence of A (Fig. 4A). When introduced into 293T cells, this PP2A A allele (RA) was resistant to the suppressive effects of the SHA vector (Fig. 4B). We also generated similarly resistant versions of the PP2A A mutants RE64D, RE64G, and RR418W (data not shown).
|
and SHGFP control vectors were introduced into HEK TER cells expressing the shRNA-resistant versions of wild-type or mutant PP2A A. The HEK TER cell lines expressing the control SHGFP were named HEK RA-SHGFP, RE64D-SHGFP, RE64G-SHGFP, and RR418W-SHGFP, and cell lines expressing SHA and therefore approximately half of the levels of endogenous PP2A A were named HEK RA-LowA1, RE64D-LowA1, RE64G-LowA1, and RR418W-LowA1. We confirmed that these cell lines expressed decreased levels of endogenous PP2A A yet expressed high levels of the introduced wild-type or mutant PP2A A (Fig. 4D). We also created cell lines under conditions where only 16% of the endogenous PP2A A is present (HEK RA-LowA5, RE64D-LowA5, RE64G-LowA5, and RR418W-LowA5).
Introduction of PP2A RA or the RE64D mutant partially reversed the cell growth arrest observed in HEK LowA5 cells, whereas the RE64G and RR418W mutants failed to rescue this cell growth arrest (Fig. 4C). In cells expressing 50% of endogenous PP2A A levels (LowA1 cells), expression of RA inhibited cell proliferation and reversed the ability of such cells to grow in soft agar or form tumors (Fig. 4C-D). These findings support the view that the effects observed in cells expressing PP2A A-specific shRNA are not the result of off-target effects of RNA interference. In contrast, the RE64D, RE64G, and RR418W mutants failed to exhibit any inhibitory effects on cell proliferation or transforming activity (Fig. 4C-D). Moreover, expression of wild-type RA restored the levels of B55, B56, B56, and C subunits in cells expressing 50% of the endogenous levels of A (Fig. 4D). Introduction of the RE64D mutant restored the expression levels of PP2A C and B56 but failed to stabilize the expression of the other PP2A B subunits, whereas the mutants RE64G and RR418W failed to restore the levels of PP2A C or any of the B subunits examined (Fig. 4D). These observations confirm that these PP2A A mutants are nonfunctional alleles and that partial depletion of PP2A A levels contributes directly to transformation.
Loss of PP2A AC-B56 complexes in cells expressing haploin-sufficient levels of A. We previously showed that perturbation of PP2A complexes containing the B56 subunit correlates with cell transformation (8). To investigate whether suppression of PP2A A also altered PP2A B56 complexes, we isolated PP2A A immune complexes and analyzed their composition. Whereas we detected the same amount of PP2A B55, B56, B56, and B56 subunits bound to A in cells expressing 50% of endogenous PP2A A (LowA1) compared with control cells, we failed to find AC-B56 complexes in either LowA5 or LowA1 cells even when twice as much cell lysate was analyzed (Fig. 5B, left). Moreover, when we analyzed tumorigenic HEK cells expressing PP2A A mutants in the setting of partially suppressed PP2A A (Fig. 5A, right), we found that the PP2A AC-B56 holoenzyme was also absent in PP2A A immune complexes (Fig. 5B, right). These results are consistent with the notion that haploinsufficient PP2A A levels create competition among PP2A B subunits for the available A subunits, which results in loss of PP2A complexes containing B56 subunit.
|
or B56 subunits. We found that the basal levels of phosphorylated AKT (Ser473) in cycling cells were elevated 4.3-, 7.5-, and 5.9-fold in LowA1, SHB56, and TERST cells, respectively, compared with control or nontumorigenic cells (Fig. 6). Moreover, we observed phosphorylated AKT in cells expressing mutant PP2A A along with reduced endogenous A subunit (LowA1 background, Fig. 6), yet failed to detect phosphorylated AKT in cells expressing either wild-type PP2A A with the LowA1 background or control vectors. In contrast, we failed to find alterations in the phosphorylation of MAPK (Thr202/Tyr204) in transformed cells (Fig. 6). Thus, cells lacking PP2A complexes containing PP2A B56 are not only tumorigenic but also show evidence of constitutive AKT activation.
|
. Together, these results suggest that cell transformation induced by PP2A dysfunction involves the activation of the AKT pathway. |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
subunit by small t alters PP2A activity and cooperates with large T, hTERT, and H-RAS to convert human cells to tumorigenicity. Using PP2A A mutants and RNA interference, we now show that cancer-associated A mutations contribute to cell transformation by functionally rendering cells deficient in A, and in turn, altering the composition of PP2A complexes.
Although abundant evidence supports the notion that small t plays an important role in experimental human cell transformation (4, 7, 30), the relevance of the interaction of small t with PP2A to spontaneous tumor development was unclear. Mutations in the PP2A A and Aß subunits and reduction of A expression have been reported in some human cancers (18, 20, 24–26), but the contribution of these alterations to transformation had not been examined. Here we focused on the roles of PP2A A mutations in human cell transformation. Because human cancer-associated A mutations occur predominantly in the presence of an intact wild-type allele, we determined whether these A mutations are directly oncogenic. However, we failed to observe transforming activity when we introduced these PP2A A mutants into immortal HEK TER cells, and the introduction of such mutants failed to decrease overall cellular PP2A-attributable phosphatase activity. Thus, it is unlikely that these PP2A A mutants act as oncogenic or dominantly interfering mutants.
Because we confirmed that these cancer-associated PP2A A mutants are deficient in their ability to bind the B and/or C subunits, we speculated that these PP2A A mutations act as inactive alleles and thereby reduce the levels of functional A protein. To test this hypothesis, we suppressed endogenous PP2A A expression using two different PP2A A-specific shRNAs. We found that cells expressing approximately half the level of endogenous PP2A A together with large T, hTERT, and H-RAS formed colonies in soft agar and tumors as xenografts. We also produced human cells expressing a loss-of-function allele of PP2A A in the setting of half the normal level of endogenous PP2A A, recapitulating the configuration of the PP2A A locus in tumors that harbor such mutations and confirming that such genetic alterations induce cell transformation.
Recent work in animal models suggests that haploinsufficiency of certain loci may also lead to tumorigenesis, suggesting an alternative form of tumor suppression (31). For example, deletion of one allele of the Fbxw7/cdc4, Chk1, and Dmp1 tumor suppressor genes predisposes mice to tumor development (32–34), and Dmp1+/– mice are more sensitive to treatment with carcinogens and -irradiation (32). Somatic mutation of PP2A A in human tumors occurs primarily in only one allele, and reduced expression of A has been observed in human gliomas and MCF-7 cells (20, 21). Thus, our results show that reduction of PP2A A gene dosage by suppression of A expression or a single PP2A A allele mutation creates a functionally haploinsufficient state for A that contributes directly to tumorigenicity.
Whereas suppression of endogenous PP2A A by 50% leads to cell transformation, further suppression of A expression resulted in cell cycle arrest and apoptosis. These findings are consistent with experiments in which PP2A A levels were reduced in rat cells (35) or Drosophila S2 cells (36) and are reminiscent of findings in murine embryonic stem cells lacking PP2A C (37). In each case, suppression of PP2A A or C levels induced apoptosis, indicating that a minimal level of PP2A A or C is required for cell survival. Prior work suggests that PP2A controls apoptosis at several levels (reviewed in ref. 38). For example, PP2A interacts with and dephosphorylates Bcl-2 at Ser70, resulting in inactivation of Bcl-2 (39). In addition, association of the PP2A B56 subunit with Bcl-2 plays a role in ceramide-induced apoptosis (40), and ablation of all PP2A B56 subunits in Drosophila S2 cells leads to apoptosis (36). Our findings imply that loss of PP2A complexes containing A and specific B subunits induces apoptosis. At present, the specific PP2A complexes involved in the regulation of apoptosis remain undefined.
Recently, the 4 protein, which binds directly to the PP2A C subunit (41), was shown to play an important role in the control of cell survival. The 4 protein was required for murine embryonic stem cell viability, and loss of 4 resulted in apoptosis (42). Although the binding of 4 protein with the PP2A C subunit results in the displacement of the PP2A A and B subunits (41), the effect of suppressing PP2A A on the formation of 4-C complexes remains unclear. However, our observations suggest that 4 fails to prevent apoptosis induced by PP2A A depletion.
We also showed that the integrity of PP2A core enzyme is essential for stabilizing the PP2A holoenzyme. Suppression of PP2A A subunit expression resulted in the corresponding degradation of C and all B subunits examined. The down-regulation of PP2A C and other B subunits is due to accelerated protein degradation, because the mRNA level of C and other B subunits remained unchanged (data not shown). Our observations suggest that free PP2A C and B subunits including B55, B56, B56, and B56 are unstable in human cells. These observations corroborate similar observations in rat (35) and Drosophila S2 cells (36). Taken together, these experiments suggest that PP2A B subunits exist primarily as part of a heterotrimer with PP2A A and C.
Overexpression of wild-type A lead to stabilization of the B55, B56, and C subunits. Elevated levels of these subunits were also observed with expression of the A mutants, despite the impaired binding properties of the mutants. Residual binding of the E64D and E64G mutants to these other subunits likely accounts for the stabilization observed in HEK E64D and E64G cells. Although we found that the R418W mutant binds only weakly to the B55 subunit and fails to bind the B56 or C subunits, we suspect that this mutant retains binding to either PR72 or PR93/110 family subunits. Such binding may alter the equilibrium among the B subunits and free additional endogenous PP2A A subunit to stabilize the B56 and C subunits. However, these PP2A A mutants were unable to stabilize the B and C subunits under conditions of partial PP2A A suppression, indicating that the equilibrium among PP2A A and the other PP2A subunits is disrupted when the expression of PP2A A falls below wild-type levels.
The finding that PP2A AC-B56 complexes were undetectable in cells expressing 50% endogenous A levels suggests that functional haploinsufficiency of A contributes to cell transformation through disruption of B56-containing complexes. The PP2A B56 family consists of five isoforms (10, 43). Although sharing 68% sequence identity (44), these five PP2A B56 isoforms differ in genomic organization, chromosomal localization, tissue distribution, and developmental regulation (45), suggesting that they meditate different PP2A functions. Under limiting amounts of the PP2A A subunit, we found that competition among the various PP2A B subunits leads to loss of AC-B56 complexes. In addition, we speculate that the loss of PP2A AC-B56 complex also occurs in human cancers that bear A mutations. Because these PP2A A mutants are defective in binding to B56 family members, expression of these PP2A A mutants effectively decreases by half the amount of A available for PP2A B56 subunit binding. Whereas we had previously established that disruption of PP2A B56 complexes participates in cell transformation (8), the relationship of these findings to human cancers remained unclear. Here we have linked loss of B56-containing PP2A complexes to cancer-associated PP2A A mutations and suggest that the altered abundance of these B56 complexes accounts for the function of these mutations in tumors.
Our understanding of PP2A function has been guided in part by studies of SV40 small t, which exerts its effects by altering the activity of PP2A, thereby preventing dephosphorylation of multiple protein kinases including MAPK (46, 47) and AKT (27, 28) and inducing c-Myc stabilization (29). A recent study defined a PP2A-dependent role for polyoma small t in disrupting ARF-mediated activation of p53 (48). In addition, SV40 small t induces a conformational change in the PP2A A subunit that mediates PP2A binding to the androgen receptor (49). Although the interaction of small t with PP2A complexes is involved in regulating many signaling pathways, only some of those pathways are responsible for the transforming function of small t. Here we showed that the introduction of small t or suppression of PP2A B56 or A all lead to loss of AC-B56 complexes, constitutive phosphorylation of AKT, and cell transformation, suggesting a common mechanism for PP2A alterations and human cell transformation. Because monoallelic PP2A A mutations occur at low frequency in human tumor samples, these observations provide strong evidence that haploinsufficiency of PP2A A disrupts PP2A complexes containing PP2A B56 and contributes directly to the development of human cancers.
|
Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Thomas Roberts for advice and Matthew Meyerson for critical reading of the article.
Received 3/31/05. Revised 6/28/05. Accepted 7/ 7/05.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
- and ß-forms of the 65-kDa subunit of protein phosphatase 2A have a similar 39 amino acid repeating structure. Biochemistry 1990;29:3166–73.[CrossRef][Medline]
and Aß subunit isoforms of protein phosphatase 2A: differences in expression, subunit interaction, and evolution. Biochem J 2003;369:387–98.[CrossRef][Medline]
(PPP2R1A) and ß (PPP2R1B) isoforms of the subunit A of the serine-threonine phosphatase 2A in human neoplasms. Oncogene 2000;19:1191–5.[CrossRef][Medline]
subunit gene. Oncogene 2001;20:10–5.[CrossRef][Medline]
subunit of protein phosphatase 2A in human gliomas in the absence of mutations in the A and Aß subunit genes. Int J Cancer 2001;93:798–804.[CrossRef][Medline]
. Proc Natl Acad Sci U S A 1998;95:12370–5.-subunit of protein phosphatase 2A in ceramide-mediated regulation of Bcl2 phosphorylation status and function. J Biol Chem 2002;277:22847–52.4 displays rapamycin-sensitive binding directly to the catalytic subunit of protein phosphatase 2A. Proc Natl Acad Sci U S A 1997;94:10624–9.4 is an essential inhibitor of apoptosis. Science 2004;306:695–8.This article has been cited by other articles:
|
|
 |
|
  L. F. Grochola, A. Vazquez, E. E. Bond, P. Wurl, H. Taubert, T. H. Muller, A. J. Levine, and G. L. Bond Recent Natural Selection Identifies a Genetic Variant in a Regulatory Subunit of Protein Phosphatase 2A that Associates with Altered Cancer Risk and Survival Clin. Cancer Res., October 1, 2009; 15(19): 6301 - 6308. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. M. Fluck and B. S. Schaffhausen Lessons in Signaling and Tumorigenesis from Polyomavirus Middle T Antigen Microbiol. Mol. Biol. Rev., September 1, 2009; 73(3): 542 - 563. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Puustinen, M. R. Junttila, S. Vanhatupa, A. A. Sablina, M. E. Hector, K. Teittinen, O. Raheem, K. Ketola, S. Lin, J. Kast, et al. PME-1 Protects Extracellular Signal-Regulated Kinase Pathway Activity from Protein Phosphatase 2A-Mediated Inactivation in Human Malignant Glioma Cancer Res., April 1, 2009; 69(7): 2870 - 2877. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Hong, L. Lou, S. Gupta, F. Ribeiro-Neto, and D. L. Altschuler A Novel Epac-Rap-PP2A Signaling Module Controls cAMP-dependent Akt Regulation J. Biol. Chem., August 22, 2008; 283(34): 23129 - 23138. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Levallet, J. Levallet, and P.-J. Bonnamy FSH-induced phosphoprotein phosphatase 2A-mediated deactivation of particulate phosphodiesterase-4 activities is abolished after alteration in proteoglycan synthesis in immature rat Sertoli cells J. Endocrinol., April 1, 2008; 197(1): 45 - 54. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Nazarenko, R. Schafer, and C. Sers Mechanisms of the HRSL3 tumor suppressor function in ovarian carcinoma cells J. Cell Sci., April 15, 2007; 120(8): 1393 - 1404. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Rocher, C. Letourneux, P. Lenormand, and F. Porteu Inhibition of B56-containing Protein Phosphatase 2As by the Early Response Gene IEX-1 Leads to Control of Akt Activity J. Biol. Chem., February 23, 2007; 282(8): 5468 - 5477. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Olivero, T. Ruggiero, S. Saviozzi, A. Rasola, N. Coltella, S. Crispi, F. Di Cunto, R. Calogero, and M. F. Di Renzo Genes regulated by hepatocyte growth factor as targets to sensitize ovarian cancer cells to cisplatin Mol. Cancer Ther., May 1, 2006; 5(5): 1126 - 1135. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
