Cancer Research Prevention Award  Advances in Breast Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jiang, J.
Right arrow Articles by Griffin, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jiang, J.
Right arrow Articles by Griffin, J. D.
[Cancer Research 65, 8968-8974, October 1, 2005]
© 2005 American Association for Cancer Research


Cell and Tumor Biology

Epidermal Growth Factor–Independent Transformation of Ba/F3 Cells with Cancer-Derived Epidermal Growth Factor Receptor Mutants Induces Gefitinib-Sensitive Cell Cycle Progression

Jingrui Jiang1,3, Heidi Greulich1,3,5, Pasi A. Jänne1,2, William R. Sellers1,2,3,5, Matthew Meyerson1,4,5 and James D. Griffin1,2,3

1 Department of Medical Oncology, Dana-Farber Cancer Institute; 2 Department of Medicine; Brigham and Women's Hospital; Departments of 3 Medicine and 4 Pathology, Harvard Medical School, Boston, MA; and 5 The Broad Institute at MIT and Harvard, Cambridge, Massachusetts

Requests for reprints: Jingrui Jiang, Dana-Farber Cancer Institute, 44 Binney Street, Mayer 534, Boston, MA 02115. Phone: 617-632-3575; Fax: 617-632-4388; E-mail: jingrui_jiang{at}dfci.harvard.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Epidermal growth factor receptor (EGFR) plays critical roles in many biological processes and in tumorigenesis. Here, we show that two mutated EGFRs found in lung and other malignancies, EGFR-G719S and EGFR-L858R, could transform Ba/F3 cells to interleukin-3 (IL-3)–independent growth, in a ligand-independent manner, an activity associated with the transforming function of other mutated tyrosine kinases. The mutated receptors are autophosphorylated in the absence of IL-3 without EGF stimulation, and their expression led to the constitutive activation of signal transducers and activators of transcription 5, extracellular signal-regulated kinase 1/2 (ERK1/2), ERK5, and AKT. In wild-type EGFR-expressing Ba/F3 cells, the major EGF-mediated signaling pathways were still intact. Gefitinib inhibited the growth of mutant EGFR-transformed Ba/F3 cells. Strikingly, the gefitinib sensitivity of cells expressing the L858R mutant was significantly greater than that of cells expressing the G719S mutant form, suggesting that distinct EGFR mutations may be differentially sensitive to small-molecule inhibitors. Furthermore, our data showed an antiproliferative effect of gefitinib on the EGFR-transformed Ba/F3 cells. Our results provide a model system to study the function of mutated EGFR and the differential effects of pharmacologic EGFR inhibition on the distinct mutant forms of this tyrosine kinase.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Epidermal growth factor receptor (EGFR, HER1, and c-erbB1) is a membrane-bound glycoprotein and belongs to the HER/ERBB growth factor receptor family. EGFR can form either homodimers with other EGFRs or heterodimers with other HER family members, including HER2, HER3, and HER4 (1, 2). Upon binding of its polypeptide ligands, EGFR initiates signaling cascades that regulate cellular processes. The importance of EGFR in development is shown by EGFR knockout mice that have congenital organ defects and die within the first month of birth (2, 3).

The first EGFR somatic mutation characterized was an 801-bp in-frame deletion of the exons 2 to 7 within the extracellular ligand-binding domain of wild-type EGFR, known as EGFRvIII (46). It has been shown that expression of EGFRvIII leads to a ligand-independent, constitutive activity (68) and can induce tumors in a murine glioma model (9).

Recently, somatic mutations in the kinase domain of EGFR have been discovered in lung adenocarcinomas (1012). The finding that overexpression and mutations of EGFR occurred in many types of human cancer make EGFR a promising target for anticancer therapy. The specific inhibitors, including gefitinib and erlotinib, which compete with ATP for binding to the kinase domain of EGFR, have been approved for clinical use in non–small cell lung cancer (13). The dramatic responses to gefitinib and erlotinib of lung adenocarcinomas harboring EGFR mutations (1012), as well as the finding that secondary mutations in the EGFR kinase domain cause resistance to gefitinib (14, 15), indicate that mutated EGFR appears to be their major target. The antiproliferative or apoptotic effects (1618) of gefitinib have been documented, although the mechanism of its action remained largely unknown, especially in the cells harboring mutations of EGFR.

The major signaling cascades induced by ligand-activated wild-type EGFR include mitogen-activated protein kinase (MAPK) pathways, signal transducers and activators of transcription (STAT) pathways, and the phosphatidylinositol 3-kinase (PI3K) pathway (reviewed in ref. 19). MAPK pathways can be activated in a Ras/Raf-dependent or Ras/Raf-independent manner, converging on extracellular signal-regulated kinase (ERK1/2) and ERK5. STAT activation seems dependent on EGFR tyrosine kinase activity (2022), whereas PI3K activity leads to phosphorylation and activation of the AKT kinase (23). Studies of cells expressing EGFR mutations in the kinase domain revealed phosphorylation of STAT5 and AKT (16) and Src homology and collagen (Shc; ref. 18). NIH-3T3 cells can be transformed by mutant EGFRs, leading to activation of Shc and STAT3.6

The growth of the murine bone marrow–derived cell line, Ba/F3, is dependent on the growth factor interleukin-3 (IL-3) but is rendered IL-3 independent by several tyrosine kinase oncogenes, including BCR/ABL (24), FLT3 (25), and TEL/platelet-derived growth factor receptor ß (26). For such oncogenes, induction of factor independence of Ba/F3 cells has been closely associated with transforming activity in vitro and in vivo (27).

In this study, we characterized Ba/F3 cells expressing two missense mutations in the kinase domain of EGFR, EGFR-L858R and EGFR-G719S, and showed that these mutants transformed Ba/F3 cells to factor independence in the absence of exogenous EGF. Our results provide conclusive evidence of constitutive activation of these mutant receptors and provide a model system to study the effects of EGFR inhibitors and downstream targets. Strikingly, we find a difference in response to gefitinib between the two mutants and show that gefitinib acts by inhibiting cell cycle progression in these cells. This system should prove useful for further studies of EGFR inhibitor action.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents and antibodies. Gefitinib was obtained from AstraZeneca (Waltham, MA). AG1478, EGF, RNase A, propidium iodide, and anti-tubulin antibody (clone DM 1A) were from Sigma (St. Louis, MO). The following antibodies were used: pTyr (PY99), pERK (E4), EGFR (1005), ERK5 (H-300), CDK4(c-22), CDK6 (c-21), Cyclin D2 (c-17), and Cyclin D3 (c-16) from Santa Cruz Biotechnology (Santa Cruz, CA); pAKT (Ser473), AKT, pERK5 (Thr218/Tyr220), p44/42 MAPK from Cell Signaling (Beverly, MA); p-STAT5 (Tyr694, clone 47), STAT5 (clone 89), EGFR (clone 13), p27 (clone 57) from BD Transduction Laboratories (Lexington, KY).

Generation of EGFR-L858R and EGFR-G719S containing expression vectors and transfection into Ba/F3 cells. Full-length cDNAs of EGFR containing L858R and G719S mutations were generated by mutagenesis using QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) following the manufacturer's instruction with mutagenesis primers AAGATCACAGATTTTGGGAGGGCCAAACTGCTGGGTG and CACCCAGCAGTTTGGCCCTCCCAAAATCTGTGATCTT. The mutated full-length EGFR cDNAs were confirmed by sequencing. The cDNAs of EGFR-L858R, EGFR-G719S or wild-type EGFR was then subsequently cloned into the MCS site between XhoI and NheI of the pClneo mammalian expression vector (Promega, Madison, WI) driven by pCMV I.E enhancer/promoter. The putative pClneo/EGFR-wt, EGFR-L858R, or EGFR-G719S expression constructs were confirmed by both restriction digestion and sequencing.

The pClneo expression vector containing full-length wild-type EGFR, EGFR-L858R, or EGFRG719S were then introduced into the murine growth factor–dependent Ba/F3 cells by electroporation, respectively. The transfected cells were first selected in 800 mg/mL of G418. The G418-resistant cells were then subjected to the second round selection by growing in the medium without IL-3. Stable polyclonal cell lines and monoclonal cell lines were selected and used for further study.

Cell culture. Ba/F3 cells were cultured in RPMI 1640 (Mediatech, Inc., Herndon, VA) with 10% FCS, 10% WEHI3B conditional medium (as a source of IL-3), 100 units/mL penicillin and 100 mg/mL streptomycin, and 1% glutamine. Ba/F3-EGFR-L858R and Ba/F3-EGFR-G719S cells were maintained in the culture medium as its parental Ba/F3 cells, except without IL-3, but with 800 mg/mL G418; Ba/F3-EGFR wild-type cells were cultured in the medium with IL-3 and 800 mg/mL G418. All the cells were maintained in a humidified incubator at 37°C with 5% CO2.

Western blotting analysis. Cells were collected and washed once in cold PBS and then lysed in NP40 buffer [50 mmol/L Tris (pH 8.0), 150 mmol/L NaCl, 1.0% NP40, and 1x Protein Inhibitor Cocktail Set I (Calbiochem, San Diego, CA)]. After incubation in ice for 30 minutes, the lysates were centrifuged at 14,000 x g for 15 minutes, and the supernatant was transferred into a new tube. The protein concentration of the supernatant was detected by the Bio-Rad protein assay kit (Richmond, CA) and equivalent amount of proteins were loaded into SDS-PAGE gel and electrophoretically transferred to Immobilon-P membranes (Millipore, Danvers, VA), which was then subjected to Western blotting analysis using the specific antibodies indicated.

Immunoprecipitation and immunoblotting. Immunoprecipitations were done using 1,000 to 1,500 mg of total protein as starting materials following a protocol suggested by Santa Cruz Biotechnology. Briefly, the reaction volumes were equalized using NP40 lysis buffer. The samples were precleared with control IgG followed by incubation with primary antibody and corresponding protein-agarose. At the end of the incubation, the beads were washed four times with TNN buffer [40 mmol/L Tris-HCl (pH 8.0), 10 mmol/L NaCl, 0.5 % NP40]. After the final washing, the pelleted beads were resuspended in 1x Laemmli sample buffer and the supernatant was subjected to Western blotting analysis following the standard procedures.

Fluorescence-activated cell sorting analysis. Cells were collected and fixed in 40% ethanol for at least 1 hour (or until ready for the experiment) at 4°C. The fixed cells were treated with 0.5 mL of 500 mg/mL RNase A for 45 minutes at 37°C and stained with 69 mmol/L propidium iodide (in 38 mM sodium citrate) for at least 30 minutes at room temperature in the dark. The stained cells were then analyzed for DNA content in a Becton Dickinson fluorescence-activated cell sorter using both ModFit (Verity Software House, Topsham, ME) and CellQuest (Becton Dickinson, San Jose, CA) programs.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Interleukin-3-independent growth of Ba/F3-EGFR-L858R and Ba/F3-EGFR-G719S cells and constitutive autophosphorylation of the mutated receptors. To determine the transforming potential, pClneo expression vector (with G418-selective marker) containing EGFR, EGFR-L858R, EGFR-G719S, and empty pClneo were each transfected into IL-3-dependent Ba/F3 cells. After selection in G418, IL-3 was withdrawn from the medium. Whereas cells transfected with either pClneo or pClneo-EGFR failed to grow, polyclonal populations of cells transfected with pClneo-EGFR-G719S or pClneo-EGFR- L858R were readily obtained and able to proliferate, with a growth rate similar to that in the presence of IL-3 and comparable with those of Ba/F3 cells transfected with pClneo alone grown in the presence of IL-3 (Fig. 1A). In contrast, the expression of wild-type EGFR did not permit factor-independent growth of Ba/F3 cells (Fig. 1B), even at the levels higher than those for some IL-3-independent, mutant EGFR-expressing cells (data not shown). In the absence of IL-3, some slight growth of Ba/F3-EGFR cells was observed upon EGF stimulation but much slower than for cells grown in the presence of IL-3 (Fig. 1B), which agree with previous findings (2830).



View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. IL-3-independent proliferation of Ba/F3 cells expressing mutant EGFR, associated with constitutive EGFR autophosphorylation. A, Ba/F3 cells stably expressing EGFR-L858R or EGFR-G719S or pClneo empty vector were seeded at a density of 1 x 105/mL and grown in the presence or absence of IL-3 (labeled as G719S, +/–IL-3; L858R, +/–IL-3; and pClneo, +/–IL-3). Cells were collected at the time indicated and counted after staining with trypan blue. Points, means of two independent experiments; bars, SD. B, as controls, Ba/F3 cells transfected with empty vector (pClneo) or with wild-type EGFR were grown and analyzed as above in the presence or absence of EGF or IL-3 (labeled as WT, +/–IL-3+/–EGF; pClneo, +/–IL-3). C, immunoblots with anti-EGFR antibody 1005 (top) and antiphosphotyrosine antibody pY99 (bottom) from lysates of Ba/F3 cells transfected with vector (pClneo), EGFR-L858R, or EGFR-G719S. Lanes 1 and 4, pooled populations stably expressing EGFR-L858R and EGFR-G719S, respectively; lanes 2, 3, 5, and 6, clones derived from the pooled population. D, immunoprecipitation with control IgG (Con IgG) or anti-EGFR antibodies from lysates of Ba/F3 cells expressing EGFR-L858R or EGFR-G719S, as above, followed by immunoblotting with anti-EGFR antibody 1005 (top) and antiphosphotyrosine antibody pY99 (bottom). Representative of two independent experiments.

 
To determine whether IL-3-independent growth was associated with constitutive activation of the mutated receptors without EGF stimulation, we analyzed the tyrosine phosphorylation status of the receptors in both polyclonal Ba/F3 populations and cloned lines. Immunoblotting of cell lysates revealed a tyrosine-phosphorylated protein with a molecular weight corresponding to EGFR (Fig. 1C). Immunoprecipitation of EGFR followed by immunoblotting with antiphosphotyrosine antibodies confirms the identity of this tyrosine-phosphorylated protein as EGFR (Fig. 1D).

These results indicated that the L858R and G719S mutations of EGFRs have transforming potential and that these mutated receptors are constitutively autophosphorylated.

Differential growth inhibition of epidermal growth factor receptor mutant-expressing Ba/F3 cells by gefitinib. We next examined the effects of two EGFR-specific inhibitors, AG1478 and gefitinib, on the growth of Ba/F3-EGFR-L858R and Ba/F3-EGFR-G719S cells. Figure 2A shows that both drugs could inhibit the growth of Ba/F3 cells expressing either mutation in the absence of IL-3; whereas in the presence of IL-3, the cells were still able to proliferate at concentrations as high as 300 nmol/L for either drug. The EGFR inhibitors did not inhibit the growth of FLT3-N841I-transformed Ba/F3 cells (25) in both the presence and absence of IL-3 at concentrations up to 3,000 nmol/L.



View larger version (40K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Dose-dependent inhibitory effects of AG1478 and gefitinib on the proliferation of EGFR-L858R- or EGFR-G719S-expressing Ba/F3 cells and on the autophosphorylation of the mutated receptors. A, cells were seeded at a density of 1 x 105/mL and immediately treated with AG1478 (left) or gefitinib (right) at the concentrations indicated. As a control, FLT3-N841I expressing Ba/F3 cells were also seeded at the same density and treated with both drugs. Cells were collected 72 hours after treatment and counted after staining with trypan blue, respectively. Points, averages of two independent experiments. B, Ba/F3 cells expressing mutant EGFR were treated with gefitinib and lysated in NP40 buffer after 30 minutes. Whole cell lysates were subjected to immunoblotting analysis directly. Top, levels of autophosphorylations of mutated receptors as detected by an antibody against phosphotyrosine (pY99). Bottom, expression levels of the mutated EGFRs. Representative of two independent experiments.

 
Strikingly, gefitinib seemed to inhibit growth of cells expressing the two EGFR mutants to different extents. IC50 for AG1478 is about 8 nmol/L in Ba/F3 cells expressing EGFRL858R and about 17 nmol/L in EGFR-G719S cells, whereas IC50 for gefitinib is about 20 nmol/L in EGFR-L858R-expressing cells and about 140 nmol/L in EGFR-G719S cells. Thus, the EGFR-G719S mutant seems clearly less sensitive to gefitinib.

To examine the effect of gefitinib on mutant EGFR kinase activity, we used receptor autophosphorylation as a marker. Figure 2B shows that in the presence or absence of IL-3, gefitinib was able to reduce the autophosphorylation levels of mutant EGFRs in a dose-dependent manner, which indicates that in the absence of IL-3, the growth inhibition observed in Fig. 2A is due to the inhibition of the mutant receptors; whereas in the presence of IL-3, the growth of the host cells was not controlled by the mutant receptors. The reason that inhibition of autophosphorylation of EGFR-G719S by gefitinib seems more effective in the presence of IL-3 is currently unknown. Figure 2B also shows that, in the absence of IL-3, the inhibition of autophosphorylation of EGFR-G719S required higher concentration of gefitinib compared with that of EGFR-L858R, indicating that the differential growth inhibition seen in Fig. 2A may be due to differential inactivation of the mutant receptors.

Constitutive activation of downstream pathways by the mutated epidermal growth factor receptors in Ba/F3 cells. To explore the downstream targets of EGFR-G719S and EGFR-L858R, the phosphorylation of several known effectors of the EGFR signaling pathways were analyzed. For cells expressing the EGFR mutants, STAT5, ERK1/2, AKT, and ERK5, are all phosphorylated in the absence of IL-3, without exogenous EGF stimulation (Fig. 3A, lanes 1 and 7). Gefitinib was able to reduce the phosphorylation of each of these downstream effectors (Fig. 3A, lanes 2, 3, 8, and 9); whereas pAkt was still detectable at the highest gefitinib dose, the levels were clearly reduced. In contrast, the activation of these downstream effectors by FLT3-N841I was not affected by gefitinib (Fig. 3A, lanes 13 and 14). IL-3 treatment of cells transfected with vector alone led to the phosphorylation of STAT5 but not the other EGFR effectors (Fig. 3A, lanes 17 and 18). Correspondingly, in IL-3-supplemented cells expressing EGFR mutants, STAT5 phosphorylation becomes resistant to gefitinib, whereas the other downstream effectors remain sensitive (Fig. 3A, lanes 4-6, 10-12). This result indicates that the phosphorylation of STAT5 in the presence of IL-3 was not controlled by the mutated EGFRs but by other pathways, probably through IL-3 pathway, because IL-3 is a strong activator of STAT5 (31, 32).



View larger version (44K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Phosphorylation of downstream effectors of the EGFR pathway in Ba/F3 cells expressing EGFR mutants and control constructs, as affected by gefitinib treatment, IL-3 supplementation, and serum starvation. A, cells expressing EGFR-L858R (lanes 1-6), EGFR-G719S (lanes 7-12), and FLT3-N841 (lanes 13-16) or pClneo vector (lanes 17 and 18) controls were treated with gefitinib or IL-3 as indicated. Whole cell lysates were subjected to immunoblotting analysis as described in Fig. 2 legend. Note that membranes were probed first with the phosphospecific antibodies and the membranes were subsequently stripped and reprobed with the corresponding non-phosphospecific antibodies. Tubulin was used as the loading control. B, cells expressing mutated receptors as well as empty vector (pClneo, as control) were cultured in medium with (+) or without (–) addition of serum for 24 hours before total protein extraction and immunoblotting analysis as described in the Fig. 2 and Fig. 3A legends. Representative of two independent experiments.

 
To determine whether serum in the medium may contribute to the observed constitutive phosphorylation of mutant EGFR and its downstream effectors, even in the absence of exogenous EGF, we also examined their phosphorylation status in the presence and absence of serum. The mutated receptors were autophosphorylated to a similar level after starvation from serum for 24 hours compared with those growing in the presence of serum, which was also the case for the phosphorylation of STAT5, AKT, and ERK5 (Fig. 3B). Phosphorylation of ERK1/2 was not affected by serum starvation in cells expressing EGFR-L858R and remained detectable after serum starvation of cells expressing EGFR-G719S. In contrast, the phosphorylation of ERK1/2, as well as other tested kinases, was diminished significantly upon serum starvation in the cells transfected with pClneo alone (Fig. 3B). These results showed that the EGFR mutations were able to confer constitutive kinase activities to the EGFRs and to activate major downstream targets, in the absence of EGF or any other EGFR ligand.

Epidermal growth factor–mediated signaling in wild-type and mutated epidermal growth factor receptor–expressing cells. Given the constitutive activation of the mutant EGFRs, we wished to determine whether the signaling pathways downstream of the wild-type receptor could be activated by EGF in Ba/F3 cells and whether the mutant receptors could be superactivated by addition of exogenous EGF. We first examined the response of wild-type EGFR to EGF stimulation. Upon EGF stimulation, wild-type EGFR was autophosphorylated, which could be blocked by gefitinib as examined by either immunoblotting (Fig. 4A) or immunoprecipitation/immunoblot analysis (data not shown). Furthermore, EGF was able to induce phosphorylations of STAT5, ERK1/2, AKT, and ERK5 in wild-type EGFR-expressing Ba/F3 cells (Fig. 4A, lanes 5-7). As for EGF-mediated receptor autophosphorylation, gefitinib inhibited phosphorylation of these kinases, indicating that they are downstream targets of the EGF-activated wild-type EGFR (Fig. 4A, lanes 6 and 7). These results indicate that the EGF-mediated major signaling pathways of wild-type EGFR found in other systems are all intact in Ba/F3 cell systems.



View larger version (64K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. EGF-mediated activations of wild-type and mutated EGFRs and the downstream targets. A, total proteins were extracted from wild-type EGFRs expressing cells starved from IL-3 for 24 hours and stimulated with EGF (+EGF) or without EGF (–EGF) for 20 minutes followed by gefitinib treatments for 30 minutes and subjected to immunoblotting analysis using the antibodies indicated. All the procedures were as described in Fig. 2 and Fig. 3 legends. B, Ba/F3 cells expressing G719S or L858R EGFR mutants were maintained in the absence of IL-3. The cells were subjected to the treatment described in (A). Total proteins were subjected to immunoblotting analysis as described in the Fig. 2 and Fig. 3 legends and probed with the antibodies indicated. Representative of two independent experiments.

 
The mutant receptors were found to respond further to the addition of EGF. Figure 4B shows that in cells expressing either G719S or L858R mutant, the autophosphorylation of mutated receptors and the phosphorylation of STAT5 were significantly induced by EGF. EGF stimulation had only subtle effects on phosphorylation of ERK5 and ERK1/2 and had a more potent effect on the phosphorylation of AKT in G719S-expressing cells than that in L858R cells. In each case, gefitinib was able to block EGF-mediated signaling, indicating that these signaling pathways were regulated through mutant EGFR itself (Fig. 4B, lanes 3 and 6).

Antiproliferative effects of gefitinib on Ba/F3 cells expressing mutated epidermal growth factor receptors. Dependent on the genetic and physiologic background of the host cells, gefitinib could have either a proapoptotic effect or an antiproliferative effect (33). To examine the cell cycle effect of gefitinib, the EGFR-L858R- and EGFR-G719S-expressing Ba/F3 cells were treated with 0.1 µmol/L (for EGFR-L858R cells) or 0.5 µmol/L (for EGFR-G719S cells) of the drug, and at the time point indicated, the cells were collected for both protein extraction and fluorescence-activated cell sorting analysis. Figure 5A shows that gefitinib induced G1 cell cycle arrest in the G719S and L858R cells starting as early as 12 hours. After 72 hours of treatment, most of the cells were blocked in the G1 phase, indicating an antiproliferative effect of gefitinib on the cells.



View larger version (40K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Gefitinib induces G1 cell cycle arrest in EGFR-L858R- and EGFR-G719S-expressing Ba/F3 cells. A, cells were seeded at a density of 2 x 105/mL and treated with gefitinib at a concentration of 0.1 µmol/L (for EGFR-L858R-expressing cells) or 0.5 µmol/L (for EGFR-G719S-expressing cells) and collected at the time points indicated for both fluorescence-activated cell sorting analysis and total protein extraction. B, total protein extracts obtained from (A) were then subjected to immunoblotting analysis, using antibodies indicated. Representative of two independent experiments.

 
To determine the potential molecular mechanism of gefitinib-induced G1 cell cycle arrest in these cells, the cell cycle regulators important for initiation of G1-to-S phase transition were analyzed. Figure 5B shows that the levels of cyclin D2 and D3 went down as early as 3 hours after exposure to drug in the G719S and L858R cells but rose back after 24 hours of treatment. The level of CDK4 also went down in the EGFR mutant-expressing cells and reached the lowest level 24 hours after treatment. In L858R cells, CDK4 level started to decrease at about 3 hours after treatment, and at 12 hours, there was almost no detectable CDK4. In G719S cells, the level of CDK4 decreased slightly after 3 hours of treatment and declined more sharply after 6 hours. The level of CDK6 was not altered by gefitinib. p27 levels showed the most delayed response, starting to increase 6 hours after gefitinib treatment and reaching the highest level at 24 hours. The results indicated that gefitinib-induced G1 cell cycle arrest was preceded by down-regulation of the levels of D-type cyclins and CDK4.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this report, we showed that two clinically relevant point mutations, L858R and G719S, within the kinase domain of EGFR, represent novel ligand-independent activating mutations and confer constitutive kinase activity and IL-3-independent proliferation to murine growth factor–dependent Ba/F3 cells. The abilities of the mutated receptors to activate ERK5, ERK1/2, STAT5, and AKT constitutively in the absence of EGF are consistent with their oncogenic potential.

Ba/F3 cells are especially suitable for studies of mutant EGFR activation, as these cells do not express endogenous EGFR or other members of the ErbB family (28, 29). In particular, the use of this system has allowed the identification of the ligand-independent activation of EGFR induced by single missense point mutations in the kinase domain. Transformation and ligand-independent activation by mutant EGFR have also been observed in NIH-3T3 cells.6

The specific transforming potential of mutant EGFRs relative to wild-type EGFR was apparent even at early stages of selection. In contrast to Ba/F3 cells expressing EGFRL858R or EGFR-G719S, which survived and started to proliferate in the absence of IL-3, cells expressing wild-type EGFR failed to grow and died out eventually, despite similar expression levels of mutant and wild-type EGFR at this early stage.

Whereas L858R and G719S mutations both conferred ligand-independent activation to EGFR, their sensitivities to gefitinib are different. L858R is almost 10-fold more sensitive to the drug. Such difference in sensitivity may be due to the fact that G719S is located in the ATP binding loop (p-loop) and gefitinib is a competitor of ATP. Due to its small side chain that could fit into niches where no other amino acid could fit in, glycine plays a unique role in the conformation of many proteins. Changing from glycine to serine may disrupt the local fine structure and induce a less favorable conformation for gefitinib to bind.

The antiproliferative and proapoptotic effects of gefitinib in a wide range of tumors have been well documented (3436). Its antiproliferative effect has been reported as due to G1 cell cycle arrest via up-regulation of p27 (37, 38) and down-regulation of D-type cyclins and CDK4/6 (38). Whereas the proapoptotic effect of gefitinib has been noticed (16, 17), its antiproliferative effect on cells expressing mutant EGFRs has not been reported. Our finding that in EGFR-L858R- and EGFR-G719S-expressing Ba/F3 cells gefitinib induced G1 cell cycle arrest, preceded by down-regulation of D-type cyclins and CDK4, adds a new role and potential new mechanism for gefitinib action.

The antiproliferative versus proapoptotic activity of gefitinib in different systems may depend on the genetic background and physiologic conditions of host cells. In our hand, when used at a concentration 5 to 10 times the IC50, gefitinib induced a G1 cell cycle arrest, but no apoptotic cells were detected for over 72 hours for both mutated receptors, whereas in lung cancer cell lines harboring L858R mutation gefitinib induced apoptosis (16, 17). It will be interesting to find out whether higher concentrations of gefitinib could induce apoptosis in Ba/F3 cells. A comparison of signaling pathways in EGFR mutant-expressing Ba/F3 cells and in lung carcinoma cells harboring the EGFR-L858R mutation may aid in dissecting antiproliferative effects from proapoptotic effects of gefitinib, an important issue when the drug is used in combination with chemotherapy (33).


    Acknowledgments
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Drs. Geoffrey Shapiro and Blanca Scheijen at the Dana-Farber Cancer Institute for the antibodies against cell cycle regulators for prescreening and Laura Prickett and Kathryn Folz-Donahue at the Dana-Farber Cancer Institute for the cell cycle analysis.


    Footnotes
 
6 H. Greulich et al., submitted for publication. Back

Received 5/26/05. Revised 7/12/05. Accepted 7/21/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Olayioye MA, Neve RM, Lane HA, Hynes NE. The ErbB signaling network: receptor heterodimerization in development and cancer. EMBO J 2000;19:3159–67.[CrossRef][Medline]
  2. Sibilia M, Wagner B, Hoebertz A, et al. Mice humanised for the EGF receptor display hypomorphic phenotypes in skin, bone and heart. Development 2003;130:4515–25.[Abstract/Free Full Text]
  3. Miettinen PJ, Berger JE, Meneses J, et al. Epithelial immaturity and multiorgan failure in mice lacking epidermal growth factor receptor. Nature 1995;376:337–41.[CrossRef][Medline]
  4. Libermann TA, Nusbaum HR, Razon N, et al. Amplification, enhanced expression and possible rearrangement of EGF receptor gene in primary human brain tumours of glial origin. Nature 1985;313:144–7.[CrossRef][Medline]
  5. Yamazaki H, Fukui Y, Ueyama Y, et al. Amplification of the structurally and functionally altered epidermal growth factor receptor gene (c-erbB) in human brain tumors. Mol Cell Biol 1988;8:1816–20.[Abstract/Free Full Text]
  6. Wong AJ, Ruppert JM, Bigner SH, et al. Structural alterations of the epidermal growth factor receptor gene in human gliomas. Proc Natl Acad Sci U S A 1992;89:2965–9.[Abstract/Free Full Text]
  7. Humphrey PA, Wong AJ, Vogelstein B, et al. Anti-synthetic peptide antibody reacting at the fusion junction of deletion-mutant epidermal growth factor receptors in human glioblastoma. Proc Natl Acad Sci U S A 1990;87:4207–11.[Abstract/Free Full Text]
  8. Antonyak MA, Moscatello DK, Wong AJ. Constitutive activation of c-Jun N-terminal kinase by a mutant epidermal growth factor receptor. J Biol Chem 1998;273:2817–22.[Abstract/Free Full Text]
  9. Holland EC, Hively WP, DePinho RA, Varmus HE. A constitutively active epidermal growth factor receptor cooperates with disruption of G1 cell-cycle arrest pathways to induce glioma-like lesions in mice. Genes Dev 1998;12:3675–85.[Abstract/Free Full Text]
  10. Paez JG, Janne PA, Lee JC, et al. EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy. Science 2004;304:1497–500.[Abstract/Free Full Text]
  11. Lynch TJ, Bell DW, Sordella R, et al. Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small cell lung cancer to gefitinib. N Engl J Med 2004;350:2129–39.[Abstract/Free Full Text]
  12. Pao W, Miller V, Zakowski M, et al. EGF receptor gene mutations are common in lung cancers from "never smokers" and are associated with sensitivity of tumors to gefitinib and erlotinib. Proc Natl Acad Sci U S A 2004;101:13306–11.[Abstract/Free Full Text]
  13. Fuster LM, Sandler AB. Select clinical trials of erlotinib (OSI-774) in non-small-cell lung cancer with emphasis on phase III outcomes. Clin Lung Cancer 2004;6:S24–9.
  14. Kobayashi S, Boggon TJ, Dayaram T, et al. EGFR mutation and resistance of non-small-cell lung cancer to gefitinib. N Engl J Med 2005;352:786–92.[Abstract/Free Full Text]
  15. Pao W, Miller VA, Politi KA, et al. Acquired resistance of lung adenocarcinomas to gefitinib or erlotinib is associated with a second mutation in the EGFR kinase domain. PLoS Med 2005;2:1–11.
  16. Sordella R, Bell DW, Haber DA, Settleman J. Gefitinib-sensitizing EGFR mutations in lung cancer activate anti-apoptotic pathways. Science 2004;305:1163–7.[Abstract/Free Full Text]
  17. Tracy S, Mukohara T, Hansen M, Meyerson M, Johnson BE, Janne PA. Gefitinib induces apoptosis in the EGFRL858R non-small-cell lung cancer cell line H3255. Cancer Res 2004;64:7241–4.[Abstract/Free Full Text]
  18. Amann J, Kalyankrishna S, Massion PP, et al. Aberrant epidermal growth factor receptor signaling and enhanced sensitivity to EGFR inhibitors in lung cancer. Cancer Res 2005;65:226–35.[Abstract/Free Full Text]
  19. Jorissen RN, Walker F, Pouliot N, Garrett TP, Ward CW, Burgess AW. Epidermal growth factor receptor: mechanisms of activation and signalling. Exp Cell Res 2003;284:31–53.[CrossRef][Medline]
  20. David M, Wong L, Flavell R, et al. STAT activation by epidermal growth factor (EGF) and amphiregulin. Requirement for the EGF receptor kinase but not for tyrosine phosphorylation sites or JAK1. J Biol Chem 1996;271:9185–8.[Abstract/Free Full Text]
  21. Olayioye MA, Beuvink I, Horsch K, Daly JM, Hynes NE. ErbB receptor-induced activation of stat transcription factors is mediated by Src tyrosine kinases. J Biol Chem 1999;274:17209–18.[Abstract/Free Full Text]
  22. Xia L, Wang L, Chung AS, et al. Identification of both positive and negative domains within the epidermal growth factor receptor COOH-terminal region for signal transducer and activator of transcription (STAT) activation. J Biol Chem 2002;277:30716–23.[Abstract/Free Full Text]
  23. Burgering BM, Coffer PJ. Protein kinase B (c-Akt) in phosphatidylinositol-3-OH kinase signal transduction. Nature 1995;376:599–602.[CrossRef][Medline]
  24. Guo XY, Balague C, Wang T, et al. The presence of the Rb c-box peptide in the cytoplasm inhibits p210bcr-abl transforming function. Oncogene 1999;18:1589–95.[CrossRef][Medline]
  25. Jiang J, Paez JG, Lee JC, et al. Identifying and characterizing a novel activating mutation of the FLT3 tyrosine kinase in AML. Blood 2004;104:1855–8.[Abstract/Free Full Text]
  26. Meyer J, Laker C, Janzir N, et al. Activation of the gene for the PDGF receptor ß1 (PDGFRß) in interleukin-3-dependent myeloid cells by retroviral insertional mutagenesis: implications for the transforming potential of PDGFRß. Growth Factors 2002;20:131–40.[CrossRef][Medline]
  27. Iijima Y, Okuda K, Tojo A, et al. Transformation of Ba/F3 cells and Rat-1 cells by ETV6/ARG. Oncogene 2002;21:4374–83.[CrossRef][Medline]
  28. Walker F, Hibbs ML, Zhang HH, Gonez LJ, Burgess AW. Biochemical characterization of mutant EGF receptors expressed in the hemopoietic cell line BaF/3. Growth Factors 1998;16:53–67.[Medline]
  29. Collins MK, Downward J, Miyajima A, Maruyama K, Arai K, Mulligan RC. Transfer of functional EGF receptors to an IL3-dependent cell line. J Cell Physiol 1988;137:293–8.[CrossRef][Medline]
  30. Riese DJ, Kim ED, Elenius K, et al. The epidermal growth factor receptor couples transforming growth factor-{alpha}, heparin-binding epidermal growth factor-like factor, and amphiregulin to Neu, ErbB-3, and ErbB-4. J Biol Chem 1996;271:20047–52.[Abstract/Free Full Text]
  31. Quelle FW, Sato N, Witthuhn BA, et al. JAK2 associates with the ß c chain of the receptor for granulocyte-macrophage colony-stimulating factor, and its activation requires the membrane-proximal region. Mol Cell Biol 1994;14:4335–41.[Abstract/Free Full Text]
  32. Nagata Y, Todokoro K. Interleukin 3 activates not only JAK2 and STAT5, but also Tyk2, STAT1, and STAT3. Biochem Biophys Res Commun 1996;221:785–9.[CrossRef][Medline]
  33. Herbst RS, Fukuoka M, Baselga J. Gefitinib: a novel targeted approach to treating cancer. Nat Rev Cancer 2004;4:956–65.[CrossRef][Medline]
  34. Ciardiello F. Epidermal growth factor receptor tyrosine kinase inhibitors as anticancer agents. Drugs 2000;60:25–32.
  35. Barker AJ, Gibson KH, Grundy W, et al. Studies leading to the identification of ZD1839 (IRESSA): an orally active, selective epidermal growth factor receptor tyrosine kinase inhibitor targeted to the treatment of cancer. Bioorg Med Chem Lett 2001;11:1911–4.[CrossRef][Medline]
  36. Cohen EE, Rosen F, Stadler WM, et al. Phase II trial of ZD1839 in recurrent or metastatic squamous cell carcinoma of the head and neck. J Clin Oncol 2003;21:1980–7.[Abstract/Free Full Text]
  37. Di Gennaro E, Barbarino M, Bruzzese F, et al. Critical role of both p27KIP1 and p21CIP1/WAF1 in the antiproliferative effect of ZD1839 (‘Iressa’), an epidermal growth factor receptor tyrosine kinase inhibitor, in head and neck squamous carcinoma cells. J Cell Physiol 2003;195:139–50.[CrossRef][Medline]
  38. Chang GC, Hsu SL, Tsai JR, et al. Molecular mechanisms of ZD1839-induced G1-cell cycle arrest and apoptosis in human lung adenocarcinoma A549 cells. Biochem Pharmacol 2004;68:1453–64.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
R. K. Kancha, N. von Bubnoff, C. Peschel, and J. Duyster
Functional Analysis of Epidermal Growth Factor Receptor (EGFR) Mutations and Potential Implications for EGFR Targeted Therapy
Clin. Cancer Res., January 15, 2009; 15(2): 460 - 467.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
U. Guha, R. Chaerkady, A. Marimuthu, A. S. Patterson, M. K. Kashyap, H. C. Harsha, M. Sato, J. S. Bader, A. E. Lash, J. D. Minna, et al.
Comparisons of tyrosine phosphorylated proteins in cells expressing lung cancer-specific alleles of EGFR and KRAS
PNAS, September 16, 2008; 105(37): 14112 - 14117.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
D. W. Bell, B. W. Brannigan, K. Matsuo, D. M. Finkelstein, R. Sordella, J. Settleman, T. Mitsudomi, and D. A. Haber
Increased Prevalence of EGFR-Mutant Lung Cancer in Women and in East Asian Populations: Analysis of Estrogen-Related Polymorphisms
Clin. Cancer Res., July 1, 2008; 14(13): 4079 - 4084.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
A. Kumar, E. T. Petri, B. Halmos, and T. J. Boggon
Structure and Clinical Relevance of the Epidermal Growth Factor Receptor in Human Cancer
J. Clin. Oncol., April 1, 2008; 26(10): 1742 - 1751.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
G D Smith, B E Chadwick, C Willmore-Payne, and J S Bentz
Detection of epidermal growth factor receptor gene mutations in cytology specimens from patients with non-small cell lung cancer utilising high-resolution melting amplicon analysis
J. Clin. Pathol., April 1, 2008; 61(4): 487 - 493.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
H.-P. Kim, S.-W. Han, S.-H. Kim, S.-A. Im, D.-Y. Oh, Y.-J. Bang, and T.-Y. Kim
Combined lapatinib and cetuximab enhance cytotoxicity against gefitinib-resistant lung cancer cells
Mol. Cancer Ther., March 1, 2008; 7(3): 607 - 615.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Deng, T. Shimamura, S. Perera, N. E. Carlson, D. Cai, G. I. Shapiro, K.-K. Wong, and A. Letai
Proapoptotic BH3-Only BCL-2 Family Protein BIM Connects Death Signaling from Epidermal Growth Factor Receptor Inhibition to the Mitochondrion
Cancer Res., December 15, 2007; 67(24): 11867 - 11875.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. A. Engelman, K. Zejnullahu, C.-M. Gale, E. Lifshits, A. J. Gonzales, T. Shimamura, F. Zhao, P. W. Vincent, G. N. Naumov, J. E. Bradner, et al.
PF00299804, an Irreversible Pan-ERBB Inhibitor, Is Effective in Lung Cancer Models with EGFR and ERBB2 Mutations that Are Resistant to Gefitinib
Cancer Res., December 15, 2007; 67(24): 11924 - 11932.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. Godin-Heymann, I. Bryant, M. N. Rivera, L. Ulkus, D. W. Bell, D. J. Riese II, J. Settleman, and D. A. Haber
Oncogenic Activity of Epidermal Growth Factor Receptor Kinase Mutant Alleles Is Enhanced by the T790M Drug Resistance Mutation
Cancer Res., August 1, 2007; 67(15): 7319 - 7326.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. Mulloy, A. Ferrand, Y. Kim, R. Sordella, D. W. Bell, D. A. Haber, K. S. Anderson, and J. Settleman
Epidermal Growth Factor Receptor Mutants from Human Lung Cancers Exhibit Enhanced Catalytic Activity and Increased Sensitivity to Gefitinib
Cancer Res., March 1, 2007; 67(5): 2325 - 2330.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
L. V. Sequist, D. W. Bell, T. J. Lynch, and D. A. Haber
Molecular Predictors of Response to Epidermal Growth Factor Receptor Antagonists in Non-Small-Cell Lung Cancer
J. Clin. Oncol., February 10, 2007; 25(5): 587 - 595.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
H. H. Schiffer, E. C. Reding, S. R. Fuhs, Q. Lu, F. Piu, S. Wong, P.-L. H. Littler, D. M. Weiner, W. Keefe, P. K. Tan, et al.
Pharmacology and Signaling Properties of Epidermal Growth Factor Receptor Isoforms Studied by Bioluminescence Resonance Energy Transfer
Mol. Pharmacol., February 1, 2007; 71(2): 508 - 518.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. N. Balak, Y. Gong, G. J. Riely, R. Somwar, A. R. Li, M. F. Zakowski, A. Chiang, G. Yang, O. Ouerfelli, M. G. Kris, et al.
Novel D761Y and Common Secondary T790M Mutations in Epidermal Growth Factor Receptor-Mutant Lung Adenocarcinomas with Acquired Resistance to Kinase Inhibitors.
Clin. Cancer Res., November 1, 2006; 12(21): 6494 - 6501.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. D. Carey, A. J. Garton, M. S. Romero, J. Kahler, S. Thomson, S. Ross, F. Park, J. D. Haley, N. Gibson, and M. X. Sliwkowski
Kinetic Analysis of Epidermal Growth Factor Receptor Somatic Mutant Proteins Shows Increased Sensitivity to the Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitor, Erlotinib
Cancer Res., August 15, 2006; 66(16): 8163 - 8171.
[Abstract] [Full Text] [PDF]


Home page
J. Mol. Diagn.Home page
Y. Yatabe, T. Hida, Y. Horio, T. Kosaka, T. Takahashi, and T. Mitsudomi
A Rapid, Sensitive Assay to Detect EGFR Mutation in Small Biopsy Specimens from Lung Cancer
J. Mol. Diagn., July 1, 2006; 8(3): 335 - 341.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Shimamura, H. Ji, Y. Minami, R. K. Thomas, A. M. Lowell, K. Shah, H. Greulich, K. A. Glatt, M. Meyerson, G. I. Shapiro, et al.
Non-Small-Cell Lung Cancer and Ba/F3 Transformed Cells Harboring the ERBB2 G776insV_G/C Mutation Are Sensitive to the Dual-Specific Epidermal Growth Factor Receptor and ERBB2 Inhibitor HKI-272.
Cancer Res., July 1, 2006; 66(13): 6487 - 6491.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
K. Politi, M. F. Zakowski, P.-D. Fan, E. A. Schonfeld, W. Pao, and H. E. Varmus
Lung adenocarcinomas induced in mice by mutant EGF receptors found in human lung cancers respond to a tyrosine kinase inhibitor or to down-regulation of the receptors
Genes & Dev., June 1, 2006; 20(11): 1496 - 1510.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Ji, X. Zhao, Y. Yuza, T. Shimamura, D. Li, A. Protopopov, B. L. Jung, K. McNamara, H. Xia, K. A. Glatt, et al.
Epidermal growth factor receptor variant III mutations in lung tumorigenesis and sensitivity to tyrosine kinase inhibitors
PNAS, May 16, 2006; 103(20): 7817 - 7822.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jiang, J.
Right arrow Articles by Griffin, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jiang, J.
Right arrow Articles by Griffin, J. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online