Cancer Research SABCS  Jordan
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, Q.
Right arrow Articles by Taketo, M. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, Q.
Right arrow Articles by Taketo, M. M.
[Cancer Research 65, 8622-8627, October 1, 2005]
© 2005 American Association for Cancer Research


Priority Reports

The Threshold Level of Adenomatous Polyposis Coli Protein for Mouse Intestinal Tumorigenesis

Qin Li1, Tomo-o Ishikawa1,2, Masanobu Oshima1 and Makoto M. Taketo1

1 Department of Pharmacology, Graduate School of Medicine, Kyoto University, Kyoto, Japan and 2 Department of Pharmacology, David Geffen School of Medicine, University of California at Los Angeles, Los Angeles, California

Requests for reprints: Makoto M. Taketo, Department of Pharmacology, Graduate School of Medicine, Kyoto University, Yoshida-konoé-cho, Sakyo-ku, Kyoto, Japan. Phone: 81-75-753-4391; Fax: 81-75-753-4402; E-mail: taketo{at}mfour.med.kyoto-u.ac.jp.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The adenomatous polyposis coli (APC) gene, whose mutations are responsible for familial adenomatous polyposis, is a major negative controller of the Wnt/ß-catenin pathway. To investigate the dose-dependent effects of APC protein in suppressing intestinal tumorigenesis, we constructed mutant mice carrying hypomorphic Apc alleles ApcneoR and ApcneoF whose expression levels were reduced to 20% and 10% of the wild type, respectively. Although both hypomorphic heterozygotes developed intestinal polyps, tumor multiplicities were much lower than that in Apc{Delta}716 mice, heterozygotes of an Apc null allele. Like in Apc{Delta}716 mice, loss of the wild-type Apc allele was confirmed for all polyps examined in the ApcneoR and ApcneoF mice. In the embryonic stem cells homozygous for these hypomorphic Apc alleles, the level of the APC protein was inversely correlated with both the ß-catenin accumulation and ß-catenin/T-cell factor transcriptional activity. These results suggest that the reduced APC protein level increases intestinal polyp multiplicity through quantitative stimulation of the ß-catenin/T-cell factor transcription. We further estimated the threshold of APC protein level that forms one polyp per mouse as ~15% of the wild type. These results also suggest therapeutic implications concerning Wnt signaling inhibitors.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Germ line mutations in the adenomatous polyposis coli (APC) gene are responsible for familial adenomatous polyposis (FAP), an inherited autosomal dominant disease characterized by development of multiple adenomas in the colon. Mutations in APC are also detected in the majority of sporadic colon cancer and early adenomas (1). The APC protein functions as a tumor suppressor through regulation of the unphosphorylated cytoplasmic ß-catenin levels (1, 2). In the absence of functional APC, ß-catenin is accumulated in the cytoplasm, resulting in translocation to the nucleus with T-cell factor (TCF), followed by transcriptional activation of the Wnt target genes (1, 2). Consistent with Knudson's two-hit principle, both APC alleles are inactivated in the majority of intestinal tumors (3). However, it has been suggested that mutations in APC gene in FAP patients do not always follow the two-hit model. For example, reduced levels of APC expression from one allele are found in some FAP patients (4). Moreover, obvious mutations in the APC coding region are lacking in some intestinal tumors with significantly reduced APC levels (5).

Several lines of Apc mutant mice have been established as models for intestinal polyposis. Interestingly, they develop different tumor numbers. Apc{Delta}716 form ~300 polyps, whereas ApcMin and Apc1638N develop ~30 and ~3, respectively (68). In contrast, ApcneoR is a hypomorphic allele whose expression is attenuated to ~20% of the wild-type Apc allele (9, 10). Notably, heterozygous ApcneoR mice develop very small numbers of intestinal polyps. However, the molecular mechanism has not been investigated regarding the low polyp multiplicity. To determine the dosage effects of the Apc gene activity on suppression of intestinal tumorigenesis, we have constructed another hypomorphic Apc allele ApcneoF that expresses even lower level of APC than ApcneoR. By comparison of ApcneoF and ApcneoR heterozygotes with Apc{Delta}716 mice, we show that the amount of APC protein is inversely correlated with Wnt/ß-catenin transcriptional activity that seems to regulate polyp multiplicity.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Recombinant embryonic stem cells and animals. Recombinant embryonic stem (ES) cells (Apc+/neoF and ApcneoF/neoF) and ApcneoF mice were constructed as previously described (9). All Apc mutant strains were generated in ES cells of 129 strain, and backcrossed to C57BL/6 strain. Backcross generations were >30 for Apc{Delta}716, 11 for ApcneoR, and 8 for ApcneoF.

Western blotting and reporter assay. Western blotting for APC and ß-catenin, and ß-catenin/TCF reporter assay were done as described previously (9).

Northern blotting. Polyadenylated RNA was extracted from the mouse embryos and analyzed in 5 µg aliquots. Fragments of mouse Apc cDNA (nucleotides 33-920) and mouse glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA were used as probes.

Immunohistochemistry. Paraffin-embedded sections (4 µm thick) were prepared by a standard method. The ES cells attached to 0.2% gelatin coated glass chamber were fixed with 4% paraformaldehyde for 10 minutes. These specimens were incubated with the primary antibody for ß-catenin (1:500; Sigma, St. Louis, MO) or cyclooxygenase-2 (COX-2; 1:200; Cayman Chemical, Ann Arbor, MI) for 1 hour at room temperature. Activation of Akt was determined using an anti–phospho-Akt antibody (1:50; Cell Signaling, Beverly, MA) as described previously (11). Immunostaining signals were visualized using Vectastain Elite kit (Vector Laboratories, Burlingame, CA). To determine the cell proliferation rates, sections were stained with an anti–Ki-67 antibody (1:100, MIB-5; DAKOCytomation, Carpinteria, CA) as described previously (12). The labeling index for Ki-67 was calculated as the number of positive cells/5,000 tumor epithelial cells.

Scoring polyps and histologic preparations. The number of polyps was scored as described previously (6). Fixed specimens were stained with 0.5% methylene blue (Sigma-Aldrich, St. Louis, MO). For histologic analyses, formalin-fixed and paraffin-embedded sections were stained with H&E.

Loss of heterozygosity analysis of the Apc locus. Tumor DNA was isolated from paraffin sections and amplified by PCR as described previously (6). Primers used for the wild-type Apc allele were as follows: Apc-intron13-5' (GCCATACTTTAACACAAGCC) and Apc-intron13-3' (AAAGGCTGCATGAGAGCACTT). To detect the ApcneoF and ApcneoR alleles, primers PR1 (CAGACTGCCTTGGGAAAAGC) paired with Apc-intron13-3' and Apc-intron13-5' were used, respectively.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Generation of hypomorphic ApcneoF mice. We have recently generated ApcneoR (i.e., Apc+/neoR, where "R" stands for reverse orientation) mice by insertion of a PGK-neo cassette into intron 13 of Apc gene in the opposite orientation to that of transcription (Fig. 1A, bottom). In this mutant, the decrease in the Apc mRNA was likely caused by promoter attenuation due to the loxP-PGK-neo cassette inserted into an enhancer site in intron 13 (9). Here, we constructed ApcneoF (F for forward) allele with the same PGK-neo cassette inserted at the same site of Apc, but in the same orientation as that of transcription (Fig. 1A, top). After confirmation of homologous recombination in ES cells (Fig. 1B), we injected the clones into blastocysts and established germ line–transmitted mutant mice (Fig. 1C). The heterozygous Apc+/neoF mice (hereafter ApcneoF mice) were viable, although homozygous ApcneoF/neoF mice were embryonically lethal at ~9 days of gestation (data not shown). The homozygous and heterozygous ApcneoF embryos expressed Apc mRNA at ~10% and 55% levels of the wild-type, respectively (Fig. 1D), indicating that ApcneoF is a hypomorphic allele similar to ApcneoR.



View larger version (36K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Generation of hypomorphic ApcneoF mutant mice compared with that of ApcneoR. A, targeting strategy for ApcneoF (top, black) and ApcneoR (bottom, gray). Top, wild-type allele Apc+; middle, targeting vector; bottom, targeted allele. Filled boxes, exons; solid lines, intron sequences. The PGK-neo (neo) and PGK-DT (DT) cassettes are shown as open boxes with their transcriptional orientations (arrows). Triangles sandwiching exons 11 to 13 and the PGK-neo cassette indicate loxP sequences. Pairs of arrowheads, PCR primers; solid lines, Southern hybridization probe. The SacI fragments hybridizable to the probe are also shown (6.5 and 5.1 kb or 4.5 kb for the wild-type and targeted alleles, respectively). Sa,SacI sites. B, Southern hybridization of ApcneoF embryonic stem clone. Extracted DNA samples were digested with SacI and hybridized with the probe shown in (A). C, genomic PCR of the 8.5 dpc embryos from an intercross of heterozygous ApcneoF mice. Top, targeted allele; bottom, wild-type allele. Genotypes are indicated on top of the panels: +, wild-type; F, ApcneoF. D, Northern blotting of the Apc mRNA from the ApcneoF embryos. Genotypes are shown on top. Relative band intensities to the wild-type (+/+) are indicated at the bottom.

 
Intestinal polyps in ApcneoF and ApcneoR mice. Both ApcneoF and ApcneoR mutant strains developed intestinal polyps. However, their polyp multiplicities were much lower than that in the Apc{Delta}716 mice (i.e., Apc+/{Delta}716; Fig. 2A). Namely, the mean polyp numbers in ApcneoF and ApcneoR mice were 1.09 ± 0.85 and 0.26 ± 0.54 at 15 months of age, respectively, whereas about a hundred polyps were found in the Apc{Delta}716 mice at 3 months (Table 1). Moreover, the tumor incidence was 50% and 19% in the 15-month-old ApcneoF and ApcneoR mice, respectively (Table 1), whereas 100% of Apc{Delta}716 mice developed intestinal polyps at 7 weeks of age (6). Small microadenomas (<0.5 mm in diameter) that were frequently found in the Apc{Delta}716 mice under a dissecting microscope were rarely detected in ApcneoF and ApcneoR mice (Table 1; ref. 6).



View larger version (66K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Morphologic and immunohistochemical analyses of intestinal polyps. A, representative dissection micrographs of the ileum from Apc{Delta}716, ApcneoF, and ApcneoR mice (methylene blue staining). Arrowheads, polyps. Bar, 3 mm. B and C, histology of small intestinal polyps of ApcneoF and ApcneoR mice, respectively (H&E staining). Brackets indicate adenoma lesions. Bars, 40 µm. D to I, immunostaining for ß-catenin in polyps of Apc{Delta}716 (D, G), ApcneoF (E, H), and ApcneoR (F, I) mice, respectively. (G) to (I) are higher magnification of the boxed areas from (D) to (F), respectively. Arrows (H and I), ß-catenin–positive nuclei. Bars, 20 µm (D-F) and 100 µm (G-I). J to L, immunostaining for Ki-67 in polyps of Apc{Delta}716 (J), ApcneoF (K), and ApcneoR (L) mice. Bars, 50 µm. M to O, immunostaining for COX-2 in polyps of Apc{Delta}716 (M), ApcneoF (N), and ApcneoR (O) mice. Bars, 20 µm. P to R, immunostaining for phospho-Akt in polyps of Apc{Delta}716 (P), ApcneoF (Q), and ApcneoR (R) mice. Bars, 30 µm. S, Ki-67 labeling index for polyps of Apc{Delta}716, ApcneoF, and ApcneoR mice. Columns, mean; bars, SD.

 

View this table:
[in this window]
[in a new window]

 
Table 1. Small intestinal polyposis in ApcneoF and ApcneoR mice compared with that in Apc{Delta}716

 
ß-Catenin localization in polyps of respective Apc mutants. Histologically, polyps in both ApcneoF and ApcneoR mice consisted of dysplastic adenomas that were similar to those in Apc{Delta}716 mice (Fig. 2B and C). In the Apc{Delta}716 mouse polyps, ß-catenin was localized predominantly to nuclei of the adenoma epithelial cells, with some weak staining in the membrane (Fig. 2D and G). In the polyps of ApcneoF and ApcneoR mice, however, cells with nuclear ß-catenin were found only sparsely (Fig. 2E, F, H, and I). Accordingly, ß-catenin is less stabilized in the polyps of the ApcneoF and ApcneoR mice than in those of the Apc{Delta}716 mice. Importantly, proliferation of adenoma cells determined by Ki-67 labeling index was not much different among the polyps of the Apc{Delta}716, ApcneoF, and ApcneoR mice (Fig. 2J-L, and S). These results indicate that the nuclear ß-catenin localization is not necessarily correlated with adenoma cell proliferation.

We have previously shown that induction of COX-2 in the polyp stroma is critical for polyp formation (12, 13). In the polyps of ApcneoF and ApcneoR mice, expression of COX-2 was detected in the luminal side of polyp stroma like in the Apc{Delta}716 mice (Fig. 2M-O). We next examined activation of Akt by detection of its phosphorylated form because Akt is constitutively activated in stem cells where ß-catenin is accumulated in nuclei (11). Interestingly, we found phospho-Akt in cells of the entire adenoma in both ApcneoF and ApcneoR mouse polyps as in Apc{Delta}716 (Fig. 2P-R). Thus, induction of COX-2 pathway and activation of PI3K-Akt signaling are independent of ß-catenin translocation to nuclei of adenoma cells.

We next examined the Apc genotype of polyp tissues by genomic PCR. The wild-type Apc allele (Apc+) was lost in all polyps examined in both hypomorphic Apc mutants (Fig. 3A and B), suggesting that polyp initiation was triggered by Apc gene loss of heterozygosity (LOH) as in the Apc{Delta}716 mice (6). Because Apc LOH is caused by recombination at the centromeric rDNA cluster on mouse chromosome 18 (14), it is expected that all adenoma cells are in fact homozygous for the mutant Apc alleles (i.e., ApcneoF/neoF and ApcneoR/neoR, respectively). These results are consistent with the interpretation that Wnt signaling activation is necessary for the polyp initiation to a level higher than that caused by Apc+/{Delta}716 heterozygosity itself (see below).



View larger version (37K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Inverse correlation between the APC level and Wnt/ß-catenin transcriptional activity. A and B, Apc LOH in ApcneoF (A) and ApcneoR (B) polyps analyzed for the adenoma (T) compared with normal intestine (N). WT, wild-type allele; KO, knockout alleles. Western blotting for APC (C) and ß-catenin (D) in the intestines of ApcneoR (top), ApcneoF (middle), and Apc{Delta}716 (bottom). Representative results are shown of normal intestinal tissues (N1 and N2) and polyp samples (T1 and T2) of mutant mice, compared with wild-type littermate tissues (C1 and C2). E and F, Western blot analyses of APC and ß-catenin in the wild-type (+/+) and homozygous ApcneoR (R/R), ApcneoF (F/F), and Apc{Delta}716 ({Delta}/{Delta}) ES cells. Quantified band intensities are also shown. G to J, immunostaining for ß-catenin in wild-type (G) and homozygous ApcneoR (H), ApcneoF (I), and Apc{Delta}716 (J) ES cells. Bars, 10 µm. K, percentage of ES cells with nuclear ß-catenin localization. Columns, mean; bars, SD. L, luciferase reporter assays for ß-catenin/TCF transcription in the homozygous ApcneoR (R/R), ApcneoF (F/F), and Apc{Delta}716 ({Delta}/{Delta}) ES cells as well as in the wild-type (+/+). Three independent clones were used. Luciferase activity of the TOPFLASH or FOPFLASH reporter calibrated to the activity of LacZ (lower axis) is shown for each ES line in triplicate transfections. The upper axis indicates the TOPFLASH/FOPFLASH ratios for the respective ES cell lines. M, correlation of the APC protein level and polyp numbers. The threshold of APC level required for formation of one polyp per mouse is estimated to be ~15%.

 
Adenomatous polyposis coli protein levels and ß-catenin accumulation in Apc mutant polyps. We next determined the APC protein levels in the polyps by Western blotting. The relative amounts of APC in the normal (i.e., nonpolyp) small intestine in the ApcneoR, ApcneoF, and Apc{Delta}716 mice were 75%, 65%, and 50% of the wild-type level, respectively (Fig. 3C). The slightly lower APC level in the ApcneoF than ApcneoR may have been caused by the insertional orientation of the PGK-neo cassette. Notably, we found faint bands for full-length APC in the polyps of ApcneoR and ApcneoF mice, whereas none in the Apc{Delta}716 polyps (Fig. 3C). In contrast, the ß-catenin level was much higher in the polyps of Apc{Delta}716 mice than ApcneoF or ApcneoR (Fig. 3D). These results indicate that the level of stabilized ß-catenin is inversely correlated with the residual amount of wild-type APC.

Molecular basis of polyp multiplicity difference among Apc mutants. To determine the transcriptional activities by ß-catenin/TCF complex in the respective Apc mutants in vitro, we generated homozygous ES cell lines for ApcneoR, ApcneoF, and Apc{Delta}716 alleles. The APC levels in the homozygous ApcneoR and ApcneoF ES cells were 20% and 10% of that in the Apc+/+ ES cells, respectively, whereas no APC protein was detected in the homozygous Apc{Delta}716 ES cells (Fig. 3E). Furthermore, the ß-catenin levels in the homozygous ApcneoR, ApcneoF, and Apc{Delta}716 ES cells were inversely correlated with the APC levels; ~2.1, 3.1, and 12 times of that in the wild type, respectively (Fig. 3F). Accumulation of ß-catenin in the ApcneoR and ApcneoF cells was milder than that in the Apc{Delta}716 cells (Fig. 3G-J). Consistently, the nuclear staining index for ß-catenin was significantly lower in the ApcneoR and ApcneoF cells than that in Apc{Delta}716 (Fig. 3K). Moreover, homozygous Apc{Delta}716 ES cells showed the highest transcriptional activity by ß-catenin/TCF complex, followed by ApcneoF and ApcneoR with 41, 14, and 6.2 times of the wild-type level, respectively (Fig. 3L). These results, taken together, indicate that Wnt signaling activity is inversely and quantitatively correlated with the APC level both in vivo and in vitro.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have shown here that the intestinal polyp multiplicity is inversely correlated with the APC level, mediated by the strength of Wnt/ß-catenin signaling. Namely, the more reduced levels of APC lead to the stronger activation of Wnt/ß-catenin signaling, resulting in the higher polyp numbers. Based on the present results, we propose an "expression dosage" model that explains different intestinal polyp multiplicity among the respective Apc mutant alleles. The threshold level of APC that produces one intestinal polyp per mouse is ~15% of the wild type (Fig. 3M). Consistent with these results, it has been suggested that predisposition to human colon polyposis is dependent on the reduced level of APC expression. Approximately 25% decrease in APC expression, which causes ~75% reduction by further APC LOH, may predispose to FAP (4). Likewise, Wnt/ß-catenin signaling controls ES cell differentiation and intestinal tumorigenesis in a quantitative manner at various levels of the pathway (10, 15, 16).

The attenuated form of FAP (AAPC) is characterized by smaller polyp number and delayed age of onset than the common form, and phenotypically similar to the ApcneoF and ApcneoR mice. However, the molecular mechanisms seem to be different slightly between human AAPC and ApcneoF or ApcneoR mice. Germ line mutations in familial adenomatous polyposis suggest that there is a need for a third mutation because the inherited alleles are leaky or may express amino-terminally truncated proteins when the allele is mutated in the 5' region (17). The amino-terminal mutation is followed by reinitiation of the mRNA translation from an internal ribosomal entry site, resulting in reduced expression of nearly full-length functional APC (18, 19).

Although it has been suggested that some truncated APC proteins have dominant effects in tumorigenesis through chromosomal instability (20, 21), hypomorphic alleles ApcneoF or ApcneoR did not produce any truncated products (ref. 9 and data not shown). We have also shown that Apc{Delta}716 allele does not show any dominant effects in intestinal tumorigenesis when expressed in the intestines as a transgene (22).

We have reported recently that significantly decreased levels of APC and CDX2 proteins in the distal colon of the Apc{Delta}716 Cdx2+/– compound mutant mice cause numerous colonic adenomas due to an increased anaphase bridge index that caused Apc LOH (23). In contrast, the normal (nonpolyp) epithelium of Apc{Delta}716 small intestine showed similar anaphase bridge index to the wild type (data not shown). Accordingly, it is possible that frequencies of Apc LOH in the intestinal epithelium of the ApcneoF and ApcneoR mice are also similar to that in the wild type. Therefore, it is conceivable that the difference in the polyp multiplicity among the Apc{Delta}716, ApcneoF, and ApcneoR mice are caused by some events controlled by Wnt signaling after the polyp initiation. Despite the difference in the nuclear ß-catenin staining and Wnt transcriptional activation between Apc{Delta}716 and ApcneoF or ApcneoR polyps, the Ki-67 labeling index was similar among them (Fig. 2). Likewise, expression of COX-2 and the level of phospho-Akt were also similar (Fig. 2). Thus, it remains to be investigated what particular molecules are responsible for the difference in the polyp multiplicity.

In conclusion, we have determined the APC expression levels in relation to the intestinal polyp multiplicity and found that the polyp number is inversely correlated with the Wnt/ß-catenin transcriptional activity. We have estimated that one polyp is formed per mouse when APC protein level decreases to ~15% of that in the wild type. These results also suggest therapeutic implications concerning Wnt signaling inhibitors.


    Acknowledgments
 
Grant support: Ministry of Education, Culture, Sports, Science and Technology of Japan.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank A. Matsunaga, H. Takeda, K. Aoki, and H. Oshima for help and discussion.

Received 6/20/05. Revised 7/13/05. Accepted 8/ 5/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Sieber OM, Tomlinson IP, Lamlum H. The adenomatous polyposis coli (APC) tumor suppressor—genetics, function and disease. Mol Med Today 2000;6:462–9.[CrossRef][Medline]
  2. Giles RH, Van Es JH, Clevers H. Caught up in a Wnt storm: Wnt signaling in cancer. Biochim Biophys Acta 2003;1653:1–24.[Medline]
  3. Powell SM, Zilz N, Beazer-Barclay Y, et al. APC mutations occur early during colorectal tumorigenesis. Nature 1992;359:235–7.[CrossRef][Medline]
  4. Yan H, Dobbie Z, Gruber SB, et al. Small changes in expression affect predisposition to tumorigenesis. Nat Genet 2002;30:25–6.[CrossRef][Medline]
  5. Laken SJ, Papadopoulos N, Petersen GM, et al. Analysis of masked mutations in familial adenomatous polyposis. Proc Natl Acad Sci U S A 1999;96:2322–6.[Abstract/Free Full Text]
  6. Oshima M, Oshima H, Kitagawa K, Kobayashi M, Itakura I, Taketo M. Loss of Apc heterozygosity and abnormal tissue building in nascent intestinal polyps in mice carrying a truncated Apc gene. Proc Natl Acad Sci U S A 1995;92:4482–6.[Abstract/Free Full Text]
  7. Moser AR, Pitot HC, Dove WF. A dominant mutation that predisposes to multiple intestinal neoplasia in the mouse. Science 1990;247:322–4.[Abstract/Free Full Text]
  8. Fodde R, Edelmann W, Yang K, et al. A targeted chain-termination mutation in the mouse Apc gene results in multiple intestinal tumors. Proc Natl Acad Sci U S A 1994;91:8969–73.[Abstract/Free Full Text]
  9. Ishikawa TO, Tamai Y, Li Q, Oshima M, Taketo MM. Requirement for tumor suppressor Apc in the morphogenesis of anterior and ventral mouse embryo. Dev Biol 2003;253:230–46.[CrossRef][Medline]
  10. Kielman MF, Rindapaa M, Gaspar C, et al. Apc modulates embryonic stem-cell differentiation by controlling the dosage of ß-catenin signaling. Nat Genet 2002;32:594–605.[CrossRef][Medline]
  11. He XC, Zhang J, Tong WG, et al. BMP signaling inhibits intestinal stem cell self-renewal through suppression of Wnt-ß-catenin signaling. Nat Genet 2004;36:1117–21.[CrossRef][Medline]
  12. Takeda H, Sonoshita M, Oshima H, et al. Cooperation of cyclooxygenase 1 and cyclooxygenase 2 in intestinal polyposis. Cancer Res 2003;63:4872–7.[Abstract/Free Full Text]
  13. Oshima M, Dinchuk JE, Kargman SL, et al. Suppression of intestinal polyposis in Apc{Delta}716 knockout mice by inhibition of cyclooxygenase 2 (COX-2). Cell 1996;87:803–9.[CrossRef][Medline]
  14. Haigis KM, Dove WF. A Robertsonian translocation suppresses a somatic recombinant pathway to loss of heterozygosity. Nat Genet 2003;33:33–9.[CrossRef][Medline]
  15. Taketo MM. Shutting down Wnt signal-activated cancer. Nat Genet 2004;36:320–2.[CrossRef][Medline]
  16. Suzuki H, Watkins DN, Jair KW, et al. Epigenetic inactivation of SFRP genes allows constitutive WNT signaling in colorectal cancer. Nat Genet 2004;36:417–22.[CrossRef][Medline]
  17. Spirio L, Samowitz W, Robertson J, et al. Alleles of APC modulate the frequency and classes of mutations that lead to colon polyps. Nat Genet 1998;20:385–8.[CrossRef][Medline]
  18. Spirio L, Olschwang S, Groden J, et al. Alleles of the APC gene: an attenuated form of familial polyposis. Cell 1993;75:951–7.[CrossRef][Medline]
  19. Heppner Goss KH, Trzepacz C, et al. Attenuated APC alleles produce functional protein from internal translation initiation. Proc Natl Acad Sci U S A 2002;11:8161–6.
  20. Fodde R, Kujpers J, Roseberg C, et al. Mutations in the APC tumour suppressor gene cause chromosomal instability. Nat Cell Biol 2001;3:433–8.[CrossRef][Medline]
  21. Kaplan KB, Burds AA, Swedlow JR, et al. A role for the adenomatous polyposis coli protein in chromosome segregation. Nat Cell Biol 2001;3:429–32.[CrossRef][Medline]
  22. Oshima M, Oshima H, Kobayashi M, et al. Evidence against dominant negative mechanisms of intestinal polyp formation by Apc gene mutations. Cancer Res 1995;55:2719–22.[Abstract/Free Full Text]
  23. Aoki K, Tamai Y, Horiike S, et al. Colonic polyposis caused by mTOR-mediated chromosomal instability in Apc+/{Delta}716Cdx2+/– compound mutant mice. Nat Genet 2003;35:323–30.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
U. Dougherty, D. Cerasi, I. Taylor, M. Kocherginsky, U. Tekin, S. Badal, L. Aluri, A. Sehdev, S. Cerda, R. Mustafi, et al.
Epidermal Growth Factor Receptor Is Required for Colonic Tumor Promotion by Dietary Fat in the Azoxymethane/Dextran Sulfate Sodium Model: Roles of Transforming Growth Factor-{alpha} and PTGS2
Clin. Cancer Res., November 15, 2009; 15(22): 6780 - 6789.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. Yang, N. Kurihara, K. Fan, H. Newmark, B. Rigas, L. Bancroft, G. Corner, E. Livote, M. Lesser, W. Edelmann, et al.
Dietary Induction of Colonic Tumors in a Mouse Model of Sporadic Colon Cancer
Cancer Res., October 1, 2008; 68(19): 7803 - 7810.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
J. Schneikert and J. Behrens
The canonical Wnt signalling pathway and its APC partner in colon cancer development
Gut, March 1, 2007; 56(3): 417 - 425.
[Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
P. Bjorklund, G. Akerstrom, and G. Westin
Accumulation of Nonphosphorylated {beta}-Catenin and c-myc in Primary and Uremic Secondary Hyperparathyroid Tumors
J. Clin. Endocrinol. Metab., January 1, 2007; 92(1): 338 - 344.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, Q.
Right arrow Articles by Taketo, M. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, Q.
Right arrow Articles by Taketo, M. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online