Cancer Research Cancer Epigenetics  Sign up for Cancer Research eTOC's
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kedzia, C.
Right arrow Articles by Binart, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kedzia, C.
Right arrow Articles by Binart, N.
[Cancer Research 65, 8497-8503, September 15, 2005]
© 2005 American Association for Cancer Research


Endocrinology

Medullary Thyroid Carcinoma Arises in the Absence of Prolactin Signaling

Cécile Kedzia1, Ludovic Lacroix2, Nabahet Ameur2, Thierry Ragot3, Paul A. Kelly1, Bernard Caillou4 and Nadine Binart1

1 Institut National de la Sante et de la Recherche Médicale U584, Faculté de Médecine Necker, Paris, France; 2 Unité de Génomique Fonctionnelle, 3 UMR 8121, Vectorologie et Transfert de Gènes; and 4 Département d'Histopathologie, Institut Gustave Roussy, Villejuif, France

Requests for reprints: Nadine Binart, Hormone Targets, Institut National de la Sante et de la Recherche Medicale U584, Faculté de Médecine Necker, 156 rue de Vaugirard, 75730 Paris Cedex 15, France. Phone: 33-1-40-61-5318; Fax: 33-1-43-06-0443; E-mail: binart{at}necker.fr.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Prolactin, a pituitary hormone, exerts pleiotropic effects in various cells. These effects are mediated by a membrane receptor highly expressed in many tissues. To analyze prolactin effects on the thyroid gland, we first identified prolactin receptor (PRLR) mRNAs by in situ hybridization. To further evaluate the physiologic relevance of PRLR actions in the thyroid in vivo, we used PRLR knockout mice. Whereas the histologic structure of thyroid of PRLR-null mice was not disturbed, we show that T4 levels are lower in null animals (13.63 ± 2.98 versus 10.78 ± 2.25 pmol/L in null mice), confirming that prolactin participates in the control of thyroid metabolism. To further investigate thyroid effects in mice, we measured body temperature and thyroid-stimulating hormone in young and adult male and/or female PRLR-null mice and their normal siblings. Surprisingly, in null animals, we saw medullary thyroid carcinoma (MTC) arising from parafollicular C cells producing calcitonin. The incidence of these carcinomas attained 41% in PRLR-null mice, whereas this malignant tumor occurs sporadically or as a component of the familial cancer syndrome in humans. This finding suggests that PRLR-null mice could represent a valuable animal model for MTC, which could be compared with existing MTC models. These observations suggest a possible link between the appearance of this carcinoma and the absence of prolactin signaling.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Prolactin is synthesized by the anterior pituitary and to a lesser extent by numerous extrapituitary tissues. This hormone influences various physiologic processes among which are the regulation of mammary gland development, initiation and maintenance of lactation, reproduction, osmoregulation, immunomodulation, and metabolism (1). These actions are mediated via the binding of prolactin to its receptor, a member of the class I cytokine receptor superfamily, which activates the Janus-activated kinase/signal transducers and activators of transcription signaling pathway (2).

The prolactin receptor (PRLR) is expressed as short and long forms, differing in sequence of their cytoplasmic tails due to alternative splicing of a single PRLR gene (3).

Null mutation of the PRLR functions (4) has mainly highlighted its essential role in reproduction and mammary gland development. Most of the actions, other reported target tissues are presumably modulated by rather than strictly dependent on prolactin. It is known that prolactin plays a role in carbohydrate metabolism via effects on pancreatic insulin production and peripheral insulin sensitivity; however, its role in lipid metabolism is poorly understood (5). Progressive reduction in body weight associated with a reduction in total abdominal fat mass and in leptin concentrations was observed in null females (6). Moreover, PRLR deficiency is accompanied by islet and ß-cell hypoplasia, reduced pancreatic insulin mRNA levels, a blunted insulin secretory response to glucose, and mild glucose intolerance establishing a physiologic role for prolactin in islet and ß-cell maturation, development, and function. Moreover, we have shown bone alterations in null mice representing a delay in bone formation leading to minor osteopenia (7). The observed mineral abnormalities could be explained by an elevated level of parathyroid hormone.

Medullary thyroid carcinoma (MTC) is an endocrine neoplasm of C cells (for review, see refs. 8, 9). This thyroid tumor is sporadic in about 75% of cases and familial in 25% (10). Hereditary germ line mutations or somatic mutations of the RET proto-oncogene are involved in the carcinogenesis of familial or sporadic MTCs (11, 12) and multiple endocrine neoplasia 2 syndromes (MEN2A and MEN2B). RET is a membrane-associated tyrosine kinase receptor involved in neural crest development. Activating mutations in codon 634 are present in 80% of MEN2A patients and a part of familial MTC. On the other hand, 95% of MEN2B syndrome patients display a gain of function mutation in codon 918. In sporadic tumors, somatic mutations in codon 918 of RET proto-oncogene have been identified in 25% to 33% of case, whereas other mutations are not frequent (13). Moreover, MTC synthesizes and secretes large amounts of calcitonin (14), the most specific marker that can be measured in plasma or by immunohistochemistry. Levels of plasma calcitonin are generally correlated with tumor size (15).

With the aim of better understanding the precise role of parathyroid and thyroid function in PRLR knockout mice, we analyzed, in detail, numerous biochemical, histologic, and hormonal variables to explore in vivo the function of prolactin in the thyroid. Our results show that a high incidence of MTC occurs in both genders at about 1 year of age in the absence of the PRLR, suggesting that this cytokine receptor could play some protective role against carcinogenesis.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Prolactin receptor knockout mice. Wild-type, PRLR+/– and PRLR–/– mice on a pure 129Sv genetic background were generated by heterozygous crossbreeding (4). PCR analysis of tail DNA determined the genotypes of the offspring as described previously (16).

In situ hybridization. Microdissected thyroids were snap-frozen and sectioned at 8 µm using a cryocut (Leica, Deerfield, IL). Sections were mounted on Superfrost gold slides (CML, Nemours, France) and fixed in 4% paraformaldehyde for 10 minutes at room temperature. After rinsing in PBS, slides were acetylated for 10 minutes in triethanolamine/acetic anhydride (0.25%, 0.1 mol/L) and dehydrated. Slides were prehybridized for 2 hours at 50°C in the hybridization solution [50% formamide, 10% sulfate dextran, 1x Denhardt's solution, 10 mmol/L Tris-HCl (pH 7), 1 mmol/L EDTA (pH 8), 200 µg/mL yeast tARN, 600 mmol/L NaCl, and 50 mmol/L DTT]. Slides were then hybridized at 55°C for 18 hours in the same solution containing the labeled probes. (35S)-UTP-labeled sense and antisense probes were synthesized using SP6 or T7 RNA polymerase (Kit riboprobe system, Promega, Madison, WI) and used at 4 x 105 cpm by section. Sections were then washed in high stringency, treated with RNase A (20 µg/mL) for 15 minutes at 37°C, and washed in SSC 2x, 50% formamide for 30 minutes at 65°C, in SSC 2x then in 0.1x at 37°C for 20 and 10 minutes, respectively. After drying in ethanol series, the slides were dipped in photographic NTB-2 emulsion (Kodak, Rochester, NY) and exposed for 2 weeks. Slides were developed and fixed (D19 developer and fixer, Kodak) and counterstained by hematoxylin.

Free T4 and calcitonin measurements. Free T4 was measured in individual serum samples from 1- to 14-month-old females using a human RIA kit (Immunotech, Marseille, France). Calcitonin was measured in individual serum with a commercially available chemiluminescence immunoassay (immunoluminometric assay, ILMA, Nichols Institute Diagnostics, Nijmegen, the Netherlands). The ILMA mainly recognizes the mature monomeric form of human calcitonin (calibration to WHO 2nd IS 89/620). The specificity of the ILMA was checked by means of gel filtration analysis (product information from the manufacturer). The lower detection limit was 0.7 pg/mL. The intra-assay variation was 6% for 6.5 pg/mL and 2.6% for 40 pg/mL. The interassay variation was 11% for 6.2 pg/mL and 7.7% for 47 pg/mL. After initiating the chemiluminescence reaction, the light is quantified by the luminometer and expressed as relative luminescent unit (RLU). A standard curve is generated by plotting the RLU versus the respective concentration of calcitonin for each standard in logarithmic scale, whereas calcitonin concentrations are expressed as pg/mL.

Thyroid-stimulating hormone measurement. Blood was obtained by cardiac puncture from anesthetized mice. Plasma thyroid-stimulating hormone (TSH) levels were assayed using antibodies specific for human TSH as previously described (17).

Measurement of body temperature. Body temperature was measured every day between 9:30 and 10:00 am for 10 days, using a rectal probe equipped with a digital thermometer (model 508 BR, Bioseb, Chaville, France) in PRLR+/+ and PRLR–/– females. The median temperature was calculated for each animal and the average of median temperatures was determined for 7- to 10-month-old animals.

Thyroid dissection and weight. Thyroids with trachea were extracted from PRLR+/+ and PRLR–/– animals. Thyroid glands were microdissected with needles under a dissecting microscope to discard all contaminant tissue; glands were immediately weighed to avoid drying and to quantitate mass (Mettler, Hightstown, NJ). Thyroid glands were fixed in 4% paraformaldehyde in PBS for few hours, processed for paraffin embedding and sectioning (5 µm), or they were embedded in cryocompound Tissue-Tek and then frozen in –40°C, cooled isopentane for cryocut sections.

Histology and anticalcitonin immunohistochemistry. Histologic sections were deparaffined, rehydrated, and processed for either histology sections by H&E staining or for immunohistochemistry. Tissue sections were pretreated with microwaves heating in citrate buffer. After washing in PBS and blocking in bovine serum albumin and goat serum, rabbit polyclonal to calcitonin (DAKO, Trappes, France) was used at 1:700 dilution overnight at 4°C. Immunostaining was visualized by using Texas red–conjugated anti-rabbit IgG. Sections were counterstained by Hoechst solution (Sigma, St. Louis, MO).

Reverse transcription-PCR of mRNA prolactin receptor. The C cell line used here was initially derived from a medullary thyroid carcinoma tumor arisen in a 19.5-month-old transgenic animal deriving from the 5319 founder animal (18). The transgene contained the cDNA coding the human RET 9 isoform carrying the MEN2A-specific mutation at codon 634 under the control of the rat CGRP/calcitonin promoter (18). The CMT-125 C cell line was finally obtained after a s.c. passage of the dissociated tumor cells in nude mouse and isolation from the dissociated nude s.c. tumor of individual calcitonin-secreting clones in cell culture.5

Total RNA was extracted from C cells by modified guanidine isothiocyanate phenol chloroform (Trizol); 1 µg was reverse transcribed using 1 µg oligo-dT (Amersham Pharmacia Biotech, Orsay, France), 200 units of Moloney murine leukemia virus reverse transcriptase (Life Technologies, Cergy-Pontoise, France), 1 mmol/L of deoxynucleotide triphosphate (dNTP), and 40 units of RNAsine (Life Technologies) for 30 minutes at 37°C. The amplification of transcripts was done with oligonucleotides primers (Eurogentec, Seraing, Belgium) 5'-GAGAAAAACACCTATGAATGTC-3' and 5'-AGCAGTTCTTCAGACTTGCC-3'(antisense) spanning exons 5 to 10 (5 mmol/L each) using Taq polymerase (Life Technologies) on 1 µL of the reverse transcription reaction in a mix containing 0.5 mmol/L of dNTP, 2.5 mmol/L of MgCl2 in 20 µL final. PCR was carried out for 30 cycles to insure the linear amplification, with an annealing temperature of 62°C. The experimental conditions were such that the amplification was exponential. Products (653-bp size) were resolved by electrophoresis on 1% agarose gel, which was stained with ethidium bromide.

Ret mutations. We focused on the most frequent mutation localized in exon 11 (codon 634, cysteine-rich domain) and exon 16 (codon 918, tyrosine kinase domain). Mouse (NM_009050) and Human (NM_000323) RET sequences display a perfect identity and similarity for those codon. DNA was extracted from six paraffin-embedded tumors. PCR amplification and Big Dye Terminator sequencing (Applied Biosystems, Rochester CA) were done according to manufacturer's recommendations and using the following primers: RET-MmEx11F CATCTCAGATGGTCACAGTGCA and RET-MmEx11R AAGGTCATTTCCGCTGATGC, RET-MmEx16F AGCCATACTAATGCCTTCGTTCA, RET-MmEx16R GAGACAAGAC ATCATGGCCCA. Sequencing products were analyzed on 3730 DNA analyzer and sequence alignment was done with Sequencing Analysis software.

Statistical analysis. Statistical analysis was done using ANOVA followed by Newman-Keuls tests. P < 0.05 was considered statistically significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Identification of prolactin receptor in thyroid cells. The cause of the increase in serum calcium levels observed in PRLR–/– animals remains obscure, but it is well known that mineral homeostasis is under the control of hormones such as parathyroid hormone, estradiol, or calcitriol, which have been suggested to be directly or indirectly involved with prolactin metabolism (1921). All mineral abnormalities could be explained by estrogen and progesterone deficiency or/and high level of parathyroid hormone. Such elevated levels of parathyroid hormone in PRLR–/– mice could also explain the increased calcium concentration and bone abnormalities (7). Thus, the hormonal status of PRLR–/– mice is perturbed, resulting in several potential consequences, not only on bone formation but also for metabolic status. To analyze potential parathyroid dysfunctions, we first did a study of PRLR mRNA expression in parathyroid sections of PRLR+/+ sibling mice. A representative section of parathyroid included in thyroid tissue is shown in Fig. 1A. We revealed for the first time, by in situ hybridization analysis (Fig. 1C), a moderate expression of PRLR transcripts in the parathyroid glands but a very high level of expression in the thyroid gland, mostly in follicles of young mice (6-week-old females). The hybridization signal is clearly specific compared with the sense probe (Fig. 1D).



View larger version (85K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Expression of PRLR mRNA. In situ hybridization using antisense under bright (A) and dark (C) field and sense (D) riboprobes to mPRLR on microdissected thyroid sections from 6-week-old wild-type female. T, thyroid; P, parathyroid. Bar, 100 µm. B, semiquantitative reverse transcription-PCR analysis of PRLR mRNA in ovaries from PRLR+/+ mice (as positive control), C cells and H2O (as negative control). Predicted size product is 653 bp (arrow). Markers (1-kb ladder).

 
To determine whether the thyroid C cells also express PRLR mRNA, we did reverse transcription-PCR on a population of isolated C cell line derived from a transgenic mouse developing MTC (18). As shown in Fig. 1B, the C cells express an intense band representing PRLR mRNA that was also detected in the ovary, a well-known prolactin target. Finally, we noted an unexpected high level of PRLR expression in thyroid tissues suggesting that thyroid could be a potential new target of prolactin.

Weight and function of thyroid glands in PRLR+/+ and PRLR–/– mice. To evaluate the possible phenotypic differences between PRLR+/+ and PRLR–/– thyroids, the weight of microdissected glands was measured at different ages (2-, 4-, and 14-month-old mice). A significant increase (P < 0.05) in PRLR–/– thyroid gland weight was observed in animals at 2, 4, and 5 months of age (Fig. 2A), although at 14 months of age, this did not quite reach statistical significance (P = 0.06). However, the regression curve corresponding to PRLR–/– thyroid weights (y = 0.3634x + 3.3735) was systematically above that of PRLR+/+ (y = 0.3881x + 2.0208) animals.



View larger version (11K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. A, thyroid gland weight of PRLR+/+ ({square}) and PRLR–/– ({blacksquare}) mice between 2 and 14 months. A linear regression curve is represented in dotted (+/+) and black (–/–) lines. B, serum-free T4 levels in PRLR+/+ (open columns, n = 30) and PRLR–/– mice (solid columns, n = 32) from 2- to 14-month-old females. C, histograms of the means of body temperature of 7- to 10-month-old PRLR+/+ females (n = 10) and PRLR–/– females (n = 13), recorded for 10 days. Columns, means; bars, ±SD (B and C). ***, P < 0.0001, statistically significant differences.

 
Because thyroid weight was increased in PRLR–/– mice, the presence of abnormal thyroid function was considered. Serum-free T4 (FT4) was significantly decreased compared with that in PRLR+/+ mice (Fig. 2B). The mean FT4 concentration was 13.63 ± 2.98 and 10.78 ± 2.25 pmol/L in PRLR+/+ and PRLR–/– mice, respectively corresponding to a reduction of 21% in PRLR–/– mice. The serum TSH level is one of the most sensitive indicators of thyroid function state and is therefore useful in understanding the action of prolactin in our model mouse. TSH levels were not statistically different in PRLR+/+ and PRLR–/– animals [16.58 ±1.99 ng/ mL (n = 12) versus 17.58 ± 1.16 ng/mL (n = 18)]. These results suggest only a moderate hypothyroid status, which led us to measure body temperature, a good index of thyroid function.

Throughout the 2-week period of recording, body temperature in PRLR–/– mice was significantly lower than in PRLR+/+ mice (Fig. 2C). Over this period, mean body temperature in PRLR–/– mice was 0.55°C lower than controls. At 7 to 10 months, it was 36.91 ± 0.18°C and 37.46 ± 0.36°C in PRLR–/– and PRLR+/+ mice, respectively. The same two groups, analyzed 5 months later, exhibited a similar significant difference (36.94 ± 0.26°C and 37.24 ± 0.14°C in PRLR–/– and PRLR+/+ mice, respectively).

Histologic analysis. Longitudinal sections and H&E staining of 14- to 16-month-old PRLR+/+ and PRLR–/– thyroid gland revealed that the follicular structure was regular and uniform in both genotypes (Fig. 3). At low magnification (Fig. 3A-B), the global histology was comparable between the two genotypes. At high magnification, the aspect and size of the follicles of PRLR–/– mice were not different from that observed in PRLR+/+ mice. The abundance and structure of the different organelles were normal (Fig. 3C-D). In addition, the average area of the follicular lumen was not different between PRLR–/– and PRLR+/+ mice (4,418 ± 624 µm2, n = 7 and 4,603 µm2 ± 791, n = 6), respectively. However, we observed much more mucus cell–like structures in thyroid gland from PRLR–/– than in PRLR+/+ mice (Fig. 3C-D).



View larger version (116K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Histology of longitudinal sections of thyroid gland from PRLR+/+ (A-C) and PRLR–/– (B-D) mice. At high magnification (C-D), one can note the presence of mucus-like cells (arrow), which are more abundant in PRLR–/– than in PRLR+/+ thyroid. Bar, 100 µm.

 
Appearance of medullary thyroid carcinoma in PRLR–/– mice. We examined thyroid of older animals and were surprised to discover the presence of tumors in 5 of 17 animals around 1 year of age. Gross thyroid morphology of a large unilateral tumor is illustrated in Fig. 4A. An exhaustive histologic analysis of this tumor showed features of medullary thyroid carcinomas consisting of sheets, nest, or trabeculae of polygonal, round, or spindles cells. Tumors contain round to oval, regular nuclei with coarse chromatin. Destruction and replacement of normal follicular thyroid tissue by a more or less solid cellular proliferation is clearly shown in Fig. 4B. In addition, numerous mitoses were observed, suggesting a highly active proliferation rate of this tissue (Fig. 4C). The definitive diagnosis of MTC rests on the immunohistochemical demonstration of calcitonin in malignant cells. Consistent with the histology, calcitonin immunoreactivity was clearly detected in all observed MTC in the PRLR–/– mice; a representative tumor is shown (Fig. 4D).



View larger version (102K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. A, macroscopic observation of MTC in a 14-month-old PRLR–/– mouse (left). The size of the contralateral lobe (right) is normal compared with the size of PRLR–/– lobe which does not develop tumor. B, histologic section of MTC with massive invasion of one lobe. Arrows, remnants of thyroid follicles at the periphery of the tumor mass (*). C, details of MTC exhibiting numerous mitoses (arrows). D, positive calcitonin staining (red) of the section described in (B) shows definitively that the tumor is medullary thyroid carcinoma. Nuclei (blue) are detected by Hoechst staining. Bar, 1 mm (A), 100 µm (B), and 50 µm (C).

 
Thyroid carcinoma was suspected in all five cases. In accordance with the hypothesis of a MTC, we did calcitonin measurements because this pathology arises generally from C cells producing high levels of calcitonin. First, serum calcitonin measurements were done on healthy animals (Table 1). In PRLR+/+ and PRLR–/– mice, no detectable serum calcitonin was evident and <25 cells were positive by immunohistochemistry in the thyroid sections, whereas all five animals presenting a tumor or an early tumor were highly positive for calcitonin immunostaining. The serum calcitonin level in these five animals was extremely high in accordance with tumor size. Two additional PRLR–/– animals (T40 and T50) exhibited >25 positive C cells on thyroid sections suggesting a hyperplasic phenotype, these cells were able to produce sufficient quantities of calcitonin to be measured in sera of these animals (Table 1). In addition, the analysis of the distribution of thyroid C cells in PRLR+/+ and PRLR–/– of 14-month-old mice by immunohistochemical calcitonin labeling was done (Fig. 5). The number of positive calcitonin cells by section was <25 of total cells in both PRLR+/+ (Fig. 5A) and PRLR–/– sections (Fig. 5B). However, >25 positive C cells were observed in the 14-month-old PRLR–/– thyroid corresponding to T40 mouse evocative of C-cell hyperplasia (CCH). Taken together, these data including five bona fide tumors and two CCH lead to a tumor incidence of 41% in a total of seventeen 1-year-old PRLR–/– animals.


View this table:
[in this window]
[in a new window]

 
Table 1. Serum calcitonin measurement and immunohistochemical staining in PRLR+/+ and PRLR–/– mice

 


View larger version (48K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Distribution of thyroid C cells in PRLR+/+ (A) and PRLR–/– (B) mice at 14 and 16 months of age, respectively, by calcitonin immunohistochemistry. On one longitudinal section, the total number of calcitonin positive cells (red) by section is <25 in both (A) and (B). C, >25 positive C cells are observed in a 14-month-old PRLR–/– thyroid mouse suggesting a hyperplasia of C cells. Arrows, positive calcitonin C cells. Bar, 100 µm.

 
Search of characterized Ret mutations. The characterized mutations currently found in MEN2A and MEN2B corresponding to the human amino acid 634 (extracellular cysteine-rich domain, syndrome MEN2A) and amino acid 918 (tyrosine kinase 2 intracellular domain, syndrome MEN2B) after alignment of mouse and human sequences were analyzed in all five CMT. A perfect homology at the nucleotide level is evident between mouse and human species (codons 633-635 and codons 917-919).

No mutation was found in any of the tumors compared with wild-type thyroid and PRLR–/– nontumoral thyroid. This result tends to exclude the known human mutations that occur at high frequency in the CMT.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The development of the PRLR knockout mouse model has largely contributed to a better understanding of prolactin physiology. Results of the present study reveal that PRLR–/– mice share a number of characteristics with growth hormone receptor (GHR)–/– mice (22). PRLR–/– mice have mild hypothyroidism, generally reduced body temperature, and reduced insulin and glucose levels (23). This is an interesting point because both knockout mouse models are the result of the deletion of a hormone receptor belonging to the same family, class I cytokine receptor. Lower body temperature in PRLR–/– mice resulting, perhaps, from reduced metabolic rate would potentially lead to the production of fewer free radicals, which are known to be related to the aging process (24). Measurements of plasma T4 and TSH revealed that PRLR–/– mice are moderately hypothyroid when compared with their normal littermates with no major alterations in thyroid function. Furthermore, these data show that some similarities exist between GHR- and PRLR-deficient mice.

We show for the first time the presence of PRLR mRNA in thyroid and parathyroid tissues in wild-type mice. This was an interesting observation because high serum levels of parathyroid hormone, an increased calcium concentration, and bone abnormalities have been reported in null animals (7). Thus, prolactin could be a potential negative regulator of parathyroid hormone synthesis.

We showed also that PRLR mRNA expression was present in both compartments: thyroid follicles and C cells, the site of calcitonin production. The apparent morphology of follicles was not altered in the absence of prolactin signaling and the C-cell compartment did not seem affected because the calcitonin immunostaining was not modified. No clear effect of prolactin on thyroid has been reported until now, although some authors described that prolactin can exert indirect effects on CD40 expression on thyrocytes by antagonizing the modulatory actions of IFN-{gamma} and interleukin-4 (25). Moreover, it has been suggested that hyperprolactinemia increases the release of calcitonin by thyroid cells in rats through a cyclic AMP–dependent pathway caused an indirect effect of prolactin (26).

In 1-year-old animals, there was a high incidence of MTC that arises from C cells of the thyroid that produce calcitonin. Hereditary MTC either as a single entity, familial MTC or as MEN syndrome (MEN2A or MEN2B) represents 20% to 30% of all MTCs. The identification of hereditary MTC has been facilitated by the direct analysis of the RET proto-oncogene. We observed 41% of MTC in PRLR–/– mice; this very high incidence was not linked to the most frequent RET gain-of-function mutations involved in the etiology of hereditary MTC and up to 30% of sporadic MTC (13, 18, 27). Even if mutation out of codons 634 and 918 are not frequent in human-inherited MTC (28), these results do not exclude the presence of other RET genetic abnormalities. These negative results might also suggest that oncogenic pathway could be independent from RET proto-oncogene. An "old" animal model for inherited C-cell carcinoma, the WAG/Rij rat strain, has a similar behavior: a high incidence of spontaneous C-cell tumors without any of the RET-activating mutations (29). This may suggest there must be additional mechanisms for the genesis and progression of the WAG/Rij rat and PRLR–/– mouse MTCs. The problem is to know if they are also relevant in humans.

In accord with the development of MTC, we have previously shown the development of prolactinomas in PRLR–/– mice by direct and indirect mechanisms. In fact, we previously found pituitary hyperplasia and adenoma formation in PRLR–/– mice (30). In the majority of tissues where it has been evaluated prolactin is mitogenic (31), with only a few tissues showing an antiproliferative role (32). In PRLR–/– mice, there are two factors that contribute to the release of the lactotroph from its usual secretory and proliferative controls: a decrease in the inhibitory dopaminergic control and a second direct effect at the level of the pituitary, which is more consistent with an antiproliferative action of prolactin on lactotroph. No causes of sporadic MTC in absence of RET mutation has been reported for now. However, in one human case report, hyperparathyroidism has been associated to sporadic MTC (33). Hypercalcemia and increased parathyroid hormone level found in our mouse model could constitute a potential link to be investigated.

This new mouse model described here may therefore provide a suitable model system in which to identify and elucidate the effects of undiscovered genes in the etiology of MTC and to establish a link between the absence of prolactin signaling and the appearance of this cancer.


    Acknowledgments
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Gérard Pivert and Monique Talbot for excellent technical assistance and Dr. Gabor Szinnai for helpful discussion.


    Footnotes
 
5 T. Ragot et al., in preparation. Back

Received 11/ 2/04. Revised 2/11/05. Accepted 5/13/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Goffin V, Binart N, Touraine P, Kelly PA. Prolactin: the new biology of an old hormone. Annu Rev Physiol 2002;64:47–67.[CrossRef][Medline]
  2. Bole-Feysot C, Goffin V, Edery M, Binart N, Kelly PA. Prolactin and its receptor: actions, signal transduction pathways and phenotypes observed in prolactin receptor knockout mice. Endocr Rev 1998;19:225–68.[Abstract/Free Full Text]
  3. Ormandy CJ, Binart N, Helloco C, Kelly PA. Mouse prolactin receptor gene: genomic organization reveals alternative promoter usage and generation of isoforms via alternative 3'-exon splicing. DNA Cell Biol 1998;17:761–70.[Medline]
  4. Ormandy CJ, Camus A, Barra J, et al. Null mutation of the prolactin receptor gene produces multiple reproductive defects in the mouse. Genes Dev 1997;11:167–78.[Abstract/Free Full Text]
  5. Ling C, Hellgren G, Gebre-Medhin M, et al. Prolactin (PRL) receptor gene expression in mouse adipose tissue: increases during lactation and in PRL-transgenic mice. Endocrinology 2000;141:3564–72.[Abstract/Free Full Text]
  6. Freemark M, Fleenor D, Driscoll P, Binart N, Kelly PA. Body weight and fat deposition in prolactin receptor-deficient mice. Endocrinology 2001;142:532–7.[Abstract/Free Full Text]
  7. Clement-Lacroix P, Ormandy C, Lepescheux L, et al. Osteoblasts are a new target for prolactin: analysis of bone formation in prolactin receptor knockout mice. Endocrinology 1999;140:96–105.[Abstract/Free Full Text]
  8. Vitale G, Caraglia M, Ciccarelli A, et al. Current approaches and perspectives in the therapy of medullary thyroid carcinoma. Cancer 2001;91:1797–808.[CrossRef][Medline]
  9. Leboulleux S, Baudin E, Travagli JP, Schlumberger M. Medullary thyroid carcinoma. Clin Endocrinol (Oxf) 2004;61:299–310.[CrossRef][Medline]
  10. Modigliani E, Cohen R, Campos JM, et al. Prognostic factors for survival and for biochemical cure in medullary thyroid carcinoma: results in 899 patients. The GETC Study Group. Groupe d'etude des tumeurs a calcitonine. Clin Endocrinol (Oxf) 1998;48:265–73.[CrossRef][Medline]
  11. Eng C, Clayton D, Schuffenecker I, et al. The relationship between specific RET proto-oncogene mutations and disease phenotype in multiple endocrine neoplasia type 2. International RET mutation consortium analysis. JAMA 1996;276:1575–9.[Abstract/Free Full Text]
  12. Mulligan LM, Kwok JB, Healey CS, et al. Germ-line mutations of the RET proto-oncogene in multiple endocrine neoplasia type 2A. Nature 1993;363:458–60.[CrossRef][Medline]
  13. Romei C, Elisei R, Pinchera A, et al. Somatic mutations of the ret protooncogene in sporadic medullary thyroid carcinoma are not restricted to exon 16 and are associated with tumor recurrence. J Clin Endocrinol Metab 1996;81:1619–22.[Abstract]
  14. Milhaud G, Tubiana M, Parmentier C, Coutris G. Epithelioma of the thyroid secreting thyrocalcitonin. C R Acad Sci Hebd Seances Acad Sci D 1968;266:608–10.
  15. Cohen R, Campos JM, Salaun C, et al. Preoperative calcitonin levels are predictive of tumor size and postoperative calcitonin normalization in medullary thyroid carcinoma. Groupe d'Etudes des Tumeurs a Calcitonine (GETC). J Clin Endocrinol Metab 2000;85:919–22.[Abstract]
  16. Binart N, Helloco C, Ormandy CJ, et al. Rescue of preimplantatory egg development and embryo implantation in prolactin receptor-deficient mice after progesterone administration. Endocrinology 2000;141:2691–7.[Abstract/Free Full Text]
  17. Weiss RE, Forrest D, Pohlenz J, Cua K, Curran T, Refetoff S. Thyrotropin regulation by thyroid hormone in thyroid hormone receptor ß-deficient mice. Endocrinology 1997;138:3624–9.[Abstract/Free Full Text]
  18. Michiels FM, Chappuis S, Caillou B, et al. Development of medullary thyroid carcinoma in transgenic mice expressing the RET protooncogene altered by a multiple endocrine neoplasia type 2A mutation. Proc Natl Acad Sci U S A 1997;94:3330–5.[Abstract/Free Full Text]
  19. Sowers MF, Hollis BW, Shapiro B, et al. Elevated parathyroid hormone-related peptide associated with lactation and bone density loss. JAMA 1996;276:549–54.[Abstract/Free Full Text]
  20. Mortensen BM, Gautvik KM, Gordeladze JO. Bone turnover in rats treated with 1,25-dihydroxyvitamin D3, 25-hydroxyvitamin D3 or 24,25-dihydroxyvitamin D3. Biosci Rep 1993;13:27–39.[CrossRef][Medline]
  21. Lippuner K, Zehnder HJ, Casez JP, Takkinen R, Jeager P. PTH-related protein is released into the mother's bloodstream during lactation: evidence for beneficial effects on maternal calcium-phosphate metabolism. J Bone Miner Res 1997;11:1394–9.
  22. Hauck SJ, Hunter WS, Danilovich N, Kopchick JJ, Bartke A. Reduced levels of thyroid hormones, insulin, and glucose, and lower body core temperature in the growth hormone receptor/binding protein knockout mouse. Exp Biol Med (Maywood) 2001;226:552–8.[Abstract/Free Full Text]
  23. Freemark M, Avril I, Fleenor D, et al. Targeted deletion of the prolactin receptor: effects on islet development, insulin production, and glucose tolerance. Endocrinology 2002;143:1378–85.[Abstract/Free Full Text]
  24. Harman D. The aging process. Proc Natl Acad Sci U S A 1981;78:7124–8.[Abstract/Free Full Text]
  25. Li J, Teng W, Shan Z. Effects of prolactin on HLA-DR and CD40 expressions by human thyrocytes. Chin Med J (Engl) 2001;114:1151–6.
  26. Lu CC, Tsai SC, Huang WJ, Tsai CL, Wang PS. Effects of hyperprolactinemia on calcitonin secretion in male rats. Metabolism 1999;48:221–6.[CrossRef][Medline]
  27. Acton DS, Velthuyzen D, Lips CJ, Hoppener JW. Multiple endocrine neoplasia type 2B mutation in human RET oncogene induces medullary thyroid carcinoma in transgenic mice. Oncogene 2000;19:3121–5.[CrossRef][Medline]
  28. Jindrichova S, Kodet R, Krskova L, Vlcek P, Bendlova B. The newly detected mutations in the RET proto-oncogene in exon 16 as a cause of sporadic medullary thyroid carcinoma. J Mol Med 2003;81:819–23.[CrossRef][Medline]
  29. De Miguel M, Fernandez-Santos JM, Trigo-Sanchez I, et al. The Ret proto-oncogene in the WAG/Rij rat strain: an animal model for inherited C-cell carcinoma? Lab Anim 2003;37:215–21.[Abstract/Free Full Text]
  30. Schuff KG, Hentges ST, Kelly MA, et al. Lack of prolactin receptor signaling in mice results in lactotroph proliferation and prolactinomas by dopamine-dependent and -independent mechanisms. J Clin Invest 2002;110:973–81.[CrossRef][Medline]
  31. Lee RC, Walters JA, Reyland ME, Anderson SM. Constitutive activation of the prolactin receptor results in the induction of growth factor-independent proliferation and constitutive activation of signaling molecules. J Biol Chem 1999;274:10024–34.[Abstract/Free Full Text]
  32. Kiya T, Endo T, Goto T, et al. Apoptosis and PCNA expression induced by prolactin in structural involution of the rat corpus luteum. J Endocrinol Invest 1998;21:276–83.[Medline]
  33. Livolsi VA, Feind CR. Incidental medullary thyroid carcinoma in sporadic hyperparathyroidism. An expansion of the concept of C-cell hyperplasia. Am J Clin Pathol 1979;71:595–9.[Medline]



This article has been cited by other articles:


Home page
J Mol EndocrinolHome page
A. Cerrato, V. De Falco, and M. Santoro
Molecular genetics of medullary thyroid carcinoma: the quest for novel therapeutic targets
J. Mol. Endocrinol., October 1, 2009; 43(4): 143 - 155.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. J. LeBaron, T. J. Ahonen, M. T. Nevalainen, and H. Rui
In Vivo Response-Based Identification of Direct Hormone Target Cell Populations Using High-Density Tissue Arrays
Endocrinology, March 1, 2007; 148(3): 989 - 1008.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kedzia, C.
Right arrow Articles by Binart, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kedzia, C.
Right arrow Articles by Binart, N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online