Cancer Research Annual Meeting 2010 Protein Translation and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Irving, J. A.E.
Right arrow Articles by Hall, A. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Irving, J. A.E.
Right arrow Articles by Hall, A. G.
[Cancer Research 65, 9712-9718, November 1, 2005]
© 2005 American Association for Cancer Research

Molecular Biology, Pathobiology and Genetics

Loss of Heterozygosity and Somatic Mutations of the Glucocorticoid Receptor Gene Are Rarely Found at Relapse in Pediatric Acute Lymphoblastic Leukemia but May Occur in a Subpopulation Early in the Disease Course

Julie A.E. Irving1, Lynne Minto1, Simon Bailey2 and Andy G. Hall1

1 Northern Institute for Cancer Research and 2 Royal Victoria Infirmary, Newcastle upon Tyne, United Kingdom

Requests for reprints: Julie A.E. Irving, Northern Institute for Cancer Research, Paul O'Gorman Building, Framlington Place, Newcastle upon Tyne, United Kingdom. Phone: 44-191-246-4369; E-mail: j.a.e.irving{at}ncl.ac.uk.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Glucocorticoids are pivotal in the treatment of children with acute lymphoblastic leukemia (ALL) and have significant antileukemic effects in the majority of children. However, clinical resistance is a significant problem. Although cell line models implicate somatic mutations and loss of heterozygosity (LOH) of the glucocorticoid receptor (GR) gene as a mechanism of in vitro glucocorticoid resistance, the relevance of this mechanism as a cause of clinical resistance in children with ALL is not known. Mutational screening of all coding exons of the GR gene and LOH analyses were done in a large cohort of relapsed ALL. We show that somatic mutations and LOH of the GR rarely contribute to relapsed disease in children with ALL. However, we report the second case of ALL with a somatic mutation of the GR involving a 29-bp deletion in exon 8 and resulting in a truncated protein with loss of part of the ligand-binding domain. There was no evidence of a remaining wild-type allele. Allele-specific PCR detected the mutated clone at day 28 after presentation, which persisted at a low level throughout the disease course before relapse several years later. We hypothesize that the mutated allele present in a leukemic subclone at initial diagnosis was selected for during remission induction with glucocorticoids and contributed to the emergence of a glucocorticoid-resistant cell population.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Synthetic glucocorticoids, such as dexamethasone and prednisolone, are pivotal in the treatment of childhood acute lymphoblastic leukemia (ALL) due to their relatively specific effect of inducing apoptosis in cells derived from the lymphoid lineage. Their effects are mediated by the glucocorticoid receptor (GR), a member of the nuclear receptor superfamily, which has a typically modular structure composed of a DNA-binding domain, a ligand-binding domain, and two transactivation domains. In the absence of ligand, the GR is held in an inactive cytosolic complex that includes several proteins, including heat shock proteins 70 and 90, but after ligand binding the complex dissociates and the ligand-bearing receptor translocates to the nucleus, modulating the transcriptional activity of numerous target genes by both DNA binding–dependent and DNA binding–independent mechanisms.

The molecular basis of glucocorticoid sensitivity and similarly resistance is poorly understood and is the subject of much debate (most recently reviewed in refs. 1–4). However, in vitro and mouse model studies indicate that a DNA binding–dependent mechanism with direct activation or repression of target genes is necessary for steroid-induced lymphocytolysis (5–7). Inherited germ line alterations have been identified in individuals with endocrinological glucocorticoid resistance syndromes and include both point mutations and small deletions of the GR gene (8–13). In cell line models too, the acquisition of a steroid-resistant phenotype is frequently associated with complete or partial deletion or point mutations in the GR gene (5, 14–17). Mutations are found in all domains of the GR protein and cause a functional disruption that alters glucocorticoid responsiveness (18). The majority of in vitro studies have been carried out with the CCRF-CEM cell line originally derived from a child with T-cell ALL at relapse (19). This cell line carries the L753F mutation in exon 9 of the hGR and was recently detected in archived lymph node biopsy material from the patient from whom the cell line was derived (20). This was the first reported example of a somatic mutation in the hGR in a patient with ALL. The fact that the mutation was present in only a subpopulation of the cells and that it renders the GR functionally hemizygous suggests that hGR mutations, if they occur, may be selected for during steroid therapy and contribute to clinical resistance. This suggests that the most apt time to investigate the presence of GR mutations in clinical samples is at relapse after glucocorticoid-based chemotherapy, particularly because in vitro sensitivity assays show that leukemic blasts at relapse are 20- to 300-fold more resistant to glucocorticoids than at diagnosis (21).

In this study, we have screened the entire coding region of the GR for somatic mutations and loss of heterozygosity (LOH) in a large cohort of relapse blasts from children with ALL after prolonged glucocorticoid therapy. We show that both mutation and LOH of the hGR can be identified at relapse but that this only occurs in a minority of cases and describe the second case of ALL with somatic mutation of the GR in vivo.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cell culture. CCRF-CEM cells were maintained in RPMI 1640 supplemented with 10% fetal bovine serum at 37°C and grown in a humidified atmosphere containing 5% CO2.

Clinical details of patient cohort. Cases comprised 50 children (<16 years) diagnosed with ALL between 1981 and 1998 while resident in the Northern Region of England. All diagnoses, remission, and relapse events were pathologically confirmed. Patients were treated according to several different protocols, all of which included glucocorticoid administration during remission induction and subsequent phases of therapy. Studies were done with permission of the local ethics committee.

Clinical history of patient 8871. Patient 8871 presented at age 2 years with a WBC count of 9.2 x 109/L. Immunophenotypic markers were typical of common ALL (TDT+, CD19+ CD10+, and HLA-DR+) and the blasts were CD34+ (71%) with an L1 morphology. Cytogenetic analyses detected normal metaphases as well as those bearing a t(8:14)(q24:q11). Cerebrospinal fluid (CSF) contained four blasts with 70 RBCs and, therefore, by definition was considered CSF negative. Induction chemotherapy included 40 mg/m2 prednisolone for 5 weeks, two additional 5-day pulses during intensive treatment, and monthly prednisolone for 5 days at the same dose. A day 8 marrow sample showed 72% blasts, but clinical remission was achieved by day 28. The patient also received anthracyclines and etoposide as well as intrathecal methotrexate as central nervous system (CNS) prophylaxis. Eighteen months into treatment, he relapsed with CNS disease. Relapse treatment included craniospinal radiotherapy and prednisolone. A further relapse with testicular disease occurred 15 months after relapse treatment began and he then received a bone marrow transplant. Neither prednisolone nor dexamethasone was used at this stage. Bone marrow relapse occurred 10 months later and palliation included prednisolone and vincristine. He died 3 months later.

DNA extraction and PCR. Genomic DNA was extracted from mononuclear cell preparations of peripheral blood or bone marrow aspirates or CCRF-CEM cells using either a standard phenol chloroform method or QIAmp DNA Minikit (Qiagen Ltd., Crawley, Sussex, United Kingdom). Selected exons and flanking intronic sequences were amplified using PCR in 50 µL reaction volume containing 50 to 100 ng DNA, 2.5 mmol/L MgCl2, 100 µmol/L deoxynucleotide triphosphate, 0.2 µmol/L each of forward and reverse primers, 1.25 units Taq polymerase (AmpliTaq Gold, Applied Biosystems, Warrington, United Kingdom), and 1x accompanying PCR buffer. Primer pairs were either designed using OMIGA software (Accelrys, Cambridge, United Kingdom) using variables recommended by Transgenomic (Crewe, United Kingdom) or were those described in Ruiz et al. (12). Sequences of forward and reverse primers, the appropriate annealing temperature for each pair, and size of the amplicons are given in Supplementary Data.

PCR conditions were an initial 10-minute denaturation at 95°C, a touchdown protocol of 20 seconds at 94°C, 1 minute at +7°C above annealing temperature, and 1 minute at 72°C (–0.5°C for 14 cycles) followed by 20 cycles of 20 seconds at 94°C, 1 minute at optimal annealing temperature, and 1 minute at 72°C with a final 7-minute extension at 72°C. Synthesis of an appropriately sized amplicon was confirmed by standard agarose gel electrophoresis.

Heteroduplex formation and denaturing high-performance liquid chromatography. Before denaturing high-performance liquid chromatography (DHPLC), DNA heteroduplexes were formed in a thermal cycler as follows: initial denaturation (95°C, 5 minutes) and annealing/stabilization (start at 94°C for 2 minutes with a –1°C touchdown until 4°C). DHPLC was done using a Wave 3500 system (Transgenomic) with a DNA Sep cartridge and a gradient of 0.1 mol/L triethyl ammonium acetate in 25% acetonitrile against 0.1 mol/L triethyl ammonium acetate. The running conditions and the selected temperature to induce partial denaturation of the each amplicons were predicted by Wavemaker software (Transgenomic) and are shown in Supplementary Data. Sample injection volume was 10 µL and eluted PCR products were detected using a UV detector set at 260 nm.

To prevent false-negative results that may occur due to both mutation and LOH of the GR in the same sample, all amplicons showing homoduplex peaks were spiked with a similar amount of known wild-type amplicons determined from area under curve readouts of the homoduplex peaks. Heteroduplex formation was then carried out and the samples were rerun by DHPLC. All samples that showed altered chromatographic profiles indicative of a genetic change were reamplified and rerun by DHPLC. If the altered pattern was replicated, samples were subsequently sequenced as described below.

Microsatellite analysis. Primers for microsatellite analysis of the dinucleotide repeat at the D5S207 locus were obtained from Research Genetics Inc. (Huntsville, AL). The forward primer was fluorescently labeled using a Beckman WellRed dye D3. PCR was done in a Perkin-Elmer 9700 GeneAmp PCR system (Applied Biosystems). One microliter of each PCR product was combined with 40 µL deionized formamide and 0.25 µL size standard 400 (Beckman Coulter UK, High Wycombe, Bucks, United Kingdom) labeled with Beckman WellRed dye D1 and analyzed using CEQ2000XL (Beckman Coulter UK) for automatic sizing of fragments using a fluorescent detection method.

Sequencing. PCR product (100 µL) was purified using a QIAquick PCR purification kit (Qiagen) with a final elution volume of 30 µL and then sequenced using both forward and reverse primers with the ABI Version 3 BigDye terminator cycle sequencing kit and analyzed on an ABI Prism DNA sequencer (Applied Biosystems). Sequence alignments were carried out using OMIGA software. The nomenclature used for single nucleotide polymorphisms (SNP) follows that of Bray and Cotton (18) and uses the Genbank accession no. NM_000176 as the reference sequence. The National Center for Biotechnology Information (NCBI) SNP annotation is also quoted.

Reverse transcription-PCR. Total RNA was extracted from 5 x 106 patient cells and CCRF-CEM cells using a RNeasy kit (Qiagen) following the protocol of the manufacturer. First-strand cDNA synthesis was then carried out with 3 µg RNA using a Superscript kit (Invitrogen Ltd., Paisley, United Kingdom) primed with random hexamers according to the guidelines of the manufacturer. cDNA (3 µL) was then used in a PCR reaction with primers positioned in GR exons 7 (forward primer sequence GTACGACCAATGTAAACACA) and 9 (reverse primer sequence CTCGGGGAATTCAATACT). The products were visualized by standard methods.

Allele-specific PCR. Allele-specific PCR was done with a forward primer spanning the 29-bp deletion (AAAGCCATTGTTGCAG) and a wild-type reverse primer (ACCAACATCCACAAACTG). PCR was carried out with 50 to 100 ng genomic DNA extracted from bone marrow aspirates taken at various intervals during the clinical course of patient 8871, and amplicons were visualized by standard agarose gel electrophoresis.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Somatic mutations in GR are rarely found at relapse in childhood acute lymphoblastic leukemia. The entire coding region of the GR {alpha} (exons 2-9a, inclusive) was screened at the genomic level by DHPLC in a cohort of 50 relapsed ALL blasts. DHPLC chromatographic profiles were scored as homoduplex, heteroduplex, or homoduplex with altered retention time (see Table 1). For exons 2b, 3, 4, 6, and 7, all samples showed single homoduplex peaks both before and after spiking, indicative of a wild-type GR sequence. In exon 2a, two samples showed distinctive homoduplex and heteroduplex peaks, which after sequencing were identified as bearing both E22E and R23K SNPs (rs6189 and rs6190; Fig. 1). Similarly, in exon 2c, altered chromatographic profiles found in six samples were found after sequencing to be due to the presence of the N363S SNP (rs6195). For exons 5 and 9, homoduplex and heteroduplex peaks were identified both before and after spiking. For exon 5 amplicons, 14 samples scored as heteroduplex before spiking were found to be heterozygous for the intronic IVSD –16 G/T SNP (rs6188) that precedes the start of exon 5. In addition, four samples that scored as homoduplex prespiking were scored as heteroduplex after spiking with a characterized sample known to be homozygote (GG) and were shown after sequencing to be homozygote (TT) for this SNP. Similarly, seven samples with heteroduplexes of exon 9 amplicons were identified as being heterozygote for the synonymous N766N T/C SNP (rs6196) and three samples showing heteroduplexes after spiking were found to be CC homozygotes.


View this table:
[in this window]
[in a new window]

  		Table 1. Summary of DHPLC mutational screening of the GR in childhood ALL at relapse

 


View larger version (11K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 1. DHPLC chromatograms of GR amplicons showing homoduplex peaks associated with wild-type sequences and heteroduplex peaks associated with SNPs.

 
For exon 8 amplicons, all samples were judged as generating a homoduplex profile; however, one sample (patient 8871) reproducibly showed a single homoduplex peak with a reduced retention time, eluting at 5.4 minutes rather than 6 minutes (Fig. 2A). Direct sequencing of exon 8 amplicons from the relapsed sample from patient 8871 revealed a deletion of 29 bp causing the creation of a premature stop codon 42 bp downstream. The resultant protein is predicted to be truncated with the latter 14 amino acids deviating from the wild-type sequence with partial loss of the steroid-binding domain (Fig. 2B). Analyses of remission samples, which served as a source of constitutive DNA, confirmed that this {Delta}702 mutation was not present in the germ line of this patient but was a somatic mutation associated with the leukemic blasts.



View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 2. A, DHPLC chromatograms of exon 8 amplicons showing the reduced retention time of amplicons bearing the {Delta}702 mutation from patient 8871 compared with wild-type. B, diagram of the predicted truncated protein, with the latter 14 amino acids deviating from the wild-type sequence resulting in partial loss of the steroid-binding domain.

 
Expression of the mutated allele by reverse transcription-PCR. Nonsense mutations in GR upstream from the terminal coding exon usually result in loss of mRNA expression (9, 20). We investigated the expression of the {Delta}702 deletion by reverse transcription-PCR (RT-PCR) analyses of exons 7 to 9 of the GR in samples of patient 8871 at relapse and of CCRF-CEM cells, which served as a wild-type control (Fig. 3). Expression of the mutated allele, 29 bp shorter than the wild-type allele, is evident in the patient sample; however, there is complete absence of a wild-type allele. CCRF-CEM cells, as expected, expressed a wild-type allele only.



View larger version (26K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 3. Agarose gel electrophoresis of RT-PCR products of GR exons 7 to 9 in a relapsed sample of patient 8871 compared with CCRF-CEM cells showing the expression of the mutated allele but no evidence of a wild-type product. Minus reverse transcriptase (–RT) controls validated that RNA, and not DNA, served as the template in the generation of these PCR products.

 
Tracking of the {Delta}710 mutation from presentation to bone marrow relapse. Allele-specific PCR using a forward primer spanning the deletion allowed tracking of the GR mutated clone in sequential bone marrow aspirates taken at presentation, clinical remission, CNS and testicular relapse when there was no morphologically detectable bone marrow involvement, at bone marrow relapse, and finally after glucocorticoid-based therapy when there was no clinical response (Fig. 4). The mutated clone was not apparent at presentation or in day 8 bone marrow aspirate that contained 70% blasts but was first evident in a day 28 remission sample and then at a low level throughout the disease course. Using a dilution series of relapse blasts added to normal peripheral blood, the sensitivity of the allele-specific PCR was judged to be between 0.1% and 1%.



View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 4. Agarose gel electrophoresis of allele-specific PCR amplicons in samples from patient 8871 taken at presentation and from sequential samples before bone marrow (BM) relapse showing the presence of the mutated clones at low levels throughout the disease course. *Bone marrow samples analyzed at testicular and CNS relapse were morphologically normal.

 
Loss of heterozygosity at the GR locus is rare at relapse. The absence of a wild-type homoduplex with normal retention time by DHPLC and lack of expression of appropriately sized wild-type mRNA transcripts is indicative of LOH of the wild-type GR allele. To confirm this, microsatellite analyses of the dinucleotide repeat at the D5S207 locus, 200 kb upstream of the GR gene, in samples of patient 8871 were done. The presence of two alleles was apparent in both remission and presentation samples (136 and 138 bp) but only one (138 bp) in the relapse sample, indicative of LOH (Fig. 5). Thus, relapsed blasts in patient 8871 have mutation of one GR allele and loss of the other allele.



View larger version (25K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 5. Microsatellite analyses of the dinucleotide repeat at the D5S207 microsatellite in samples of patient 8871 showing the presence of two alleles (136 and 138 bp) in both remission (i.e., constitutive) and presentation samples but only one (138 bp) allele in the relapse sample, indicative of LOH.

 
To expand investigations of LOH of the GR at relapse in ALL, a cohort of paired relapse and remission samples, the latter serving as constitutive DNA, was analyzed by DHPLC for those GR exons bearing the most common polymorphisms (exons 5 and 9) as well as for the D5S207 microsatellite by capillary electrophoresis. Of 30 paired samples analyzed, 20 were informative for the exon 9 N766N T/C and/or the exon 5 IVSD –16 G/T SNPs and/or the dinucleotide microsatellite. In contrast to relapse samples from patient 8871, all other relapse samples retained heterozygosity at the microsatellite or GR SNP loci.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Despite mutations and LOH of the GR being the predominant mechanism for steroid resistance in leukemic cell line models, our mutational screening study of the entire coding region of the GR in a cohort of ALL samples at relapse found mutations along with LOH in only 1 of 50 patients. This low incidence is in concordance with one other clinical study carried out by Soufi et al. (22), which failed to detect any GR mutations in the leukemic cells of patients with chronic lymphocytic leukemia. The disparity between the incidences of mutations/LOH in cell line models compared with clinical samples may be due to an unusual combination of genetic aberrations coexisting in the most commonly used cell line, CCRF-CEM. The evidence indicates that all parent glucocorticoid-sensitive CCRF-CEM cell lines already have one mutant GR allele (i.e., L753F; ref. 23), which results in an activation-labile receptor with diminished functional capability (14). In addition, they have been recently characterized as carrying a mutation in the MLH1 gene, an important component of the postreplicative mismatch repair pathway (24). This mutation renders them functionally mismatch repair deficient (25, 26); thus, DNA polymerase errors occurring during normal DNA replication fail to be corrected, resulting in an increased basal mutation rate. Thus, the presence of an existing GR mutation concomitant with a higher mutation rate may explain the disparity between leukemia cell lines and clinical samples. This hypothesis is supported from studies in our laboratory, which show that mismatch repair defects are not a predominant feature in childhood ALL (25). Intriguingly, the leukemic blasts from patient 8871 carried the rare t(8;14)(q24;q11), which results in the overexpression of c-myc (27). Due to its interaction with components of the mismatch repair pathway, myc overexpression has been shown to partially inhibit mismatch repair activity (28). The establishment of glucocorticoid-resistant leukemic cell line clones from a parent cell line that is mismatch repair proficient and possesses two wild-type GR alleles may reveal alternative glucocorticoid resistance mechanisms other than GR mutations.

DHPLC screening detected previously characterized SNPs, including the E22E and R23K, N363S, IVSD –16G/T, and N766N (18), and validates our methodologic approach. The allele frequencies determined in our patient cohort are similar to those reported in other studies—E22E and R23K 198G/A and 200G/A, 0.98/0.02; N363S 1220A/G, 0.93/0.07; IVSD –16G/T, 0.78/0.22; and N766N 2403T/C, 0.875/0.125 (29, 30). Although most GR polymorphisms do not affect receptor function, the N363S polymorphism present in ~3% to 6% of the population is associated with increased sensitivity to GC (31). Although one might speculate that patients heterozygous for the N363S SNP may have a better prognosis, the similar frequency of the N363S allele in this relapsed ALL population study compared with a cohort at presentation suggests this is not the case.3

The leukemic blasts at relapse in patient 8871 have loss of one GR allele and a 29-bp deletion of the other allele. Previous studies suggest that mutations in the GR that introduce a premature stop codon are not associated with the expression of mutated mRNA transcripts due to nonsense-mediated decay (9, 20). The {Delta}702 mutation identified in patient 8871 is expressed at the mRNA level; however, to what degree is unclear without a quantitative assessment. However, any resultant protein is predicted to be truncated with loss of the last 75 amino acids of the steroid-binding domain and with the addition of 14 amino acids deviating from the wild-type sequence at its new COOH terminus. A similar predicted protein with loss of the last 67 residues, due to the nonsense mutation Q710X, has been described in a glucocorticoid-resistant subclone of the CCRF-CEM cell line. Radioreceptor assays of this cell line revealed complete loss of ligand-binding activity (15). Thus, the leukemic blasts of patient 8871 at bone marrow relapse with only one mutant {Delta}702 GR allele have no intact functioning GR and were clinically unresponsive to glucocorticoid-based therapy.

Thus, this is the second report of a somatic mutation of the GR in leukemic blasts, the first being the detection of L753F bearing minority subclones in clinical material of the patients from which the cell line CCRF-CEM was derived (20). Acquisition of the {Delta}702 GR allele in our patient could be detected as early as day 28 after presentation and persisted for several years before overt bone marrow relapse. Whether the {Delta}702-bearing clone at this point still possessed a wild-type GR allele, which was subsequently lost during treatment, or whether both GR hits occurred simultaneously is not known. The former possibility seems more likely and in vitro studies have shown that complete or partial deletion of the GR can occur both spontaneously and after treatment with several agents, including bleomycin, chlorambucil, and methotrexate, the latter being a key component of all ALL protocols (32, 33). Nevertheless, whether there was hemi or complete loss of GR functionality, the direct correlation between GR concentration and glucocorticoid sensitivity (34) supports a mechanism in which partial or complete loss of GR functionality in a minority clone results in the selection of this relatively steroid-resistant population during glucocorticoid therapy and may contribute to clinical relapse.

In summary, our results indicate that somatic mutations of the GR rarely contribute to relapsed disease in children with ALL. We describe the second example of a patient with ALL with an acquired mutation of the GR, evident in only a subpopulation of cells soon after diagnosis, emerging as the dominant population at relapse with associated clinical steroid resistance. Our study also suggests that residual blasts enriched after steroid therapy may be the more pertinent cells to investigate glucocorticoid resistance mechanisms because, at presentation, a glucocorticoid-sensitive population may predominate, masking glucocorticoid-resistant minority subclones.


   Acknowledgments
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The authors gratefully acknowledge the Leukaemia Research Fund for funding this study and would like to thank the parents and children for their altruism.


   Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

3 J. Irving, unpublished data. Back

Received 4/26/05. Revised 6/15/05. Accepted 8/ 2/05.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Renner K, Ausserlechner MJ, Kofler R. A conceptual view on glucocorticoid-induced apoptosis, cell cycle arrest and glucocorticoid resistance in lymphoblastic leukemia. Curr Mol Med 2003;3:707–17.[CrossRef][Medline]
  2. Kofler R, Schmidt S, Kofler A, Ausserlechner MJ. Resistance to glucocorticoid-induced apoptosis in lymphoblastic leukemia. J Endocrinol 2003;178:19–27.[Abstract]
  3. Haarman EG, Kaspers GJ, Veerman AJ. Glucocorticoid resistance in childhood leukaemia: mechanisms and modulation. Br J Haematol 2003;120:919–29.[CrossRef][Medline]
  4. Tissing WJ, Meijerink JP, den Boer ML, Pieters R. Molecular determinants of glucocorticoid sensitivity and resistance in acute lymphoblastic leukemia. Leukemia 2003;17:17–25.[CrossRef][Medline]
  5. Powers JH, Hillmann AG, Tang DC, Harmon JM. Cloning and expression of mutant glucocorticoid receptors from glucocorticoid-sensitive and -resistant human leukemic cells. Cancer Res 1993;53:4059–65.[Abstract/Free Full Text]
  6. Liu W, Hillmann AG, Harmon JM. Hormone-independent repression of AP-1-inducible collagenase promoter activity by glucocorticoid receptors. Mol Cell Biol 1995;15:1005–13.[Abstract]
  7. Reichardt HM, Kaestner KH, Tuckermann J, et al. DNA binding of the glucocorticoid receptor is not essential for survival. Cell 1998;93:531–41.[CrossRef][Medline]
  8. Hurley DM, Accili D, Stratakis CA, et al. Point mutation causing a single amino acid substitution in the hormone binding domain of the glucocorticoid receptor in familial glucocorticoid resistance. J Clin Invest 1991;87:680–6.
  9. Karl M, Lamberts SW, Detera-Wadleigh SD, et al. Familial glucocorticoid resistance caused by a splice site deletion in the human glucocorticoid receptor gene. J Clin Endocrinol Metab 1993;76:683–9.[Abstract]
  10. Mendonca BB, Leite MV, de Castro M, et al. Female pseudohermaphroditism caused by a novel homozygous missense mutation of the GR gene. J Clin Endocrinol Metab 2002;87:1805–9.[Abstract/Free Full Text]
  11. Vottero A, Kino T, Combe H, Lecomte P, Chrousos GP. A novel, C-terminal dominant negative mutation of the GR causes familial glucocorticoid resistance through abnormal interactions with p160 steroid receptor coactivators. J Clin Endocrinol Metab 2002;87:2658–67.[Abstract/Free Full Text]
  12. Ruiz M, Lind U, Gafvels M, et al. Characterization of two novel mutations in the glucocorticoid receptor gene in patients with primary cortisol resistance. Clin Endocrinol (Oxf) 2001;55:363–71.[CrossRef][Medline]
  13. Malchoff DM, Brufsky A, Reardon G, et al. A mutation of the glucocorticoid receptor in primary cortisol resistance. J Clin Invest 1993;91:1918–25.
  14. Ashraf J, Thompson EB. Identification of the activation-labile gene: a single point mutation in the human glucocorticoid receptor presents as two distinct receptor phenotypes. Mol Endocrinol 1993;7:631–42.[Abstract/Free Full Text]
  15. Hala M, Hartmann BL, Bock G, Geley S, Kofler R. Glucocorticoid receptor gene defects and resistance to glucocorticoid-induced apoptosis in human leukemic cell lines. Int J Cancer 1996;68:663–8.[CrossRef][Medline]
  16. Strasser-Wozak EM, Hattmannstorfer R, Hala M, et al. Splice site mutation in the glucocorticoid receptor gene causes resistance to glucocorticoid-induced apoptosis in a human acute leukemic cell line. Cancer Res 1995;55:348–53.[Abstract/Free Full Text]
  17. Palmer LA, Harmon JM. Biochemical evidence that glucocorticoid-sensitive cell lines derived from the human leukemic cell line CCRF-CEM express a normal and a mutant glucocorticoid receptor gene. Cancer Res 1991;51:5224–31.[Abstract/Free Full Text]
  18. Bray PJ, Cotton RG. Variations of the human glucocorticoid receptor gene (NR3C1): pathological and in vitro mutations and polymorphisms. Hum Mutat 2003;21:557–68.[CrossRef][Medline]
  19. Foley GE, Lazarus H, Farber S, Uzman BG, Boone BA, McCarthy RE. Continuous culture of human lymphoblasts from peripheral blood of a child with acute leukemia. Cancer 1965;18:522–9.[CrossRef][Medline]
  20. Hillmann AG, Ramdas J, Multanen K, Norman MR, Harmon JM. Glucocorticoid receptor gene mutations in leukemic cells acquired in vitro and in vivo. Cancer Res 2000;60:2056–62.[Abstract/Free Full Text]
  21. Klumper E, Pieters R, Veerman AJ, et al. In vitro cellular drug resistance in children with relapsed/refractory acute lymphoblastic leukemia. Blood 1995;86:3861–8.[Abstract/Free Full Text]
  22. Soufi M, Kaiser U, Schneider A, Beato M, Westphal HM. The DNA and steroid binding domains of the glucocorticoid receptor are not altered in mononuclear cells of treated CLL patients. Exp Clin Endocrinol Diabetes 1995;103:175–83.[Medline]
  23. Geley S, Hartmann BL, Hala M, Strasser-Wozak EM, Kapelari K, Kofler R. Resistance to glucocorticoid-induced apoptosis in human T-cell acute lymphoblastic leukemia CEM-C1 cells is due to insufficient glucocorticoid receptor expression. Cancer Res 1996;56:5033–8.[Abstract/Free Full Text]
  24. Hangaishi A, Ogawa S, Mitani K, et al. Mutations and loss of expression of a mismatch repair gene, hMLH1, in leukemia and lymphoma cell lines. Blood 1997;89:1740–7.[Abstract/Free Full Text]
  25. Matheson EC, Hall AG. Assessment of mismatch repair function in leukaemic cell lines and blasts from children with acute lymphoblastic leukaemia. Carcinogenesis 2003;24:31–8.[Abstract/Free Full Text]
  26. Gu L, Cline-Brown B, Zhang F, Qiu L, Li GM. Mismatch repair deficiency in hematological malignancies with microsatellite instability. Oncogene 2002;21:5758–64.[CrossRef][Medline]
  27. Erikson J, Finger L, Sun L, et al. Deregulation of c-myc by translocation of the {alpha}-locus of the T-cell receptor in T-cell leukemias. Science 1986;232:884–6.[Abstract/Free Full Text]
  28. Partlin MM, Homer E, Robinson H, et al. Interactions of the DNA mismatch repair proteins MLH1 and MSH2 with c-MYC and MAX. Oncogene 2003;22:819–25.[CrossRef][Medline]
  29. Koper JW, Stolk RP, de Lange P, et al. Lack of association between five polymorphisms in the human glucocorticoid receptor gene and glucocorticoid resistance. Hum Genet 1997;99:663–8.[CrossRef][Medline]
  30. Dobson MG, Redfern CP, Unwin N, Weaver JU. The N363S polymorphism of the glucocorticoid receptor: potential contribution to central obesity in men and lack of association with other risk factors for coronary heart disease and diabetes mellitus. J Clin Endocrinol Metab 2001;86:2270–4.[Abstract/Free Full Text]
  31. Huizenga NA, Koper JW, De Lange P, et al. A polymorphism in the glucocorticoid receptor gene may be associated with and increased sensitivity to glucocorticoids in vivo. J Clin Endocrinol Metab 1998;83:144–51.[Abstract/Free Full Text]
  32. Palmer LA, Hukku B, Harmon JM. Human glucocorticoid receptor gene deletion following exposure to cancer chemotherapeutic drugs and chemical mutagens. Cancer Res 1992;52:6612–8.[Abstract/Free Full Text]
  33. Catts VS, Farnsworth ML, Haber M, Norris MD, Lutze-Mann LH, Lock RB. High level resistance to glucocorticoids, associated with a dysfunctional glucocorticoid receptor, in childhood acute lymphoblastic leukemia cells selected for methotrexate resistance. Leukemia 2001;15:929–35.[CrossRef][Medline]
  34. Ramdas J, Liu W, Harmon JM. Glucocorticoid-induced cell death requires autoinduction of glucocorticoid receptor expression in human leukemic T cells. Cancer Res 1999;59:1378–85.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
J. Zhang, R. Ge, C. Matte-Martone, J. Goodwin, W. D. Shlomchik, M. J. Mamula, A. Kooshkabadi, M. P. Hardy, and D. Geller
Characterization of a Novel Gain of Function Glucocorticoid Receptor Knock-in Mouse
J. Biol. Chem., March 6, 2009; 284(10): 6249 - 6259.
[Abstract] [Full Text] [PDF]

Home page
 JNCI J Natl Cancer InstHome page
N. Pottier, W. Yang, M. Assem, J. C. Panetta, D. Pei, S. W. Paugh, C. Cheng, M. L. Den Boer, M. V. Relling, R. Pieters, et al.
The SWI/SNF Chromatin-Remodeling Complex and Glucocorticoid Resistance in Acute Lymphoblastic Leukemia
J Natl Cancer Inst, December 17, 2008; 100(24): 1792 - 1803.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
J. A. Meyers, J. Taverna, J. Chaves, A. Makkinje, and A. Lerner
Phosphodiesterase 4 Inhibitors Augment Levels of Glucocorticoid Receptor in B Cell Chronic Lymphocytic Leukemia but Not in Normal Circulating Hematopoietic Cells
Clin. Cancer Res., August 15, 2007; 13(16): 4920 - 4927.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
P. S. Bachmann, R. Gorman, R. A. Papa, J. E. Bardell, J. Ford, U. R. Kees, G. M. Marshall, and R. B. Lock
Divergent Mechanisms of Glucocorticoid Resistance in Experimental Models of Pediatric Acute Lymphoblastic Leukemia
Cancer Res., May 1, 2007; 67(9): 4482 - 4490.
[Abstract] [Full Text] [PDF]

Home page
 FASEB J.Home page
S. Schmidt, J. A. E. Irving, L. Minto, E. Matheson, L. Nicholson, A. Ploner, W. Parson, A. Kofler, M. Amort, M. Erdel, et al.
Glucocorticoid resistance in two key models of acute lymphoblastic leukemia occurs at the level of the glucocorticoid receptor
FASEB J, December 1, 2006; 20(14): 2600 - 2602.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Irving, J. A.E.
Right arrow Articles by Hall, A. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Irving, J. A.E.
Right arrow Articles by Hall, A. G.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online