| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Priority Reports |
1 Department of Pharmacology, Graduate School of Medicine, Kyoto University, Kyoto, Japan and 2 Department of Pharmacology, David Geffen School of Medicine, University of California at Los Angeles, Los Angeles, California
Requests for reprints: Makoto M. Taketo, Department of Pharmacology, Graduate School of Medicine, Kyoto University, Yoshida-konoé-cho, Sakyo-ku, Kyoto, Japan. Phone: 81-75-753-4391; Fax: 81-75-753-4402; E-mail: taketo{at}mfour.med.kyoto-u.ac.jp.
| Abstract |
|---|
|
|
|---|
716 mice, heterozygotes of an Apc null allele. Like in Apc
716 mice, loss of the wild-type Apc allele was confirmed for all polyps examined in the ApcneoR and ApcneoF mice. In the embryonic stem cells homozygous for these hypomorphic Apc alleles, the level of the APC protein was inversely correlated with both the ß-catenin accumulation and ß-catenin/T-cell factor transcriptional activity. These results suggest that the reduced APC protein level increases intestinal polyp multiplicity through quantitative stimulation of the ß-catenin/T-cell factor transcription. We further estimated the threshold of APC protein level that forms one polyp per mouse as
15% of the wild type. These results also suggest therapeutic implications concerning Wnt signaling inhibitors. | Introduction |
|---|
|
|
|---|
Several lines of Apc mutant mice have been established as models for intestinal polyposis. Interestingly, they develop different tumor numbers. Apc
716 form
300 polyps, whereas ApcMin and Apc1638N develop
30 and
3, respectively (68). In contrast, ApcneoR is a hypomorphic allele whose expression is attenuated to
20% of the wild-type Apc allele (9, 10). Notably, heterozygous ApcneoR mice develop very small numbers of intestinal polyps. However, the molecular mechanism has not been investigated regarding the low polyp multiplicity. To determine the dosage effects of the Apc gene activity on suppression of intestinal tumorigenesis, we have constructed another hypomorphic Apc allele ApcneoF that expresses even lower level of APC than ApcneoR. By comparison of ApcneoF and ApcneoR heterozygotes with Apc
716 mice, we show that the amount of APC protein is inversely correlated with Wnt/ß-catenin transcriptional activity that seems to regulate polyp multiplicity.
| Materials and Methods |
|---|
|
|
|---|
716, 11 for ApcneoR, and 8 for ApcneoF. Western blotting and reporter assay. Western blotting for APC and ß-catenin, and ß-catenin/TCF reporter assay were done as described previously (9).
Northern blotting. Polyadenylated RNA was extracted from the mouse embryos and analyzed in 5 µg aliquots. Fragments of mouse Apc cDNA (nucleotides 33-920) and mouse glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA were used as probes.
Immunohistochemistry. Paraffin-embedded sections (4 µm thick) were prepared by a standard method. The ES cells attached to 0.2% gelatin coated glass chamber were fixed with 4% paraformaldehyde for 10 minutes. These specimens were incubated with the primary antibody for ß-catenin (1:500; Sigma, St. Louis, MO) or cyclooxygenase-2 (COX-2; 1:200; Cayman Chemical, Ann Arbor, MI) for 1 hour at room temperature. Activation of Akt was determined using an antiphospho-Akt antibody (1:50; Cell Signaling, Beverly, MA) as described previously (11). Immunostaining signals were visualized using Vectastain Elite kit (Vector Laboratories, Burlingame, CA). To determine the cell proliferation rates, sections were stained with an antiKi-67 antibody (1:100, MIB-5; DAKOCytomation, Carpinteria, CA) as described previously (12). The labeling index for Ki-67 was calculated as the number of positive cells/5,000 tumor epithelial cells.
Scoring polyps and histologic preparations. The number of polyps was scored as described previously (6). Fixed specimens were stained with 0.5% methylene blue (Sigma-Aldrich, St. Louis, MO). For histologic analyses, formalin-fixed and paraffin-embedded sections were stained with H&E.
Loss of heterozygosity analysis of the Apc locus. Tumor DNA was isolated from paraffin sections and amplified by PCR as described previously (6). Primers used for the wild-type Apc allele were as follows: Apc-intron13-5' (GCCATACTTTAACACAAGCC) and Apc-intron13-3' (AAAGGCTGCATGAGAGCACTT). To detect the ApcneoF and ApcneoR alleles, primers PR1 (CAGACTGCCTTGGGAAAAGC) paired with Apc-intron13-3' and Apc-intron13-5' were used, respectively.
| Results |
|---|
|
|
|---|
9 days of gestation (data not shown). The homozygous and heterozygous ApcneoF embryos expressed Apc mRNA at
10% and 55% levels of the wild-type, respectively (Fig. 1D), indicating that ApcneoF is a hypomorphic allele similar to ApcneoR.
|
716 mice (i.e., Apc+/
716; Fig. 2A). Namely, the mean polyp numbers in ApcneoF and ApcneoR mice were 1.09 ± 0.85 and 0.26 ± 0.54 at 15 months of age, respectively, whereas about a hundred polyps were found in the Apc
716 mice at 3 months (Table 1). Moreover, the tumor incidence was 50% and 19% in the 15-month-old ApcneoF and ApcneoR mice, respectively (Table 1), whereas 100% of Apc
716 mice developed intestinal polyps at 7 weeks of age (6). Small microadenomas (<0.5 mm in diameter) that were frequently found in the Apc
716 mice under a dissecting microscope were rarely detected in ApcneoF and ApcneoR mice (Table 1; ref. 6).
|
|
716 mice (Fig. 2B and C). In the Apc
716 mouse polyps, ß-catenin was localized predominantly to nuclei of the adenoma epithelial cells, with some weak staining in the membrane (Fig. 2D and G). In the polyps of ApcneoF and ApcneoR mice, however, cells with nuclear ß-catenin were found only sparsely (Fig. 2E, F, H, and I). Accordingly, ß-catenin is less stabilized in the polyps of the ApcneoF and ApcneoR mice than in those of the Apc
716 mice. Importantly, proliferation of adenoma cells determined by Ki-67 labeling index was not much different among the polyps of the Apc
716, ApcneoF, and ApcneoR mice (Fig. 2J-L, and S). These results indicate that the nuclear ß-catenin localization is not necessarily correlated with adenoma cell proliferation.
We have previously shown that induction of COX-2 in the polyp stroma is critical for polyp formation (12, 13). In the polyps of ApcneoF and ApcneoR mice, expression of COX-2 was detected in the luminal side of polyp stroma like in the Apc
716 mice (Fig. 2M-O). We next examined activation of Akt by detection of its phosphorylated form because Akt is constitutively activated in stem cells where ß-catenin is accumulated in nuclei (11). Interestingly, we found phospho-Akt in cells of the entire adenoma in both ApcneoF and ApcneoR mouse polyps as in Apc
716 (Fig. 2P-R). Thus, induction of COX-2 pathway and activation of PI3K-Akt signaling are independent of ß-catenin translocation to nuclei of adenoma cells.
We next examined the Apc genotype of polyp tissues by genomic PCR. The wild-type Apc allele (Apc+) was lost in all polyps examined in both hypomorphic Apc mutants (Fig. 3A and B), suggesting that polyp initiation was triggered by Apc gene loss of heterozygosity (LOH) as in the Apc
716 mice (6). Because Apc LOH is caused by recombination at the centromeric rDNA cluster on mouse chromosome 18 (14), it is expected that all adenoma cells are in fact homozygous for the mutant Apc alleles (i.e., ApcneoF/neoF and ApcneoR/neoR, respectively). These results are consistent with the interpretation that Wnt signaling activation is necessary for the polyp initiation to a level higher than that caused by Apc+/
716 heterozygosity itself (see below).
|
716 mice were 75%, 65%, and 50% of the wild-type level, respectively (Fig. 3C). The slightly lower APC level in the ApcneoF than ApcneoR may have been caused by the insertional orientation of the PGK-neo cassette. Notably, we found faint bands for full-length APC in the polyps of ApcneoR and ApcneoF mice, whereas none in the Apc
716 polyps (Fig. 3C). In contrast, the ß-catenin level was much higher in the polyps of Apc
716 mice than ApcneoF or ApcneoR (Fig. 3D). These results indicate that the level of stabilized ß-catenin is inversely correlated with the residual amount of wild-type APC.
Molecular basis of polyp multiplicity difference among Apc mutants. To determine the transcriptional activities by ß-catenin/TCF complex in the respective Apc mutants in vitro, we generated homozygous ES cell lines for ApcneoR, ApcneoF, and Apc
716 alleles. The APC levels in the homozygous ApcneoR and ApcneoF ES cells were 20% and 10% of that in the Apc+/+ ES cells, respectively, whereas no APC protein was detected in the homozygous Apc
716 ES cells (Fig. 3E). Furthermore, the ß-catenin levels in the homozygous ApcneoR, ApcneoF, and Apc
716 ES cells were inversely correlated with the APC levels;
2.1, 3.1, and 12 times of that in the wild type, respectively (Fig. 3F). Accumulation of ß-catenin in the ApcneoR and ApcneoF cells was milder than that in the Apc
716 cells (Fig. 3G-J). Consistently, the nuclear staining index for ß-catenin was significantly lower in the ApcneoR and ApcneoF cells than that in Apc
716 (Fig. 3K). Moreover, homozygous Apc
716 ES cells showed the highest transcriptional activity by ß-catenin/TCF complex, followed by ApcneoF and ApcneoR with 41, 14, and 6.2 times of the wild-type level, respectively (Fig. 3L). These results, taken together, indicate that Wnt signaling activity is inversely and quantitatively correlated with the APC level both in vivo and in vitro.
| Discussion |
|---|
|
|
|---|
15% of the wild type (Fig. 3M). Consistent with these results, it has been suggested that predisposition to human colon polyposis is dependent on the reduced level of APC expression. Approximately 25% decrease in APC expression, which causes
75% reduction by further APC LOH, may predispose to FAP (4). Likewise, Wnt/ß-catenin signaling controls ES cell differentiation and intestinal tumorigenesis in a quantitative manner at various levels of the pathway (10, 15, 16). The attenuated form of FAP (AAPC) is characterized by smaller polyp number and delayed age of onset than the common form, and phenotypically similar to the ApcneoF and ApcneoR mice. However, the molecular mechanisms seem to be different slightly between human AAPC and ApcneoF or ApcneoR mice. Germ line mutations in familial adenomatous polyposis suggest that there is a need for a third mutation because the inherited alleles are leaky or may express amino-terminally truncated proteins when the allele is mutated in the 5' region (17). The amino-terminal mutation is followed by reinitiation of the mRNA translation from an internal ribosomal entry site, resulting in reduced expression of nearly full-length functional APC (18, 19).
Although it has been suggested that some truncated APC proteins have dominant effects in tumorigenesis through chromosomal instability (20, 21), hypomorphic alleles ApcneoF or ApcneoR did not produce any truncated products (ref. 9 and data not shown). We have also shown that Apc
716 allele does not show any dominant effects in intestinal tumorigenesis when expressed in the intestines as a transgene (22).
We have reported recently that significantly decreased levels of APC and CDX2 proteins in the distal colon of the Apc
716 Cdx2+/ compound mutant mice cause numerous colonic adenomas due to an increased anaphase bridge index that caused Apc LOH (23). In contrast, the normal (nonpolyp) epithelium of Apc
716 small intestine showed similar anaphase bridge index to the wild type (data not shown). Accordingly, it is possible that frequencies of Apc LOH in the intestinal epithelium of the ApcneoF and ApcneoR mice are also similar to that in the wild type. Therefore, it is conceivable that the difference in the polyp multiplicity among the Apc
716, ApcneoF, and ApcneoR mice are caused by some events controlled by Wnt signaling after the polyp initiation. Despite the difference in the nuclear ß-catenin staining and Wnt transcriptional activation between Apc
716 and ApcneoF or ApcneoR polyps, the Ki-67 labeling index was similar among them (Fig. 2). Likewise, expression of COX-2 and the level of phospho-Akt were also similar (Fig. 2). Thus, it remains to be investigated what particular molecules are responsible for the difference in the polyp multiplicity.
In conclusion, we have determined the APC expression levels in relation to the intestinal polyp multiplicity and found that the polyp number is inversely correlated with the Wnt/ß-catenin transcriptional activity. We have estimated that one polyp is formed per mouse when APC protein level decreases to
15% of that in the wild type. These results also suggest therapeutic implications concerning Wnt signaling inhibitors.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank A. Matsunaga, H. Takeda, K. Aoki, and H. Oshima for help and discussion.
Received 6/20/05. Revised 7/13/05. Accepted 8/ 5/05.
| References |
|---|
|
|
|---|
716 knockout mice by inhibition of cyclooxygenase 2 (COX-2). Cell 1996;87:8039.[CrossRef][Medline]
716Cdx2+/ compound mutant mice. Nat Genet 2003;35:32330.[CrossRef][Medline]This article has been cited by other articles:
![]() |
K. Yang, N. Kurihara, K. Fan, H. Newmark, B. Rigas, L. Bancroft, G. Corner, E. Livote, M. Lesser, W. Edelmann, et al. Dietary Induction of Colonic Tumors in a Mouse Model of Sporadic Colon Cancer Cancer Res., October 1, 2008; 68(19): 7803 - 7810. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Schneikert and J. Behrens The canonical Wnt signalling pathway and its APC partner in colon cancer development Gut, March 1, 2007; 56(3): 417 - 425. [Full Text] [PDF] |
||||
![]() |
P. Bjorklund, G. Akerstrom, and G. Westin Accumulation of Nonphosphorylated {beta}-Catenin and c-myc in Primary and Uremic Secondary Hyperparathyroid Tumors J. Clin. Endocrinol. Metab., January 1, 2007; 92(1): 338 - 344. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |