| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell and Tumor Biology |
1 Program of Molecular and Cellular Oncogenesis, The Wistar Institute and 2 Department of Pathology and Laboratory Medicine, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania
Requests for reprints: Meenhard Herlyn, The Wistar Institute, 3601 Spruce Street, Philadelphia, PA 19104. Phone: 215-898-3950; Fax: 215-898-0980; E-mail: parsons{at}wistar.org.
| Abstract |
|---|
|
|
|---|
20% of the metastatic melanomas cultured in growth medium suitable for human embryonic stem cells, we found a subpopulation of cells propagating as nonadherent spheres, whereas in standard medium, adherent monolayer cultures were established. Individual cells from melanoma spheres (melanoma spheroid cells) could differentiate under appropriate conditions into multiple cell lineages, such as melanocytic, adipocytic, osteocytic, and chondrocytic lineages, which recapitulates the plasticity of neural crest stem cells. Multipotent melanoma spheroid cells persisted after serial cloning in vitro and transplantation in vivo, indicating their ability to self-renew. Furthermore, they were more tumorigenic than adherent cells when grafted to mice. We identified similar multipotent spheroid cells in melanoma cell lines and found that the stem cell population was enriched in a CD20+ fraction of melanoma cells. Based on these findings, we propose that melanomas can contain a subpopulation of stem cells that contribute to heterogeneity and tumorigenesis. Targeting this population may lead to effective treatments for melanomas. | Introduction |
|---|
|
|
|---|
Indirect evidence supports the presence of melanoma stem-like cells. First, melanomas show phenotypic heterogeneity both in vivo and in vitro, suggesting an origin from a cell with multilineage differentiation abilities. Melanoma cells retain their morphologic and biological plasticity despite repeated cloning (10). Second, melanoma cells often express developmental genes (11). Third, melanoma cells can differentiate into a wide range of cell lineages, including neural, mesenchymal, and endothelial cells. They frequently exhibit characteristics of neural lineages (1214). Melanomas from aggressive lesions can develop vessel-like structures and share with endothelial cells many matrix adhesion receptors such as ß3 integrin or the cell-cell adhesion molecules MCAM, which are important for invasion and metastasis (1517). They can also acquire characteristics of stromal fibroblasts by constricting collagen type I (18) and expressing fibroblast-associated markers such as fibroblast activating protein (19). In some cases, melanoma lesions contain areas of adipogenic or osteocartilaginous differentiation patterns (2024).
Given this evidence, we asked whether melanomas contain a tumorigenic stem celllike population.
| Materials and Methods |
|---|
|
|
|---|
For growing melanoma cells, we used two types of media: (a) mouse embryonic fibroblast (MEF)conditioned human embryonic stem cell (hESC) medium (25, 26). Before use, we mixed MEF conditioned with fresh hESC medium at a 3:1 ratio and supplemented with basic fibroblast growth factor (bFGF) at 4 ng/mL. (b) Mel 2% melanoma growth medium, which was used to establish permanent melanoma cell lines (27). It consisted of MCDB 153 medium (Sigma, St. Louis, MO; 4 parts), L15 medium (Invitrogen; 1 part), 2% FCS, 5 µg/mL insulin (Sigma), 15 µg/mL bovine pituitary extract (Cambrex, East Rutherford, NJ), 1.68 mmol/L calcium chloride, and 5 ng/mL epidermal growth factor (EGF, Sigma). Established melanoma cell lines WM115 and WM239A were cultured in Mel 2% medium without pituitary extract and EGF (27). EBV-transformed B-cell lines from melanoma patients were kindly provided by Dr. D. Herlyn of The Wistar Institute and cultured in RMPI 1640 with 10% FCS (28).
To isolate melanoma cells from heterogeneous primary cultures, individual cells derived from mechanically or enzymatically dissociated primary spheres were cloned by limiting dilution assay in hESC medium. Although one cell showed limited potential for proliferation, new spheroid cultures were regenerated from two single primary cells. For subculture, spheroid cells were dissociated and replated every 7 to 10 days at a clonal density of 1,000 cells/mL (29).
Evaluation of tumorigenicity and histologic staining. Tumorigenicity was determined by s.c. injecting single cells into the right flank of severe combined immunodeficient (SCID) mice at 1.7 x 106 cells per mouse. To compare tumorigenicity of melanoma spheroid cells and their adherent counterparts with limiting amount of cells, mice were treated with 200 µg cyclophosphamide monohybrate (Cytoxan, Sigma), which further suppressed the immune response. Four days later, 2 x 105 tumor cells were injected. H&E, melanin, and hemosiderin staining were done on 5-µm paraffin-embedded sections following standard protocols.
Flow cytometry and fluorescence-activated cell sorting. Adhesive cells were removed with 0.02% EDTA in HBSS. Cells were washed, suspended in buffer [0.1% bovine serum albumin (BSA), 0.1% NaN3 in PBS], and incubated with primary antibodies for 60 minutes at 4°C with constant agitation. Cells were washed twice with buffer then incubated with Alexa Fluor 488conjugated goat anti-mouse secondary antibodies (Molecular Probes, Eugene, OR) for 60 minutes when unconjugated primary antibodies were used. Suspended spheroid cells were dissociated mechanically into single cells and stained. Approximately 5 x 103 cells were analyzed in an EPICS XL instrument (Beckman-Coulter, Inc., Miami, FL). Monoclonal antibodies (mAb) against CD3 (PE conjugated), CD4 (PE), CD8 (PE), CD20 (FITC), MCAM, CD117, and CD26 were purchased from BD PharMingen (San Diego, CA). We purchased mAbs against CD45 (PeliCluster, Amsterdam, The Netherlands), CD34 (PeliCluster), CD133 (Miltenyi Biotech, Auburn, CA), CD31 (Dako, Carpinteria, CA), neural cell adhesion molecule (CD56/NCAM, NeoMarkers, Fremont, CA), E-cadherin (Zymed Laboratories, South San Francisco, CA), N-cadherin (Sigma), von Willebrand factor (vWF, NeoMarkers), vascular endothelial growth factor-2 (VEGFR2, Imclone, New York, NY), and growth-associated phosphoprotein-43 (GAP-43, Calbiochem, San Diego, CA). mAbs against the surface markers of hESCs, including stage-specific embryonic antigen (SSEA)-1, SSEA-3, SSEA-4, TRA-1-60, and TRA-1-81 (25), were obtained from where they were originally developed at The Wistar Institute. mAbs against GD2, chondroitin sulfate proteoglycan (CSPG), ß3 integrin, EGF receptor (EGFR), HLA-DR, and p70NGFR were described previously (30). Isotype-matched mouse pure, PE- or FITC-conjugated antibodies (BD PharMingen) were used as controls.
Fluorescence-activated cell sorting (FACS) was done on a Cytomation MoFlo cytometer (DakoCytomation, Fort Collins, CO). FITC-conjugated mAb against human CD20 was used for separation. For sorting double-stained cells, a polyclonal antibody against human CD20 antigen (NeoMarkers) was used to costain with mAb against MCAM or ß3 integrin. Polyclonal antibodies were labeled by PE-conjugated goat antibodies against rabbit IgG (Sigma) and mAbs by FITC-conjugated rabbit antibodies against mouse IgG (Sigma).
Differentiation assays of melanoma spheroid cells. Melanoma spheres were allowed to sediment, individual cells were removed with the supernatant. Spheres were dissociated into individual cells before plating onto tissue culture-grade plastic coated with 10 ng/mL fibronectin at the density of 2 x 103/cm2. Melanogenic differentiation medium, which was based on melanocyte growth medium (31) and exclusively differentiated hESCs into melanocytic lineages,3 contains dexamethasone (0.05 µmol/L, Sigma), insulin-transferrin-selenium (ITS, 1x, Sigma), linoleic acid-BSA (1 mg/mL, Sigma), low-glucose DMEM (30%, Life Technologies, Rockville, MD), MCDB 201 (20%, Sigma), L-ascorbic acid (104 mol/L, Sigma), conditioned media of mouse L-Wnt3a cells (American Type Culture Collection, Manassas, VA, 50%), stem cell factor (100 ng/mL, R&D System, Minneapolis, MN), endothelin-3 (100 nmol/L, American Peptide, Sunnyvale, CA), cholera toxin (20 pmol/L, Sigma), the phorbol ester 12-O-tetradecanoylphorbol-13-acetate (50 nmol/L, Sigma), and bFGF (4 ng/mL). Differentiation media for mesenchymal lineages were used as described with modifications (32). Osteogenesis medium consisted of 90% DMEM, 10% FCS, 1x ITS (Sigma), 1 mg/mL LA-BSA (Sigma), 0.1 µmol/L dexamethasone (Sigma), 0.05 mmol/L L-ascorbic acid-2-phosphate (Sigma), and 10 mmol/L ß-glycerophosphate (Sigma). Alkaline phosphatase was detected after 14 days with the Vector Blue alkaline phosphatase substrate kit III (Vector Laboratories, Burlingame, CA). Adipogenic medium contained 90% DMEM, 10% horse serum (Invitrogen), 1x ITS, 1 mg/mL LA-BSA, 1 µmol/L hydrocortisone (Sigma), 0.5 mmol/L isobutylmethylxanthine (Sigma), and 60 µmol/L indomethacin (Sigma) for 10 to 14 days. Accumulation of lipid vacuoles was visualized by staining with Oil Red O (Sigma). Chondrogenic medium contained 90% DMEM, 10% FCS, 1x ITS, 1 mg/mL LA-BSA, 10 ng/mL transforming growth factor-ß1 (R&D System), and 1 mmol/L pyruvate (Sigma) for 10 to 14 days. Chondrogenic differentiation was assayed by expression of type II collagen. As controls, undifferentiated spheres were stained in suspension and then centrifuged onto slides.
Immunocytochemical staining. Cells were fixed with 4% paraformaldehyde and stained with primary antibodies specific for microphthalmia-associated transcription factor (MITF, monoclonal, NeoMarkers), sex-determining region Y (SRY)related transcription factor SOX10 (polyclonal, Abcam, Cambridge, MA), tyrosinase (TYR, monoclonal, Novocasta, Newcastle upon Tyne, United Kingdom), anti-human nuclei MAB1281 (Chemicon, Temecula, CA), and type II collagen (monoclonal, Chemicon). Isotype-matched mouse antibodies or normal rabbit IgG were used as controls. After washings, primary antibody binding was detected using the corresponding Alexa Fluor 488conjugated secondary antibodies (Molecular Probes). Staining was observed by fluorescence microscopy.
RNA isolation, reverse transcription-PCR, and Western blotting. RNA isolation, reverse transcription-PCR (RT-PCR), and Western blot analyses were done using primers and antibodies against dopachrome tautomerase (DCT/DCT), MITF/MITF, and TYR as described (33, 34). TYR primers were TGCCAACGATCCTATCTTCC (sense) and TGAGGAGTGGCTGCTTTTCT (antisense). A mAb against ß-actin (Sigma) was used as a control.
Statistical analysis. To assess the statistical significance of differences, a one-sided Student's t test was done. Ps <0.05 were considered significant, as indicated by asterisks.
| Results |
|---|
|
|
|---|
20%), hESC medium supported cells growing as nonadhesive spheres (Fig. 1A, c). Spheres derived from lesions WM3517 and WM3539 were pigmented, as were their adhesive cultures established in Mel 2% (data not shown). Spheres of WM3523 lesion were nonpigmented, whereas the adherent monolayer cultures grown in Mel 2% from the same specimen were pigmented (Fig. 1A, d).
|
Both WM3517 and WM3539 spheres were negative for hematopoietic markers (data not shown), whereas WM3523 spheres contained hematopoietic cells. Very few of WM3523 primary spheroid cells expressed CD3 (0.99%), CD4 (1.21%), and CD8 (1.04%), but a significant population of WM3523 spheroid cells expressed CD45 (38.90%) and CD20 (41.70%; Fig. 1C). Whereas B cells uniformly expressed CD45 (99.80%) and CD20 (98.10%), adhesive melanoma cells isolated from the same lesion were homogeneously negative for all hematopoietic markers tested (Fig. 1C). These results suggest that the WM3523 spheres contained both melanoma and hematopoietic cells.
Sphere formation of melanoma cells isolated from heterogeneous populations. To ensure the purity of cell population, melanoma cells were clonally isolated from mixed cultures as described in Materials and Methods. All 14 clones of WM3523 were pigmented and were able to produce proliferating melanoma spheres (Fig. 2A). The spheres were grown for >8 months by continuous passage. A minor population, ranging from 5% to 10%, grew adherent and subsequently differentiated into small, oval melanocytic cells with short dendrites (data not shown), whereas the major population grew as melanoma spheres. Flow cytometry analyses of five clones showed that spheroid cells homogeneously expressed melanoma markers CSPG (95.30%), ß3 integrin (96.00%), and MCAM (97.50%; Fig. 2B). A significant fraction of cells expressed E-cadherin (89.60%) but not N-cadherin (2.54%). Hematopoietic markers CD3 (0.76%) and CD4 (0.90%) remained negative, with a small portion expressing CD8 (1.22%), CD45 (1.10%), and CD20 (3.34%; Fig. 2B). The CD20-positive subpopulation coexpressed melanoma-associated MCAM and ß3 integrin and was enriched by FACS (Fig. 2C-D). This indicates that a subpopulation of melanoma spheroid cells express the hematopoietic marker CD20.
|
|
Mesenchymal differentiation of melanoma spheroid cells. Melanocytes are derived from the neural crest during embryonic development. The transient neural crest consists of pluripotent stem cells that give rise to a wide array of lineages, including neurosecretory cells, peripheral neurons, glia, and the cephalic mesenchyme (bone and cartilage; ref. 35). To determine whether WM3523 melanoma spheroid cells can differentiate similarly to neural crest stem cells, we examined neural and mesenchymal differentiation. The cells failed to differentiate into neural lineages in defined medium containing 60% DMEM, 40% MCDB 201, 0.05 µmol/L dexamethasone, 1x ITS, 1 mg/mL LA-BSA, 104 mol/L L-ascorbic acid, and 100 ng/mL bFGF (ref. 36; data not shown). On the other hand, WM3523 melanoma spheroid cells readily differentiated into mesenchymal lineages with varying efficiencies: adipogenic (31.0%), chondrogenic (18.6%), and osteogenic (5.6%; Fig. 4A-B). Few or no undifferentiated melanoma spheroid cells stained for Oil Red O (5.6%), type II collagen (1.6%), or alkaline phosphatase (0.0%). Adherent monolayer melanoma cells established in Mel 2% showed significant potential for adipogenesis only (4.0%; Fig. 4B). These results suggest that multipotent stem cells are enriched in melanoma spheroid populations isolated in stem cell growth medium.
|
The percentage of differentiated mesenchymal cell types varied considerably among clones. Of six tested, clones 4, 6, and 11 could differentiate into melanogenic, adipogenic, chondrogenic, and osteogenic lineages. Other clones were either tripotent (melanogenic, adipogenic, and chondrogenic lineages), bipotent (melanogenic and adipogenic), or unipotent (melanogenic). The mesenchymal differentiation capacity of melanoma spheroid cells persisted in long-term cultures up to 8 months, albeit with decreased efficiency (particularly in osteogenic differentiation). Melanoma spheroid cell lines WM3517 and WM3539 showed differentiation capacity for the melanocytic lineage only (data not shown).
Multipotent melanoma spheroid cells derived from established melanoma cell lines. We explored whether a stem cell population could be isolated from long-established melanoma cell lines. A total of 18 cell lines were tested in stem cell culture conditions using hESC medium. Spheroid phenotypes developed in WM115 and WM239A, a pair of primary and metastatic melanoma cell lines derived from the same patient (37). When adherent cultures of WM115 cells (Fig. 5A, a) were exposed to hESC medium, spheres appeared after
7 days (Fig. 5A, b). These spheroid cells consistently formed new spheres when separated into single cells (Fig. 5A, c). Adipogenic, osteogenic, and chondrogenic differentiation was extensively induced under appropriate conditions in WM115 spheroid cells but not in the adherent population (Fig. 5A, d-f and B). Similar differentiation capacities were observed in WM239A spheroid cells established in stem cell medium (data not shown).
|
Multipotent melanoma spheroid cells are capable of forming tumors in vivo and self-renewing after transplantation. We examined the tumorigenic capacity of WM115 and WM3523 spheroid cells by s.c. injection in SCID mice. All mice injected with WM115 spheroid cells (n = 5), or WM3523 spheroid cells (clone 4, n = 5; clone 6, n = 3) developed tumors (Fig. 6A). The majority of tumors were observed between 28 and 40 days. Tumors consisted of large cells with abundant eosinophilic cytoplasm, oval to irregular nuclei, and dominant nucleoli. Most tumors also contained giant tumor cells (data not shown). Their melanocytic origin was confirmed by positive staining for melanin and not for hemosiderin (Fig. 6A; data not shown). These results suggest that melanoma spheroid cells isolated in stem cell medium are tumorigenic.
|
To address whether multipotent melanoma spheroid cells differed in tumorigenicity from adherent monolayer melanoma cells, we implanted melanoma spheroid cells or adherent monolayer cells into Cytoxan-treated SCID mice at 2 x 105 cells per mouse, an amount that usually does not induce tumors. After
35 days, mice transplanted with spheroid cells had developed pigmented tumors, whereas tumors were not observed in mice injected with adherent cells. When mice were sacrificed 70 days after injection, three animals in the spheroid group (n = 5) had small to large tumors compared with only one small tumor in one of the adherent groups (n = 5). Total tumor weight and volume from the spheroid group were significantly larger than the adherent group (Fig. 6B). This suggests that melanoma spheroid cells isolated in hESC culture conditions are more tumorigenic.
Multipotent stem cells are enriched in the CD20+ fraction of melanoma spheres. We consistently observed CD20+ populations in WM3523 and WM115 melanoma spheroid cells but not in the corresponding adherent populations. Individual CD20+ tumor cells could be detected by immunohistochemistry in
20% of metastatic melanoma lesions, supporting our in vitro observations (data not shown). We did cell sorting to determine whether the stem cell population was within CD20+ fractions. Both positive and negative fractions from WM3523 and WM115 proliferated extensively after sorting. Their phenotypes were confirmed by flow cytometry (data not shown). The CD20+ fractions of WM3523 cells formed larger spheres compared with the CD20 fraction. In WM115 cells, only the CD20+ fraction proliferated as spheres, whereas the CD20 fraction remained as single cells (data not shown). These data suggest that the stem cell population may reside within the CD20+ fraction.
The CD20+ or CD20 fractions of WM3523 and WM115 were then subjected to differentiation. Whereas WM115 CD20 fraction remained in suspension, the other three populations adhered to substrate, indicating their differentiation potentials (data not shown). Although similar percentages showed immunoreactivity for MITF in both CD20+ and CD20 fractions from both spheroid cell lines after melanocytic differentiation, only CD20+ fractions showed substantial potential for mesenchymal differentiation (Fig. 6C-D). These data confirm that multipotent stem cells are enriched in the CD20+ fraction of melanoma spheroid cells isolated from fresh tumor lesions and established cell lines.
| Discussion |
|---|
|
|
|---|
Our studies reveal that melanoma lesions can contain a subpopulation with stem cell properties and a fraction of more differentiated tumor cells. The adherent population established in vitro under standard conditions displays spindle to epithelioid morphology. In general, these cells reflect the stage of tumor progression from which they were initially derived, and those cells from metastatic lesions are tumorigenic in mice (27). They are characterized for their expression of melanoma-associated antigens such as MCAM or ß3 integrin, which facilitate invasion and metastasis (16, 17). The second population, described for the first time here, can differentiate and self-renew. This population is characterized by its ability to form spheres. Sphere formation was initially observed in cultured neural stem cells (38). Cells within neural spheres have stem cell properties that manifest as self-renewal and multilineage differentiation potential (39). Recently, sphere formation was found when stem cells from a variety of normal and tumor tissues were isolated (3, 5, 40, 41), suggesting that sphere formation may be a common growth characteristic of stem cells.
It is not surprising that melanoma spheroid cells are capable of mesenchymal differentiation, because mesenchymal and melanocytic cells may originate from the same embryonic tissue, the neural crest (35). Differentiation of human melanomas into mesenchymal lineages has also been described in fat and osteocartilaginous differentiation (2024). Differentiating cells were often multinucleated, their cultures could not be maintained for extended periods of time, and their differentiation was irreversible. Furthermore, melanoma spheroid cells gave rise to cells that expressed both melanocytic and mesenchymal markers. These data confirmed that the mesenchymal progenitors are not derived from contaminating normal mesenchymal stem cells but rather are a property of the tumor itself.
In sphere-forming melanoma cell lines, WM3517 and WM3539, spheroid cells were able to undergo only melanogenic differentiation, suggesting they might arise from a cell at a later stage of differentiation, such as a lineage-committed melanocyte precursor cell. Multipotent WM3523 melanoma spheroid cells had a stable capacity for self-renewal over prolonged culture periods. Clones of WM3523 spheroid cells showed differences in their stability of differentiation potential. Over time in culture, some clones could no longer differentiate into all four cell lineages but only into three, two, or one suggesting the control mechanisms for each differentiation lineage is unique.
Neoplastic melanocytic cells frequently exhibit characteristics of other neural crest derivatives both in vitro and in vivo. Differentiation of melanoma cells into neural lineages has been well shown (1214); however, in this study, melanoma spheroid cells failed to differentiate into neural lineages. The differentiation medium contains bFGF, which has been used to induce neural differentiation of hESCs and bone marrowderived stem cells (36, 42, 43). In this case, the plasticity of melanoma spheroid cells was limited.
Multipotent melanoma spheroid cells isolated from fresh tumors persist in culture for a long time (8 months) when passaged at clonal densities and as tumor xenografts. Similar multipotent melanoma spheroid cells can also be isolated from established cell lines. Importantly, multipotent melanoma spheroid cells can be serially recloned from a minimum of two cells during 8 months in culture. We have provided evidence that this subpopulation of melanoma cells is able to self-renew and meet other criteria of stem cells. Moreover, melanoma spheroid cells have differentiation potential similar to neural crest stem cells, supporting the notion that melanomas may arise from a transformed melanocyte stem cell. Recent studies suggest that neural crest stem cells persist in the skin in adult animals and are capable of differentiating into neurons, smooth muscle cells, Schwann cells, adipocytes, and melanocytes (41, 44, 45). Lineage-committed melanocyte stem cells have also been reported in mouse hair follicles (46). In humans, equivalent stem cells have not yet been identified but potentially exist in adult skin to maintain homeostasis and to repair damage after injury. These long-lived stem cells may accumulate mutations and become a candidate for transformation. With its capacity for self-renewal, this subpopulation of transformed stem cells may subsequently initiate and sustain malignancy.
Increasing evidence supports this scenario. A link between epithelial cancer and bone marrowderived cells (most likely mesenchymal stem cells) has been shown in a mouse model of gastric cancer. Stem cells were recruited into gastric glands, differentiated into gastric epithelial cells, and developed into intraepithelial cancer (47). Moreover, mesenchymal stem cells transduced with the telomerase hTERT gene display neoplastic potential and contributes to mesenchymal tumor formation (48). These results show that stem cells can be transformed under appropriate conditions and give rise to malignancy. Alternatively, a transformed, differentiated melanocyte may have undergone a dedifferentiation process and regained stem cell properties such as self-renewal (1). Within neural crest derivatives, dedifferentiation of one lineage into a precursor pool that then gives rise to other lineages has been well shown (49, 50). In addition, results from chronic myelogenous leukemia indicate that a lineage-restricted progenitor or mature cell can acquire stem cell privileges after oncogenic transformation (51, 52).
The loss of E-cadherin seems important for epithelial-mesenchymal transitions, which facilitate morphogenesis during development and tumor progression (melanomas; refs. 53, 54). In this study, the sustained expression of E-cadherin was observed in both WM3523 melanoma spheroid cells (89.60%) and its adherent melanoma counterparts (99.6%; data not shown). Only a minor fraction of both spheroid and adherent populations of WM115 express E-cadherin. These results suggest that E-cadherin expression is not critical for stem cell properties of melanoma spheroid cells.
We have discovered, however, that a small subpopulation of CD20+ melanoma cells harbors multipotent stem cells, as in the case of WM115 melanoma spheroid cells. WM3523 melanoma spheroid cells could maintain sphere-forming capacity even among the CD20 population; however, these negative cells had limited capacity to undergo mesenchymal differentiation. Most interestingly, CD20 has been identified by gene expression profiling as one of the top 22 genes that define aggressive melanomas (55). In metastatic melanomas, we have identified individual CD20+ tumor cells (data not shown). Monoclonal antibodies against CD20 have become a standard treatment for non-Hodgkin's lymphoma (56). CD20 seems a potential target for melanoma as well, although a correlation between differentiation ability and tumorigenicity is still under investigation by comparing CD20+ with CD20 fractions.
In summary, our studies clearly show the presence of a stem cell population in melanomas. Like all stem cells, melanoma spheroid cells are also capable of proliferation, differentiation, and self-renewal. In addition, melanoma spheroid cells possess higher tumorigenicity. Understanding the highly tumorigenic, stem cell origin of melanomas has important implications for efficient therapy.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank James Hayden for support with photography pigmentation of cell pellets, Gian Ascione for editorial assistance, and the staff at the Flow Cytometry Facility for their analyses.
| Footnotes |
|---|
Received 4/19/05. Revised 7/13/05. Accepted 8/ 2/05.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
K. A. Hassan, G. Chen, G. P. Kalemkerian, M. S. Wicha, and D. G. Beer An Embryonic Stem Cell-Like Signature Identifies Poorly Differentiated Lung Adenocarcinoma but not Squamous Cell Carcinoma Clin. Cancer Res., October 15, 2009; 15(20): 6386 - 6390. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Bertolini, L. Roz, P. Perego, M. Tortoreto, E. Fontanella, L. Gatti, G. Pratesi, A. Fabbri, F. Andriani, S. Tinelli, et al. Highly tumorigenic lung cancer CD133+ cells display stem-like features and are spared by cisplatin treatment PNAS, September 22, 2009; 106(38): 16281 - 16286. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. G. Chen, R. D. Leapman, G. Zhang, B. Lai, J. C. Valencia, C. O. Cardarelli, W. D. Vieira, V. J. Hearing, and M. M. Gottesman Influence of Melanosome Dynamics on Melanoma Drug Sensitivity J Natl Cancer Inst, September 16, 2009; 101(18): 1259 - 1271. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Short and D. T. Curiel Oncolytic adenoviruses targeted to cancer stem cells Mol. Cancer Ther., August 1, 2009; 8(8): 2096 - 2102. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Pietra, C. Manzini, M. Vitale, M. Balsamo, E. Ognio, M. Boitano, P. Queirolo, L. Moretta, and M. C. Mingari Natural killer cells kill human melanoma cells with characteristics of cancer stem cells Int. Immunol., July 1, 2009; 21(7): 793 - 801. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Z. Ratajczak, D.-M. Shin, and M. Kucia Very Small Embryonic/Epiblast-Like Stem Cells: A Missing Link To Support the Germ Line Hypothesis of Cancer Development? Am. J. Pathol., June 1, 2009; 174(6): 1985 - 1992. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Vlashi, K. Kim, C. Lagadec, L. D. Donna, J. T. McDonald, M. Eghbali, J. W. Sayre, E. Stefani, W. McBride, and F. Pajonk In Vivo Imaging, Tracking, and Targeting of Cancer Stem Cells J Natl Cancer Inst, March 4, 2009; 101(5): 350 - 359. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Trosko REVIEW PAPER: Cancer Stem Cells and Cancer Nonstem Cells: From Adult Stem Cells or from Reprogramming of Differentiated Somatic Cells Vet. Pathol., March 1, 2009; 46(2): 176 - 193. [Abstract] [Full Text] [PDF] |
||||
![]() |
Hongling Du and H. S. Taylor Reviews: Stem Cells and Female Reproduction Reproductive Sciences, February 1, 2009; 16(2): 126 - 139. [Abstract] [PDF] |
||||
![]() |
B. A. Emmenegger and R. J. Wechsler-Reya Stem Cells and the Origin and Propagation of Brain Tumors J Child Neurol, October 1, 2008; 23(10): 1172 - 1178. [Abstract] [PDF] |
||||
![]() |
I. Zalaudek, A. A. Marghoob, A. Scope, B. Leinweber, G. Ferrara, R. Hofmann-Wellenhof, G. Pellacani, H. P. Soyer, and G. Argenziano Three Roots of Melanoma Arch Dermatol, October 1, 2008; 144(10): 1375 - 1379. [Full Text] [PDF] |
||||
![]() |
B. Bussolati, S. Bruno, C. Grange, U. Ferrando, and G. Camussi Identification of a tumor-initiating stem cell population in human renal carcinomas FASEB J, October 1, 2008; 22(10): 3696 - 3705. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Simeone Pancreatic Cancer Stem Cells: Implications for the Treatment of Pancreatic Cancer Clin. Cancer Res., September 15, 2008; 14(18): 5646 - 5648. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. T. Kawasaki, E. M. Hurt, T. Mistree, and W. L. Farrar Targeting Cancer Stem Cells with Phytochemicals Mol. Interv., August 1, 2008; 8(4): 174 - 184. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Xiao, Y. Ye, K. Yearsley, S. Jones, and S. H. Barsky The Lymphovascular Embolus of Inflammatory Breast Cancer Expresses a Stem Cell-Like Phenotype Am. J. Pathol., August 1, 2008; 173(2): 561 - 574. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sekulic, P. Haluska Jr, A. J. Miller, J. G. De Lamo, S. Ejadi, J. S. Pulido, D. R. Salomao, E. C. Thorland, R. G. Vile, D. L. Swanson, et al. Malignant Melanoma in the 21st Century: The Emerging Molecular Landscape Mayo Clin. Proc., July 1, 2008; 83(7): 825 - 846. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E. Eyler and J. N. Rich Survival of the Fittest: Cancer Stem Cells in Therapeutic Resistance and Angiogenesis J. Clin. Oncol., June 10, 2008; 26(17): 2839 - 2845. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Takaishi, T. Okumura, and T. C. Wang Gastric Cancer Stem Cells J. Clin. Oncol., June 10, 2008; 26(17): 2876 - 2882. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Zabierowski and M. Herlyn Melanoma Stem Cells: The Dark Seed of Melanoma J. Clin. Oncol., June 10, 2008; 26(17): 2890 - 2894. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Zhang, C. Balch, M. W. Chan, H.-C. Lai, D. Matei, J. M. Schilder, P. S. Yan, T. H-M. Huang, and K. P. Nephew Identification and Characterization of Ovarian Cancer-Initiating Cells from Primary Human Tumors Cancer Res., June 1, 2008; 68(11): 4311 - 4320. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Stefanello, S. Romussi, P. Signorelli, M. Caniatti, M. DiGiancamillo, P. Roccabianca, and G. Avallone Primary Osseous Melanoma in the Tibia of a Dog J. Am. Anim. Hosp. Assoc., May 1, 2008; 44(3): 139 - 143. [Abstract] [Full Text] [PDF] |
||||
![]() |
L Ricci-Vitiani, A Pagliuca, E Palio, A Zeuner, and R De Maria Colon cancer stem cells Gut, April 1, 2008; 57(4): 538 - 548. [Full Text] [PDF] |
||||
![]() |
K. Engelmann, H. Shen, and O. J. Finn MCF7 Side Population Cells with Characteristics of Cancer Stem/Progenitor Cells Express the Tumor Antigen MUC1 Cancer Res., April 1, 2008; 68(7): 2419 - 2426. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Avery-Kiejda, X. D. Zhang, L. J. Adams, R. J. Scott, B. Vojtesek, D. P. Lane, and P. Hersey Small Molecular Weight Variants of p53 Are Expressed in Human Melanoma Cells and Are Induced by the DNA-Damaging Agent Cisplatin Clin. Cancer Res., March 15, 2008; 14(6): 1659 - 1668. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Liu, C. Ginestier, E. Charafe-Jauffret, H. Foco, C. G. Kleer, S. D. Merajver, G. Dontu, and M. S. Wicha BRCA1 regulates human mammary stem/progenitor cell fate PNAS, February 5, 2008; 105(5): 1680 - 1685. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. B Dirks Brain tumour stem cells: the undercurrents of human brain cancer and their relationship to neural stem cells Phil Trans R Soc B, January 12, 2008; 363(1489): 139 - 152. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sabatino, Y. Zhao, S. Voiculescu, A. Monaco, P. Robbins, L. Karai, B. J. Nickoloff, M. Maio, S. Selleri, F. M. Marincola, et al. Conservation of Genetic Alterations in Recurrent Melanoma Supports the Melanoma Stem Cell Hypothesis Cancer Res., January 1, 2008; 68(1): 122 - 131. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Hansford, A. E. McKee, L. Zhang, R. E. George, J. T. Gerstle, P. S. Thorner, K. M. Smith, A. T. Look, H. Yeger, F. D. Miller, et al. Neuroblastoma Cells Isolated from Bone Marrow Metastases Contain a Naturally Enriched Tumor-Initiating Cell Cancer Res., December 1, 2007; 67(23): 11234 - 11243. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Tang, B. T. Ang, and S. Pervaiz Cancer stem cell: target for anti-cancer therapy FASEB J, December 1, 2007; 21(14): 3777 - 3785. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Mimeault and S. K. Batra Interplay of distinct growth factors during epithelial mesenchymal transition of cancer progenitor cells and molecular targeting as novel cancer therapies Ann. Onc., October 1, 2007; 18(10): 1605 - 1619. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Parmiani, V. Russo, A. Marrari, G. Cutolo, C. Casati, L. Pilla, C. Maccalli, L. Rivoltini, and C. Castelli Universal and Stemness-Related Tumor Antigens: Potential Use in Cancer Immunotherapy Clin. Cancer Res., October 1, 2007; 13(19): 5675 - 5679. [Full Text] [PDF] |
||||
![]() |
B. Stecca, C. Mas, V. Clement, M. Zbinden, R. Correa, V. Piguet, F. Beermann, and A. Ruiz i Altaba Melanomas require HEDGEHOG-GLI signaling regulated by interactions between GLI1 and the RAS-MEK/AKT pathways PNAS, April 3, 2007; 104(14): 5895 - 5900. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Flynn and D. S. Kaufman Donor cell leukemia: insight into cancer stem cells and the stem cell niche Blood, April 1, 2007; 109(7): 2688 - 2692. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Li, D. G. Heidt, P. Dalerba, C. F. Burant, L. Zhang, V. Adsay, M. Wicha, M. F. Clarke, and D. M. Simeone Identification of Pancreatic Cancer Stem Cells Cancer Res., February 1, 2007; 67(3): 1030 - 1037. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Diehn and M. F. Clarke Cancer Stem Cells and Radiotherapy: New Insights Into Tumor Radioresistance J Natl Cancer Inst, December 20, 2006; 98(24): 1755 - 1757. [Full Text] [PDF] |
||||
![]() |
T. M. Phillips, W. H. McBride, and F. Pajonk The Response of CD24-/low/CD44+ Breast Cancer-Initiating Cells to Radiation J Natl Cancer Inst, December 20, 2006; 98(24): 1777 - 1785. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Yang, H. Avila, H. Wang, J. Trevino, G. E. Gallick, Y. Kitadai, T. Sasaki, and D. D. Boyd Plasticity in Urokinase-Type Plasminogen Activator Receptor (uPAR) Display in Colon Cancer Yields Metastable Subpopulations Oscillating in Cell Surface uPAR Density--Implications in Tumor Progression Cancer Res., August 15, 2006; 66(16): 7957 - 7967. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Chin, L. A. Garraway, and D. E. Fisher Malignant melanoma: genetics and therapeutics in the genomic era. Genes & Dev., August 15, 2006; 20(16): 2149 - 2182. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Yu, D. Fang, S. M. Kumar, L. Li, T. K. Nguyen, G. Acs, M. Herlyn, and X. Xu Isolation of a Novel Population of Multipotent Adult Stem Cells from Human Hair Follicles Am. J. Pathol., June 1, 2006; 168(6): 1879 - 1888. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. F. Hezel, A. C. Kimmelman, B. Z. Stanger, N. Bardeesy, and R. A. DePinho Genetics and biology of pancreatic ductal adenocarcinoma. Genes & Dev., May 15, 2006; 20(10): 1218 - 1249. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |