| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell and Tumor Biology |
1 Department of Medical Oncology, Dana-Farber Cancer Institute; 2 Department of Medicine; Brigham and Women's Hospital; Departments of 3 Medicine and 4 Pathology, Harvard Medical School, Boston, MA; and 5 The Broad Institute at MIT and Harvard, Cambridge, Massachusetts
Requests for reprints: Jingrui Jiang, Dana-Farber Cancer Institute, 44 Binney Street, Mayer 534, Boston, MA 02115. Phone: 617-632-3575; Fax: 617-632-4388; E-mail: jingrui_jiang{at}dfci.harvard.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The first EGFR somatic mutation characterized was an 801-bp in-frame deletion of the exons 2 to 7 within the extracellular ligand-binding domain of wild-type EGFR, known as EGFRvIII (46). It has been shown that expression of EGFRvIII leads to a ligand-independent, constitutive activity (68) and can induce tumors in a murine glioma model (9).
Recently, somatic mutations in the kinase domain of EGFR have been discovered in lung adenocarcinomas (1012). The finding that overexpression and mutations of EGFR occurred in many types of human cancer make EGFR a promising target for anticancer therapy. The specific inhibitors, including gefitinib and erlotinib, which compete with ATP for binding to the kinase domain of EGFR, have been approved for clinical use in nonsmall cell lung cancer (13). The dramatic responses to gefitinib and erlotinib of lung adenocarcinomas harboring EGFR mutations (1012), as well as the finding that secondary mutations in the EGFR kinase domain cause resistance to gefitinib (14, 15), indicate that mutated EGFR appears to be their major target. The antiproliferative or apoptotic effects (1618) of gefitinib have been documented, although the mechanism of its action remained largely unknown, especially in the cells harboring mutations of EGFR.
The major signaling cascades induced by ligand-activated wild-type EGFR include mitogen-activated protein kinase (MAPK) pathways, signal transducers and activators of transcription (STAT) pathways, and the phosphatidylinositol 3-kinase (PI3K) pathway (reviewed in ref. 19). MAPK pathways can be activated in a Ras/Raf-dependent or Ras/Raf-independent manner, converging on extracellular signal-regulated kinase (ERK1/2) and ERK5. STAT activation seems dependent on EGFR tyrosine kinase activity (2022), whereas PI3K activity leads to phosphorylation and activation of the AKT kinase (23). Studies of cells expressing EGFR mutations in the kinase domain revealed phosphorylation of STAT5 and AKT (16) and Src homology and collagen (Shc; ref. 18). NIH-3T3 cells can be transformed by mutant EGFRs, leading to activation of Shc and STAT3.6
The growth of the murine bone marrowderived cell line, Ba/F3, is dependent on the growth factor interleukin-3 (IL-3) but is rendered IL-3 independent by several tyrosine kinase oncogenes, including BCR/ABL (24), FLT3 (25), and TEL/platelet-derived growth factor receptor ß (26). For such oncogenes, induction of factor independence of Ba/F3 cells has been closely associated with transforming activity in vitro and in vivo (27).
In this study, we characterized Ba/F3 cells expressing two missense mutations in the kinase domain of EGFR, EGFR-L858R and EGFR-G719S, and showed that these mutants transformed Ba/F3 cells to factor independence in the absence of exogenous EGF. Our results provide conclusive evidence of constitutive activation of these mutant receptors and provide a model system to study the effects of EGFR inhibitors and downstream targets. Strikingly, we find a difference in response to gefitinib between the two mutants and show that gefitinib acts by inhibiting cell cycle progression in these cells. This system should prove useful for further studies of EGFR inhibitor action.
| Materials and Methods |
|---|
|
|
|---|
Generation of EGFR-L858R and EGFR-G719S containing expression vectors and transfection into Ba/F3 cells. Full-length cDNAs of EGFR containing L858R and G719S mutations were generated by mutagenesis using QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) following the manufacturer's instruction with mutagenesis primers AAGATCACAGATTTTGGGAGGGCCAAACTGCTGGGTG and CACCCAGCAGTTTGGCCCTCCCAAAATCTGTGATCTT. The mutated full-length EGFR cDNAs were confirmed by sequencing. The cDNAs of EGFR-L858R, EGFR-G719S or wild-type EGFR was then subsequently cloned into the MCS site between XhoI and NheI of the pClneo mammalian expression vector (Promega, Madison, WI) driven by pCMV I.E enhancer/promoter. The putative pClneo/EGFR-wt, EGFR-L858R, or EGFR-G719S expression constructs were confirmed by both restriction digestion and sequencing.
The pClneo expression vector containing full-length wild-type EGFR, EGFR-L858R, or EGFRG719S were then introduced into the murine growth factordependent Ba/F3 cells by electroporation, respectively. The transfected cells were first selected in 800 mg/mL of G418. The G418-resistant cells were then subjected to the second round selection by growing in the medium without IL-3. Stable polyclonal cell lines and monoclonal cell lines were selected and used for further study.
Cell culture. Ba/F3 cells were cultured in RPMI 1640 (Mediatech, Inc., Herndon, VA) with 10% FCS, 10% WEHI3B conditional medium (as a source of IL-3), 100 units/mL penicillin and 100 mg/mL streptomycin, and 1% glutamine. Ba/F3-EGFR-L858R and Ba/F3-EGFR-G719S cells were maintained in the culture medium as its parental Ba/F3 cells, except without IL-3, but with 800 mg/mL G418; Ba/F3-EGFR wild-type cells were cultured in the medium with IL-3 and 800 mg/mL G418. All the cells were maintained in a humidified incubator at 37°C with 5% CO2.
Western blotting analysis. Cells were collected and washed once in cold PBS and then lysed in NP40 buffer [50 mmol/L Tris (pH 8.0), 150 mmol/L NaCl, 1.0% NP40, and 1x Protein Inhibitor Cocktail Set I (Calbiochem, San Diego, CA)]. After incubation in ice for 30 minutes, the lysates were centrifuged at 14,000 x g for 15 minutes, and the supernatant was transferred into a new tube. The protein concentration of the supernatant was detected by the Bio-Rad protein assay kit (Richmond, CA) and equivalent amount of proteins were loaded into SDS-PAGE gel and electrophoretically transferred to Immobilon-P membranes (Millipore, Danvers, VA), which was then subjected to Western blotting analysis using the specific antibodies indicated.
Immunoprecipitation and immunoblotting. Immunoprecipitations were done using 1,000 to 1,500 mg of total protein as starting materials following a protocol suggested by Santa Cruz Biotechnology. Briefly, the reaction volumes were equalized using NP40 lysis buffer. The samples were precleared with control IgG followed by incubation with primary antibody and corresponding protein-agarose. At the end of the incubation, the beads were washed four times with TNN buffer [40 mmol/L Tris-HCl (pH 8.0), 10 mmol/L NaCl, 0.5 % NP40]. After the final washing, the pelleted beads were resuspended in 1x Laemmli sample buffer and the supernatant was subjected to Western blotting analysis following the standard procedures.
Fluorescence-activated cell sorting analysis. Cells were collected and fixed in 40% ethanol for at least 1 hour (or until ready for the experiment) at 4°C. The fixed cells were treated with 0.5 mL of 500 mg/mL RNase A for 45 minutes at 37°C and stained with 69 mmol/L propidium iodide (in 38 mM sodium citrate) for at least 30 minutes at room temperature in the dark. The stained cells were then analyzed for DNA content in a Becton Dickinson fluorescence-activated cell sorter using both ModFit (Verity Software House, Topsham, ME) and CellQuest (Becton Dickinson, San Jose, CA) programs.
| Results |
|---|
|
|
|---|
|
These results indicated that the L858R and G719S mutations of EGFRs have transforming potential and that these mutated receptors are constitutively autophosphorylated.
Differential growth inhibition of epidermal growth factor receptor mutant-expressing Ba/F3 cells by gefitinib. We next examined the effects of two EGFR-specific inhibitors, AG1478 and gefitinib, on the growth of Ba/F3-EGFR-L858R and Ba/F3-EGFR-G719S cells. Figure 2A shows that both drugs could inhibit the growth of Ba/F3 cells expressing either mutation in the absence of IL-3; whereas in the presence of IL-3, the cells were still able to proliferate at concentrations as high as 300 nmol/L for either drug. The EGFR inhibitors did not inhibit the growth of FLT3-N841I-transformed Ba/F3 cells (25) in both the presence and absence of IL-3 at concentrations up to 3,000 nmol/L.
|
To examine the effect of gefitinib on mutant EGFR kinase activity, we used receptor autophosphorylation as a marker. Figure 2B shows that in the presence or absence of IL-3, gefitinib was able to reduce the autophosphorylation levels of mutant EGFRs in a dose-dependent manner, which indicates that in the absence of IL-3, the growth inhibition observed in Fig. 2A is due to the inhibition of the mutant receptors; whereas in the presence of IL-3, the growth of the host cells was not controlled by the mutant receptors. The reason that inhibition of autophosphorylation of EGFR-G719S by gefitinib seems more effective in the presence of IL-3 is currently unknown. Figure 2B also shows that, in the absence of IL-3, the inhibition of autophosphorylation of EGFR-G719S required higher concentration of gefitinib compared with that of EGFR-L858R, indicating that the differential growth inhibition seen in Fig. 2A may be due to differential inactivation of the mutant receptors.
Constitutive activation of downstream pathways by the mutated epidermal growth factor receptors in Ba/F3 cells. To explore the downstream targets of EGFR-G719S and EGFR-L858R, the phosphorylation of several known effectors of the EGFR signaling pathways were analyzed. For cells expressing the EGFR mutants, STAT5, ERK1/2, AKT, and ERK5, are all phosphorylated in the absence of IL-3, without exogenous EGF stimulation (Fig. 3A, lanes 1 and 7). Gefitinib was able to reduce the phosphorylation of each of these downstream effectors (Fig. 3A, lanes 2, 3, 8, and 9); whereas pAkt was still detectable at the highest gefitinib dose, the levels were clearly reduced. In contrast, the activation of these downstream effectors by FLT3-N841I was not affected by gefitinib (Fig. 3A, lanes 13 and 14). IL-3 treatment of cells transfected with vector alone led to the phosphorylation of STAT5 but not the other EGFR effectors (Fig. 3A, lanes 17 and 18). Correspondingly, in IL-3-supplemented cells expressing EGFR mutants, STAT5 phosphorylation becomes resistant to gefitinib, whereas the other downstream effectors remain sensitive (Fig. 3A, lanes 4-6, 10-12). This result indicates that the phosphorylation of STAT5 in the presence of IL-3 was not controlled by the mutated EGFRs but by other pathways, probably through IL-3 pathway, because IL-3 is a strong activator of STAT5 (31, 32).
|
Epidermal growth factormediated signaling in wild-type and mutated epidermal growth factor receptorexpressing cells. Given the constitutive activation of the mutant EGFRs, we wished to determine whether the signaling pathways downstream of the wild-type receptor could be activated by EGF in Ba/F3 cells and whether the mutant receptors could be superactivated by addition of exogenous EGF. We first examined the response of wild-type EGFR to EGF stimulation. Upon EGF stimulation, wild-type EGFR was autophosphorylated, which could be blocked by gefitinib as examined by either immunoblotting (Fig. 4A) or immunoprecipitation/immunoblot analysis (data not shown). Furthermore, EGF was able to induce phosphorylations of STAT5, ERK1/2, AKT, and ERK5 in wild-type EGFR-expressing Ba/F3 cells (Fig. 4A, lanes 5-7). As for EGF-mediated receptor autophosphorylation, gefitinib inhibited phosphorylation of these kinases, indicating that they are downstream targets of the EGF-activated wild-type EGFR (Fig. 4A, lanes 6 and 7). These results indicate that the EGF-mediated major signaling pathways of wild-type EGFR found in other systems are all intact in Ba/F3 cell systems.
|
Antiproliferative effects of gefitinib on Ba/F3 cells expressing mutated epidermal growth factor receptors. Dependent on the genetic and physiologic background of the host cells, gefitinib could have either a proapoptotic effect or an antiproliferative effect (33). To examine the cell cycle effect of gefitinib, the EGFR-L858R- and EGFR-G719S-expressing Ba/F3 cells were treated with 0.1 µmol/L (for EGFR-L858R cells) or 0.5 µmol/L (for EGFR-G719S cells) of the drug, and at the time point indicated, the cells were collected for both protein extraction and fluorescence-activated cell sorting analysis. Figure 5A shows that gefitinib induced G1 cell cycle arrest in the G719S and L858R cells starting as early as 12 hours. After 72 hours of treatment, most of the cells were blocked in the G1 phase, indicating an antiproliferative effect of gefitinib on the cells.
|
| Discussion |
|---|
|
|
|---|
Ba/F3 cells are especially suitable for studies of mutant EGFR activation, as these cells do not express endogenous EGFR or other members of the ErbB family (28, 29). In particular, the use of this system has allowed the identification of the ligand-independent activation of EGFR induced by single missense point mutations in the kinase domain. Transformation and ligand-independent activation by mutant EGFR have also been observed in NIH-3T3 cells.6
The specific transforming potential of mutant EGFRs relative to wild-type EGFR was apparent even at early stages of selection. In contrast to Ba/F3 cells expressing EGFRL858R or EGFR-G719S, which survived and started to proliferate in the absence of IL-3, cells expressing wild-type EGFR failed to grow and died out eventually, despite similar expression levels of mutant and wild-type EGFR at this early stage.
Whereas L858R and G719S mutations both conferred ligand-independent activation to EGFR, their sensitivities to gefitinib are different. L858R is almost 10-fold more sensitive to the drug. Such difference in sensitivity may be due to the fact that G719S is located in the ATP binding loop (p-loop) and gefitinib is a competitor of ATP. Due to its small side chain that could fit into niches where no other amino acid could fit in, glycine plays a unique role in the conformation of many proteins. Changing from glycine to serine may disrupt the local fine structure and induce a less favorable conformation for gefitinib to bind.
The antiproliferative and proapoptotic effects of gefitinib in a wide range of tumors have been well documented (3436). Its antiproliferative effect has been reported as due to G1 cell cycle arrest via up-regulation of p27 (37, 38) and down-regulation of D-type cyclins and CDK4/6 (38). Whereas the proapoptotic effect of gefitinib has been noticed (16, 17), its antiproliferative effect on cells expressing mutant EGFRs has not been reported. Our finding that in EGFR-L858R- and EGFR-G719S-expressing Ba/F3 cells gefitinib induced G1 cell cycle arrest, preceded by down-regulation of D-type cyclins and CDK4, adds a new role and potential new mechanism for gefitinib action.
The antiproliferative versus proapoptotic activity of gefitinib in different systems may depend on the genetic background and physiologic conditions of host cells. In our hand, when used at a concentration 5 to 10 times the IC50, gefitinib induced a G1 cell cycle arrest, but no apoptotic cells were detected for over 72 hours for both mutated receptors, whereas in lung cancer cell lines harboring L858R mutation gefitinib induced apoptosis (16, 17). It will be interesting to find out whether higher concentrations of gefitinib could induce apoptosis in Ba/F3 cells. A comparison of signaling pathways in EGFR mutant-expressing Ba/F3 cells and in lung carcinoma cells harboring the EGFR-L858R mutation may aid in dissecting antiproliferative effects from proapoptotic effects of gefitinib, an important issue when the drug is used in combination with chemotherapy (33).
| Acknowledgments |
|---|
We thank Drs. Geoffrey Shapiro and Blanca Scheijen at the Dana-Farber Cancer Institute for the antibodies against cell cycle regulators for prescreening and Laura Prickett and Kathryn Folz-Donahue at the Dana-Farber Cancer Institute for the cell cycle analysis.
| Footnotes |
|---|
Received 5/26/05. Revised 7/12/05. Accepted 7/21/05.
| References |
|---|
|
|
|---|
, heparin-binding epidermal growth factor-like factor, and amphiregulin to Neu, ErbB-3, and ErbB-4. J Biol Chem 1996;271:2004752.This article has been cited by other articles:
![]() |
U. Guha, R. Chaerkady, A. Marimuthu, A. S. Patterson, M. K. Kashyap, H. C. Harsha, M. Sato, J. S. Bader, A. E. Lash, J. D. Minna, et al. Comparisons of tyrosine phosphorylated proteins in cells expressing lung cancer-specific alleles of EGFR and KRAS PNAS, September 16, 2008; 105(37): 14112 - 14117. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. W. Bell, B. W. Brannigan, K. Matsuo, D. M. Finkelstein, R. Sordella, J. Settleman, T. Mitsudomi, and D. A. Haber Increased Prevalence of EGFR-Mutant Lung Cancer in Women and in East Asian Populations: Analysis of Estrogen-Related Polymorphisms Clin. Cancer Res., July 1, 2008; 14(13): 4079 - 4084. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kumar, E. T. Petri, B. Halmos, and T. J. Boggon Structure and Clinical Relevance of the Epidermal Growth Factor Receptor in Human Cancer J. Clin. Oncol., April 1, 2008; 26(10): 1742 - 1751. [Abstract] [Full Text] [PDF] |
||||
![]() |
G D Smith, B E Chadwick, C Willmore-Payne, and J S Bentz Detection of epidermal growth factor receptor gene mutations in cytology specimens from patients with non-small cell lung cancer utilising high-resolution melting amplicon analysis J. Clin. Pathol., April 1, 2008; 61(4): 487 - 493. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-P. Kim, S.-W. Han, S.-H. Kim, S.-A. Im, D.-Y. Oh, Y.-J. Bang, and T.-Y. Kim Combined lapatinib and cetuximab enhance cytotoxicity against gefitinib-resistant lung cancer cells Mol. Cancer Ther., March 1, 2008; 7(3): 607 - 615. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Deng, T. Shimamura, S. Perera, N. E. Carlson, D. Cai, G. I. Shapiro, K.-K. Wong, and A. Letai Proapoptotic BH3-Only BCL-2 Family Protein BIM Connects Death Signaling from Epidermal Growth Factor Receptor Inhibition to the Mitochondrion Cancer Res., December 15, 2007; 67(24): 11867 - 11875. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Engelman, K. Zejnullahu, C.-M. Gale, E. Lifshits, A. J. Gonzales, T. Shimamura, F. Zhao, P. W. Vincent, G. N. Naumov, J. E. Bradner, et al. PF00299804, an Irreversible Pan-ERBB Inhibitor, Is Effective in Lung Cancer Models with EGFR and ERBB2 Mutations that Are Resistant to Gefitinib Cancer Res., December 15, 2007; 67(24): 11924 - 11932. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Godin-Heymann, I. Bryant, M. N. Rivera, L. Ulkus, D. W. Bell, D. J. Riese II, J. Settleman, and D. A. Haber Oncogenic Activity of Epidermal Growth Factor Receptor Kinase Mutant Alleles Is Enhanced by the T790M Drug Resistance Mutation Cancer Res., August 1, 2007; 67(15): 7319 - 7326. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Mulloy, A. Ferrand, Y. Kim, R. Sordella, D. W. Bell, D. A. Haber, K. S. Anderson, and J. Settleman Epidermal Growth Factor Receptor Mutants from Human Lung Cancers Exhibit Enhanced Catalytic Activity and Increased Sensitivity to Gefitinib Cancer Res., March 1, 2007; 67(5): 2325 - 2330. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. V. Sequist, D. W. Bell, T. J. Lynch, and D. A. Haber Molecular Predictors of Response to Epidermal Growth Factor Receptor Antagonists in Non-Small-Cell Lung Cancer J. Clin. Oncol., February 10, 2007; 25(5): 587 - 595. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. H. Schiffer, E. C. Reding, S. R. Fuhs, Q. Lu, F. Piu, S. Wong, P.-L. H. Littler, D. M. Weiner, W. Keefe, P. K. Tan, et al. Pharmacology and Signaling Properties of Epidermal Growth Factor Receptor Isoforms Studied by Bioluminescence Resonance Energy Transfer Mol. Pharmacol., February 1, 2007; 71(2): 508 - 518. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. N. Balak, Y. Gong, G. J. Riely, R. Somwar, A. R. Li, M. F. Zakowski, A. Chiang, G. Yang, O. Ouerfelli, M. G. Kris, et al. Novel D761Y and Common Secondary T790M Mutations in Epidermal Growth Factor Receptor-Mutant Lung Adenocarcinomas with Acquired Resistance to Kinase Inhibitors. Clin. Cancer Res., November 1, 2006; 12(21): 6494 - 6501. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. D. Carey, A. J. Garton, M. S. Romero, J. Kahler, S. Thomson, S. Ross, F. Park, J. D. Haley, N. Gibson, and M. X. Sliwkowski Kinetic Analysis of Epidermal Growth Factor Receptor Somatic Mutant Proteins Shows Increased Sensitivity to the Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitor, Erlotinib Cancer Res., August 15, 2006; 66(16): 8163 - 8171. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yatabe, T. Hida, Y. Horio, T. Kosaka, T. Takahashi, and T. Mitsudomi A Rapid, Sensitive Assay to Detect EGFR Mutation in Small Biopsy Specimens from Lung Cancer J. Mol. Diagn., July 1, 2006; 8(3): 335 - 341. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Shimamura, H. Ji, Y. Minami, R. K. Thomas, A. M. Lowell, K. Shah, H. Greulich, K. A. Glatt, M. Meyerson, G. I. Shapiro, et al. Non-Small-Cell Lung Cancer and Ba/F3 Transformed Cells Harboring the ERBB2 G776insV_G/C Mutation Are Sensitive to the Dual-Specific Epidermal Growth Factor Receptor and ERBB2 Inhibitor HKI-272. Cancer Res., July 1, 2006; 66(13): 6487 - 6491. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Politi, M. F. Zakowski, P.-D. Fan, E. A. Schonfeld, W. Pao, and H. E. Varmus Lung adenocarcinomas induced in mice by mutant EGF receptors found in human lung cancers respond to a tyrosine kinase inhibitor or to down-regulation of the receptors Genes & Dev., June 1, 2006; 20(11): 1496 - 1510. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ji, X. Zhao, Y. Yuza, T. Shimamura, D. Li, A. Protopopov, B. L. Jung, K. McNamara, H. Xia, K. A. Glatt, et al. Epidermal growth factor receptor variant III mutations in lung tumorigenesis and sensitivity to tyrosine kinase inhibitors PNAS, May 16, 2006; 103(20): 7817 - 7822. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH |