Cancer Research SABCS  EMT and Cancer Progression and Treatment
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ogawa, T.
Right arrow Articles by Yorioka, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ogawa, T.
Right arrow Articles by Yorioka, N.
[Cancer Research 65, 9771-9778, November 1, 2005]
© 2005 American Association for Cancer Research


Cell and Tumor Biology

Suberoylanilide Hydroxamic Acid Enhances Gap Junctional Intercellular Communication via Acetylation of Histone Containing Connexin 43 Gene Locus

Takahiko Ogawa1, Tomonori Hayashi1, Masahide Tokunou1, Kei Nakachi1, James E. Trosko3, Chia-Cheng Chang3 and Noriaki Yorioka2

1 Department of Radiobiology and Molecular Epidemiology, Radiation Effects Research Foundation; 2 Department of Molecular and Internal Medicine, Graduate School of Biomedical Sciences, Hiroshima University, Hiroshima, Japan; and 3 National Food Safety Toxicology Center, Department of Pediatrics/Human Development, Michigan State University, East Lansing, Michigan

Requests for reprints: Takahiko Ogawa or Tomonori Hayashi, Department of Radiobiology and Molecular Epidemiology, Radiation Effects Research Foundation, 5-2, Hijiyama Park, Minami Ward, 732-0815 Hiroshima, Japan. Phone: 81-82-261-3131; Fax: 81-82-261-3170; E-mail: tk-ogawa{at}hph.pref.hiroshima.jp or tomo{at}rerf.or.jp.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A histone deacetylase (HDAC) inhibitor, suberoylanilide hydroxamic acid (SAHA), induces apoptosis in neoplastic cells, but its effect on gap junctional intercellular communication in relation to apoptosis was unclear. Therefore, we carried out a comparative study of the effects of two HDAC inhibitors, SAHA and trichostatin-A, on gap junctional intercellular communication in nonmalignant human peritoneal mesothelial cells (HPMC) and tumorigenic ras oncogene–transformed rat liver epithelial cells (WB-ras) that showed a significantly lower level of gap junctional intercellular communication than did HPMC. Gap junctional intercellular communication was assessed by recovery rate of fluorescence recovery after photobleaching. Treatment of HPMC with SAHA at nanomolar concentrations caused a dose-dependent increase of recovery rate without inducing apoptosis. This effect was accompanied by enhanced connexin 43 (Cx43) mRNA and protein expression and increased presence of Cx43 protein on cell membrane. Trichostatin-A induced apoptosis in HPMC but was less potent than SAHA in enhancing the recovery rate. In contrast, treatment of WB-ras cells with SAHA or trichostatin-A induced apoptosis at low concentrations, in spite of smaller increases in recovery rate, Cx43 mRNA, and protein than in HPMC. Chromatin immunoprecipitation analysis revealed that SAHA enhanced acetylated histones H3 and H4 in the chromatin fragments associated with Cx43 gene in HPMC. These results indicate that SAHA at low concentrations selectively up-regulates Cx43 expression in normal human cells without induction of apoptosis, as a result of histone acetylation in selective chromatin fragments, in contrast to the apoptotic effect observed in tumorigenic WB-ras cells. These results support a cancer therapeutic and preventive role for specific HDAC inhibitors.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Histone deacetylase (HDAC) inhibitors have been suggested as potential cancer therapeutic agents because of their different effect on apoptosis in normal and cancer cells (1, 2). The prototype of hydroxamic acid–based hybrid polar molecules, suberoylanilide hydroxamic acid (SAHA), belongs to the second generation of this class of potential therapeutic cancer drugs. It displays a greater potency, on a molar basis, as an inducer of differentiation and, therefore, is expected to be a safer analogue of trichostatin-A (3, 4). SAHA functions as a HDAC inhibitor, with ID50 values close to its optimal differentiation-inducing concentration (5). Acetylation of core nucleosomal histones is, in part, regulated by opposing activities of histone acetyltransferases and HDACs (6, 7); the increased acetylation of histones is associated with genes that are transcriptionally activated (8, 9). Hyperacetylation induced by HDAC inhibitors, such as SAHA, seems to be highly selective and changed the expression of only 2% to 5% of all genes (10). SAHA induces differentiation and/or apoptosis in certain transformed cells through the increased expression of selected genes involved in the cell cycle regulation, tumor suppression, differentiation, and apoptosis (5, 6). It has been reported that increased gene expression of the cell cycle kinase inhibitor p21WAF1 might account for the antitumor property of SAHA (6, 11), but the precise mechanism remains to be elucidated.

Asklund et al. (12) recently reported that 4-phenylbutyrate, an HDAC inhibitor, enhances gap junctional intercellular communication through increased levels of connexin 43 (Cx43) in malignant glioma cells, although precisely how this HDAC inhibitor up-regulates Cx43 has not been delineated. We previously reported that hexamethylene bisacetamide (HMBA), a hybrid polar molecule, enhanced gap junctional intercellular communication in human peritoneal mesothelial cells (HPMC), which are nontumorigenic primary cultured cells. This effect, induced by millimolar concentrations, was accompanied by an increased expression of both mRNA and phosphorylated isoforms of Cx43 (13, 14). Side effects, such as myelotoxicity, have been reported for HMBA (15).

Gap junction channels transport small molecules (<2,000 Da) important in growth regulation signaling between neighboring cells (16, 17). Gap junctional intercellular communication is involved in cell growth, differentiation, and apoptosis; aberrant control of gap junctional intercellular communication might also play an important role in cancer development (1821). Several oncogene products have been shown to reduce gap junction channel permeability and connexin expression in vitro and in vivo (22, 23). It is anticipated that SAHA will work as an enhancer of gap junctional intercellular communication in both normal and cancer cells. It is then important to elucidate (a) whether SAHA enhances Cx43 expression and gap junctional intercellular communication in normal human cells and neoplastically transformed cells, with specific target molecules at lower concentrations than with trichostatin-A; (b) whether apoptosis is induced also in normal cells or only in neoplastic cells; and (c) if so, what the specific mechanisms are. Therefore, this study assesses the effects of SAHA, an HDAC inhibitor, on Cx43 expression and apoptosis in normal and neoplastically transformed cells, from the view of cancer prevention and cancer chemotherapy, along with the underlying molecular mechanisms.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cells. HPMC was harvested from the omental tissues of three consenting patients who had undergone elective abdominal surgery. As described previously, the cells were isolated and cultured in M199 medium, supplemented with L-glutamine, 10% FCS (Intergen, Co., Purchase, NY), penicillin, and streptomycin. All experiments were done using the initial primary culture or the third-passage cells. A cell line previously derived from WB-F344 rat liver epithelial cells was also used in this study (24). WB-ras cells are a neoplastically transformed line originating from infection of WB-F344 rat liver epithelial cells with retrovirus (raszip6) containing viral Ha-ras and the neomycin-resistant gene (25). WB-ras cells were cultured in MEM medium, supplemented with L-glutamine, sodium pyruvate, essential amino acid, nonessential amino acid, MEM-vitamin solution, 7% FCS (Intergen), penicillin, and streptomycin.

Drugs and chemicals. SAHA was kindly provided by Aton Pharma, Inc. (Tarrytown, NY). Trichostatin-A, DMSO, and bovine serum albumin (BSA) were purchased from Sigma Chemical Co. (St. Louis, MO). Trichostatin-A and SAHA were prepared in a 100 mmol/L stock solution in DMSO and stored at –20°C.

Experimental design. Cells were seeded at a density of 1.0 x 104/cm2 in growth medium. After confluence was reached, SAHA or trichostatin-A was added and the culture was continued, whereas DMSO was used as solvent control. The incubation times and the concentrations of SAHA or trichostatin-A used were based on the results of earlier studies (57, 2628). Cells in the present study were incubated for 48 hours at 37°C with 50, 200, 800, and 2,000 nmol/L SAHA or trichostatin-A. These cells were then used for cell proliferation and apoptosis assays. Measurements of gap junctional intercellular communication and assessment of Cx43 protein and acetylated histones H3 and H4 were done by Western blotting and immunocytochemistry, along with mRNA quantitative analyses and chromatin immunoprecipitation assays. The p21WAF1 protein levels were also assessed.

Analysis of cell growth and cell cycle. To assess the effect of SAHA on cell proliferation, viable cells were stained with a tetrazolium salt, 4-[3-(4-iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]-1,3-benzene disulfonate (WST-1, Dojindo Laboratories, Kumamoto, Japan; ref. 29). In the present experiments, HPMC was seeded at a density of 5.0 x 103 per well in a 96-well plate. After culture for 24 hours, the cells were exposed to the medium containing SAHA or DMSO. SAHA was added to basal medium at final concentrations of 50, 200, 800, and 2,000 nmol/L; staining was done after 24 and 48 hours. The absorbance at 450 nmol/L (with reference at 650 nmol/L) was measured with microtiter plate spectrophotometer (EXPERT 98, ASYS HITEC GmbH, Linz, Austria). The results are expressed as the ratios of viable treated cells compared with the untreated control sample (arbitrary 1 unit). For cell cycle analysis, cells were trypsinized, slowly resuspended in 70% ethanol in PBS at 4°C for 5 minutes, washed in PBS, and incubated for 30 minutes in PBS containing 0.05 mg/mL propidium iodide (Sigma), and 1 mg/mL RNaseI (Sigma). The cell suspension was then analyzed on flow cytometry (BD Biosciences, San Jose, CA).

Assessment of apoptosis by Annexin V/propidium iodide staining. Cells were stained with FITC-labeled Annexin V for exposure of phosphatidylserine on the cell surface as an indicator of apoptosis using a FACScan flow cytometer, following the instructions of the manufacturer (BD Biosciences). Briefly, SAHA- or trichostatin-A–treated cells (5 x 105-10 x 105) for 24 and 48 hours were collected by centrifugation at 3,500 x g for 2 minutes and washed with 500 µL of PBS with 1% FCS thrice. The washed cells were resuspended in 180 µL PBS with 1% FCS and 0.5 µL FITC-labeled Annexin V and 1 µL propidium iodide, from MEBCYTO Apoptosis kit (MBL, Nagoya, Japan), were added to the cell suspension. After reaction for 5 minutes at room temperature, 10,000 cells were analyzed with FACScan. Obtained data were processed to the quadrant population analysis, using CellQuest software (BD Biosciences). The living cell population was determined as cells that were negative for both Annexin V and propidium iodide (distributed in the lower left of quadrant). The results are expressed as the percentage of living cell numbers.

Fluorescence recovery after photobleaching assay for gap junctional intercellular communication. The procedure was a modified version of the standard method for measuring gap junctional intercellular communication by quantitative fluorescence recovery after photobleaching (30, 31). Assays were done using an ACAS Ultima laser cytometer (Meridian Instruments, Inc., Okemos, MI). After bleaching of randomly selected cells with a microlaser beam, the rate of transfer of 5,6-carboxyfluorescein diacetate (Molecular Probes, Inc., Eugene, OR) from the adjacent labeled cells back into bleached cells was calculated. Recovery of fluorescence was examined after 0.5 minute and the recovery rate was calculated as percentage per minute (i.e., the percentage of photobleached fluorescence). The recovery rate was corrected for the loss of fluorescence measured in unbleached cells, and results are expressed as the ratio (mean ± SD) of recovery rate relative to that of untreated control cells.

Extraction of Cx43 RNA. Cells were grown in 6 cm dishes and were prepared as described previously. In brief, after 48 hours of incubation, the cells were trypsinized and suspended in M199 medium containing 10% FCS or MEM containing 7% FCS. After cells were washed once with PBS, 100 µL RNAlater (Ambion, Austin, TX) was added to pellets, which were then stored in a freezer until use. Total RNA was isolated from cells by using QIAshredder and RNeasy Mini kits (Qiagen, Inc., Chatsworth, CA). The initial strand of cDNA was synthesized from 500 ng of RNA extracts in a volume of 20 µL using avian myeloblastosis virus reverse transcriptase XL (TaKaRa, Otsu, Japan) priming with random 9-mers at 42°C for 10 minutes. The cDNA strand was stored at –20°C until use. Expression of hCx43 and rCx43 mRNAs was evaluated by real-time reverse transcription-PCR (RT-PCR) based on the TaqMan method. In brief, PCR was done in an ABI PRISM 7900 sequence detector (Perkin-Elmer/Applied Biosystems, Foster City, CA) in a final volume of 20 µL. The PCR mixture contained 10 mmol/L Tris-HCl buffer (pH 8.3; Perkin-Elmer/Applied Biosystems), 50 mmol/L KCl, 1.5 mmol/L MgCl2, 0.2 mmol/L deoxynucleotide triphosphate mixture, 0.5 units of AmpliTaq Gold (Perkin-Elmer/Applied Biosystems), 0.2 µmol/L primers, and probe. The primer and probe sequences for gene amplification were as follows: (a) hCx43, 5-GGAAAGAGCGACCCTTACCAT-3 (forward primer), 5-AGGAGCAGCCATTGAAATAAGCATA-3 (reverse primer), and 5-CTGAGCCCTGCCAAAGA-3 (probe); (b) glyceraldehyde-3-phosphate dehydrogenase (GAPDH): the housekeeping gene, 5-AATTCCATGGCACCGTCAA-3 (forward primer), 5-CCAGCATCGCCCCACTT-3 (reverse primer), and 5-CC ATCACCATCTTCCAGGAGCGA GA-3 (probe); (c) rCx43; 5-ATCAGCATCCTCTTCAAGTCTGTCT-3 (forward primer), 5-CAGGGATCTCTCTTGCAGGTGTA-3 (reverse primer), and 5-CCTGCTCATCCAGTGGT-3 (probe). The TaqMan probes carried a 5-FAM reporter label, and 3' minor groove binder and nonfluorescence quencher groups were synthesized by Applied Biosystems. The determination of rGAPDH used the TaqMan rodent GAPDH control reagents (Applied Biosystems). The AmpliTaq Gold enzyme was activated by heating for 10 minutes at 95°C and all genes were amplified by a first step of heating for 15 seconds at 95°C followed by 1 minute at 60°C for 50 cycles.

Quantification for Cx43 messenger RNA. For the construction of standard curves of positive controls, the total RNA of HPMC was reverse-transcribed into cDNA and serially diluted in water in 5 or 6 log steps to give 4-fold serial dilutions of cDNA from ~100 ng to 100 pg. This cDNA serial dilution was prepared once for all examinations done in this study and stored at –20°C. The coefficient of linear regression (r) for each standard curve was calculated. When the cycle threshold value of a sample was substituted in the formula for each standard curve, the relative concentration of hCx43, GAPDH, rCx43, or rGAPDH could be calculated. To normalize for differences in the amount of total RNA added to each reaction mixture, GAPDH was selected as an endogenous RNA control. The data represent the average expression of target genes: expression relative to GAPDH ± SD from three independent cultures.

Immunoblotting. Cells were grown to confluence in 6 cm dishes and were cultured with SAHA or DMSO. At the end of the given treatment period, the monolayers were rinsed thrice with ice-cold PBS and disposed of according to the extraction method. Nuclear extracts: Trypsinized cells were washed in PBS and resuspended in cell lysis buffer of Nuclear/Cytosol Fractionation Kit (BioVision, Inc., Mountain View, CA) and cells were then treated according to the protocol of the manufacturer. Whole cell samples: Lysates were prepared with ice-cold lysis buffer containing 20 mmol/L TBS (pH 7.5); 1% Triton X-100; 150 mmol/L NaCl; and 1 mmol/L each of EDTA, EGTA, ß-glycerophosphate, Na3VO4, and phenylmethylsulfonyl fluoride, 2.5 mmol/L sodium PPi, and 1 µg/mL leupeptin. The lysates were then sonicated. The samples were diluted 1:4 in water, and their protein concentrations were determined using detergent-compatible protein assay (Bio-Rad Corp., Richmond, CA). Samples (30 µg for Cx43, 15 µg for histones and p21WAF1) of protein were then dissolved in Laemmli sample buffer, separated on 12.5 (for Cx43) and 15% polyacrylamide gels (for acetylated histones H3/H4 and p21WAF1), and transferred to polyvinylidene difluoride (PVDF) membranes (Bio-Rad). As an internal control to determine whether equal amounts of protein had been loaded on to the gel, the PVDF membranes were stripped and reprobed with anti–{alpha}-tubulin (T5168, Sigma) mouse monoclonal antibody (p21WAF1 and Cx43). After being washed with distilled water, the membranes were scanned with a flathead scanner, and total band density as amount of loaded protein was analyzed by NIH Image. The Cx43, acetylated histones H3/H4, or p21WAF1 contents of the various samples were determined by incubating them with anti-Cx43 monoclonal antibody (diluted 1:2,000; Chemicon International, Inc., Temecula, CA), antiacetylated histone H3 or H4 antibody (diluted 1:1,000; Upstate Biotechnology, Lake Placid, NY), and anti-p21WAF1 protein monoclonal antibody (F-5; Santa Cruz Biotechnology, Inc., Santa Cruz, CA). Next, a horseradish peroxidase–conjugated secondary antibody (diluted 1:2,000; Amersham Co., Arlington Heights, IL) and an enhanced chemiluminescence detection reagent (Renaissance Western blot chemiluminescence reagent; NEN Life Science Products, Inc., Boston, MA) were added. The average control value was assigned an arbitrary value of 1 unit, and relative band intensities were standardized to this arbitrary unit. Exposed films were scanned using a flathead scanner, and band density was quantified by NIH Image.

Indirect immunofluorescence and confocal microscopy. HPMC and WB-ras cells were cultured as described previously. The cells were plated on a Lab-Tek Chamber Slide (Nalge Nunc Int., Naperville, IL) before culture with SAHA or DMSO. The cells were then washed twice in PBS and fixed in 95% methanol/5% acetic acid for 1 minute at room temperature before being washed and permeabilized thrice with 0.1% Triton X-100–PBS (PBST), and then incubated in 5% BSA for 60 minutes. After this, slides were incubated overnight at 4°C in anti-Cx43 monoclonal antibody (Chemicon) at a 1:400 dilution, and antiacetylated histone H3 polyclonal antibody at a 1:200 dilution (Upstate Biotechnology). Next, the cells were washed thrice with PBST and incubated in Alexa 546–conjugated goat anti-mouse antibody and Alexa 488–conjugated goat anti-rabbit antibody (Molecular Probes) at a dilution of 1:500 for 1 hour, in dark conditions. The slides were then washed thrice in PBST and once in PBS before being mounted in Gel/Mount (Biomeda, Corp., Foster City, CA). Finally, the cells were examined by Zeiss LSM 510 laser-scanning confocal microscope (Carl Zeiss International, Jena, Germany).

Chromatin immunoprecipitation assay. HPMC was plated at a density of 2 x 106 cells/6 cm dish and incubated overnight at 37°C with 5% CO2. The next day, cells were cultured with SAHA (2,000 nmol/L) for 0, 2, or 24 hours. Chromatin immunoprecipitation assay was done according to the protocol of the manufacturer (32). DNA extracted from both immunoprecipitation steps was purified by phenol/chloroform extraction and ethanol precipitation, and analyzed by real-time RT-PCR. The same Cx43 primers and probe for the real-time RT-PCR analysis were used to carry out real-time PCR of Cx43 DNA with samples obtained from chromatin immunoprecipitation experiments. The amplification and detection procedures were identical to the real-time RT-PCR analysis.

Statistical analysis. Data were analyzed using Statview II software (Apple Computer, Inc., Cupertino, CA). The two-tailed unpaired t test was used in comparing SAHA-treated cultures with control cultures; differences were considered significant at P < 0.05. Results are expressed as the mean ± SD.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Suberoylanilide hydroxamic acid inhibits human peritoneal mesothelial cell growth without inducing morphologic changes. Figure 1A1 shows the results of the WST-1 assay of viable cell numbers. In preliminary experiments, WST-1 staining of HPMC (i.e., absorbance at 450 nm) was found to increase linearly with the number of viable cells from 1 x 103 to 1 x 105 per well in a 96-well plate (data not shown). SAHA, at 800 and 2,000 nmol/L, seemed to suppress cell proliferation of HPMC when compared with the cells incubated in the untreated control, but this was not associated with any loss of cell viability as determined by trypan blue exclusion (data not shown). Phase-contrast micrographs of control confluent HPMC revealed uniform monolayers of polygonal cells that clearly exhibited contact inhibition (Fig. 1A2, a); SAHA (2,000 nmol/L) did not change morphology of the HPMC even after 48 hours (Fig. 1A2, b). On the other hand, WB-ras cells revealed spindle-shaped morphologies and loss of contact inhibition (Fig. 1A2, c), and some of these cells became rounded with detached from the dishes (Fig. 1A2, d).



View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. SAHA-induced growth suppression occurred only at high concentrations, and SAHA induced neither morphologic changes nor apoptosis even with accumulation of acetylated histones in HPMC. A1, SAHA time course and dose response in HPMC. Viable cell number was analyzed by WST-1 assay. Measurement at each time point was done in quadruplet. Points, mean; bars, SD. A2, phase-contrast micrographs. HPMC and WB-ras cells were cultured on Lab-Tek chamber slides with (b and d) or without (a and c) SAHA (2,000 nmol/L) for 48 hours. Bar, 100 µm. B, Western blot analysis of acetylated histones H3 and H4 in HPMC. Histones were isolated by nuclear extraction as described in Materials and Methods from the cells cultured for indicated hours and with indicated concentrations of SAHA (B1). Acetylation was detected by using antiacetylated H3 and H4 antibodies. Lane C, untreated HPMC or WB ras cells (control).

 
Suberoylanilide hydroxamic acid time and dose dependently accelerates acetylation of histones H3 and H4. We next determined the level of histone acetylation at each time point after culture with SAHA. Samples were collected from nuclear fractions of the cells cultured with SAHA (2,000 nmol/L) for 2, 4, 9, 24, and 48 hours, or with various concentrations (50, 200, 800, and 2,000 nmol/L) of SAHA for 48 hours. Western blot analysis showed that levels of acetylated histones H3 and H4 in untreated HPMC were low, and that accumulation of both acetylated histones occurred at 2 hours after SAHA addition. This accumulation continued for 48 hours (Fig. 1B1). Incubation for 48 hours with SAHA resulted in accumulation of acetylated histones, which reached a peak at 800 nmol/L and was sustained at 2,000 nmol/L (Fig. 1B1). In contrast, histone H3 was weakly acetylated in untreated WB-ras cells. Treatment of WB-ras cells with SAHA resulted in accumulated acetylated histones H3 and H4, which reached a peak at 2,000 nmol/L (Fig. 1B2).

Suberoylanilide hydroxamic acid induces apoptosis in WB-ras cells, but not in human peritoneal mesothelial cells. Analyses of the cell cycle and apoptosis, using propidium iodide and Annexin V/propidium iodide, respectively, were done at 24 and 48 hours after culturing confluent cells with SAHA or trichostatin-A. SAHA exerted minimal effects on cell cycle progression in HPMC. Treatment for 24 hours with SAHA reduced the S-phase fraction (8.4% control versus 2.6% SAHA 2,000 nmol/L) but did not significantly alter the G0-G1 and G2-M populations, whereas no subdiploid (apoptotic) population was detected. Treatment of HPMC with 50 to 2,000 nmol/L SAHA did not cause apoptotic cell death or reduce the living cell population in contrast to trichostatin-A, which dose-dependently induced apoptosis at >200 nmol/L. Both SAHA and trichostatin-A induced apoptotic cell death in WB-ras cells, although trichostatin-A showed greater potency (Fig. 2A).



View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. A, SAHA induced apoptosis in WB ras cells but not in HPMC. Cells were stained with FITC labeled Annexin V and propidium iodide after treatment with trichostatin-A or SAHA. The living cell population was defined as cells that were negative for both Annexin V and propidium iodide, being expressed as the percentage of cell numbers distributed in each quadrant. Results are means of at least three experiments; P values show significance levels compared with control (C). Columns, mean percentage of living cells in HPMC (gray, treated with trichostatin-A; white, SAHA) or WB-ras cells (dark gray, trichostatin-A; black, SAHA). B, SAHA induced p21WAF1 protein in HPMC. HPMC was cultured with SAHA (2,000 nmol/L) for the indicated hours; lane C, untreated HPMC. Protein extracts (15 µg) were prepared and resolved on 15% SDS gels; p21WAF1 protein was detected with the mouse monoclonal anti-p21WAF1 antibody (F-5); the membrane was stripped and reprobed with {alpha}-tubulin as a loading control.

 
Suberoylanilide hydroxamic acid induces transient expression of p21WAF1. The effect of SAHA on p21WAF1 protein levels was examined by Western blot analysis. HPMC was cultured with and without SAHA for 2, 4, 9, 24, and 48 hours. After culturing with SAHA, p21WAF1 protein levels slightly increased at 2 hours, reached a peak at 9 hours, and decreased to control level after 48 hours treatment (Fig. 2B).

Suberoylanilide hydroxamic acid enhances gap junctional intercellular communication in human peritoneal mesothelial cell and WB-ras cells. Figure 3A shows typical digitized images obtained by the fluorescence recovery after photobleaching assay. After photobleaching, sequential scans detected the recovery of fluorescence in the bleached cells: The dye was transferred to photobleached cells through gap junctional intercellular communication from surrounding nonbleached cells. Recovery of fluorescence after photobleaching was much more rapid in HPMC cultured with SAHA (Fig. 3A, SAHA) than in untreated cells (Fig. 3A, control). SAHA was more efficient than trichostatin-A in enhancing the recovery rate in HPMC in a concentration-dependent manner. In WB-ras cells, both SAHA and trichostatin-A treatments also increased the recovery rate. Although their recovery levels were much lower, their enhancing rates relative to the control were no less than those in HPMC (Fig. 3B).



View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. A, typical digitized fluorescence images on fluorescence recovery after photobleaching and plots of fluorescence recovery after photobleaching are shown. After culture with 2,000 nmol/L SAHA for 48 hours, HPMC was labeled with 5,6-carboxyfluorescein diacetate. Suitable fields of cells were identified using a x40 objective lens. Each field was scanned to generate a digital image of fluorescence (Prebleach). After the initial scan, selected cells were photobleached (0 minute, 1-6). Sequential scans were then carried out at 15-second intervals to detect the recovery of fluorescence in bleached cells (0.5 minute, 1-6). Images were digitally recorded for analysis. Several unbleached cells were also monitored to provide control data (7). Typical plots of fluorescence recovery after photobleaching are shown (percentage prebleach versus time). An upward slope indicates the recovery of fluorescence. The percentage recovery of fluorescence over time was determined for each cell, and the data were corrected for background loss of fluorescence in one area (7). Untreated cells were used as the control. B, dose-course analyses of the effect of SAHA or trichostatin-A on gap junctional intercellular communication in HPMC. Gap junctional intercellular communication was estimated by fluorescence recovery after photobleaching assay in the cells cultured with SAHA or trichostatin-A. Results are expressed as the relative recovery rate (RR). The value from an untreated sample of HPMC (C, control) was taken as a unit to determine fold increase after culturing with SAHA or trichostatin-A (this scale is used for WB-ras cells for comparison). Results are means of at least three experiments; P values show significance levels compared with the control. Columns, relative recovery rate in the HPMC (gray, treated with trichostatin-A; white, SAHA) or WB-ras cells (dark gray, trichostatin-A; black, SAHA).

 
Suberoylanilide hydroxamic acid increases phosphorylated isoforms of Cx43. Western blotting was carried out to determine whether gap junctional intercellular communication activity was related to total Cx43 protein level and/or to the extent of Cx43 phosphorylation. Three forms of Cx43 immunoreactive protein (Mr 41,000-43,000) were observed in all samples in HPMC and nontransformed WB-F344 cells, as reported in previous papers (13, 14, 33, 34): A faster migrating band (P0) and two slower migrating adjacent bands (two phosphorylated forms, P1 and P2; Fig. 4A). Densitometric analysis of the results for HPMC showed that SAHA, at all concentrations, induced a significant dose-dependent increase in P1 + P2 (active form of Cx43) and P0 + P1 + P2 (total Cx43), compared with control cells; the increase of P0 with increased SAHA was less significant, compared with that of P1 + P2. As a result, (P1 + P2) / P0 was increased by the treatment. In untreated WB-ras cells, P0 was predominant, and the active forms (P1 + P2) were minor. SAHA also induced an increase in active and total Cx43 protein in WB-ras cells, showing a peak at 800 nmol/L SAHA, although the ratio of (P1 + P2) / P0 was very low compared with that in HPMC (Fig. 4B).



View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. SAHA induced Cx43 protein in HPMC and WB-ras cells. HPMC and WB-ras cells were cultured with or without SAHA for 48 hours at indicated concentrations. A, Western blot analysis of Cx43 protein expression. Protein extracts from whole cells were prepared and resolved (30 µg) on 12.5% SDS/PAGE. Cx43 protein was detected by using mouse monoclonal antibody. WB-F344 (10 µg) cells were used as a positive control of Cx43 and the membrane was then stripped and reprobed with {alpha}-tubulin as a loading control. B, densitometric analysis of Cx43 protein bands in blotting membrane. The value from an untreated sample of HPMC (C, control) was taken as a unit to determine fold increase after culturing with SAHA. Columns, fold increase of Cx43 protein in HPMC (white) or WB-ras cells (black). C, intracellular localization of Cx43 and acetylated histone H3 protein was detected by immunofluorescence microscopy using monoclonal antibodies. Red spots, Cx43; green spots, acetylated histone H3. Images were acquired by confocal microscopy. HPMC: a to e, WB-ras cells; f to j, a (f), control; b (g), c (h), d (i), and e (j) with 50, 200, 800, 2,000 nmol/L SAHA, respectively. Bars, 20 µm (a-e); 10 µm (f-j).

 
The localization of Cx43 protein and acetylated histone H3 was then examined by indirect immunofluorescence cytochemistry. Figure 4C shows immunostaining of the cells for Cx43 (red) and acetylated histone H3 (green) after 48-hour incubation with or without SAHA in HPMC (a-e) or WB-ras cells (f-j). The negative control, in which mouse or rabbit IgG was substituted for the primary antibodies, showed no staining (data not shown). Control cells showed that a few bright red spots (indicating Cx43 labeling) were dominant in cytoplasm rather than at the areas of intercellular contact. Incubation of HPMC with SAHA caused an increase in the number and size of the labeled regions, resulting in the cells displaying linear or dotted labeling along the membrane between cells, in contrast to control cells where a few positive spots were observed in cytoplasm. Although WB-ras cells showed altered immunostaining patterns in the same fashion as HPMC after treatment with SAHA, immunostaining was weaker for Cx43, displaying fewer spots in a nonlinear pattern along the membrane. The fluorescent levels of acetylated histone H3 seemed more prominent and concentrated in the nuclei in SAHA-treated HPMC and WB-ras cells compared with those in untreated cells.

Suberoylanilide hydroxamic acid induces a higher level of Cx43 messenger RNA expression in human peritoneal mesothelial cell than in WB-ras cells. Cx43 mRNA levels, measured by real-time RT-PCR, also increased in both HPMC and WB-ras cells cultured with SAHA in a time-dependent manner. Cx43 mRNA in HPMC increased 3-fold over that of control cells after 48 hours culture with SAHA (Fig. 5A). Subsequently, we analyzed the Cx43 mRNA levels, at various SAHA concentrations in HPMC as well as in WB-ras cells. Cx43 mRNA levels in HPMC and WB-ras cells after 48 hours treatment with various concentrations of SAHA revealed dose-dependent increase of Cx43 mRNA, which is much more remarkable in HPMC (3-fold increase at 2,000 nmol/L) than in WB-ras cells (1.3-fold increase at 2,000 nmol/L; Fig. 5B).



View larger version (18K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Real-time RT-PCR analysis of Cx43 mRNA expression in HPMC and WB-ras cells. A, HPMC was cultured with 2,000 nmol/L SAHA for the indicated hours. B, HPMC and WB-ras cells were cultured with the indicated concentrations of SAHA for 48 hours. The value from untreated control of HPMC was taken as a unit to determine fold increase after culturing with SAHA. Cx43 mRNA levels were normalized by GAPDH mRNA, whose levels did not change during culture with SAHA (data not shown). Results are means of at least three experiments: P values show significance levels compared with control (C). Columns, fold increase of Cx43 mRNA in HPMC (white) or WB-ras cells (black).

 
Suberoylanilide hydroxamic acid increases acetylated histones in chromatin fragments associated with Cx43 gene. Chromatin immunoprecipitation analysis was used to study the mechanism of SAHA-induced expression of Cx43. Chromatin fragments from HPMC cultured with SAHA for 2 and 24 hours were immunoprecipitated with antibodies against acetylated histones H3 and H4. DNA from the immunoprecipitates was isolated, and real-time PCR, using Cx43 primers, was done (Fig. 6A): The amounts of Cx43 gene in acetylated histones H3 and H4 increased remarkably with increased hours of culture with SAHA (Fig. 6B). This observation confirms that histone acetylation is involved in the transcriptional regulation of Cx43 expression, and that Cx43 gene is a selective target for SAHA.



View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. SAHA-induced accumulation of acetylated histones H3 and H4 in the chromatin fragments associated with Cx43 gene. Soluble chromatin from HPMC cultured with 2,000 nmol/L SAHA for 2 or 24 hours was immunoprecipitated with the antibodies against acetylated histone H3/H4. PCR primers used for Cx43 mRNA were also used to amplify the DNA isolated from immunoprecipitated chromatin as described in Materials and Methods. A, the diagrams of real-time PCR analysis of the Cx43 gene indicate that HPMC cultured with SAHA for 2 or 24 hours showed higher amplification levels when compared with untreated control cells. B, the relative amounts of DNA contained in acetylated histones were quantified by real-time PCR analysis. The value from an untreated control (C) was taken as a unit to determine fold increase.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, we showed that low concentrations (50-2,000 nmol/L) of SAHA enhanced gap junctional intercellular communication in normal HPMC via Cx43 gene–associated histone acetylation without incurring apoptosis, whereas the same SAHA treatment of tumorigenic WB-ras cells induced apoptosis along with an increase of gap junctional intercellular communication. When we used WB-vector control cells (WB-neo), 50-2,000 nmol/L SAHA induced no apoptosis in these cells as it was the case in HPMC (data not shown), implying little difference in response to SAHA between rat and human nonmalignant cells. We also showed that SAHA-induced Cx43 gene expression could be ascribed to histone H3/H4 acetylation. Our findings are the first demonstration of the efficacy of SAHA as an inhibitor of HDAC in nonmalignant cells to induce the transcriptional activation of the Cx43 gene through histone acetylation. Furthermore, we showed that SAHA induced apoptosis in ras-transformed cells at a low concentration despite a smaller increase in Cx43 mRNA and protein than in the case of HPMC.

Micromolar concentrations of SAHA have been shown to induce growth arrest and/or apoptosis in various transformed cells; the precise mechanism involved has been discussed with regard to variable transformed cells but not well defined (27, 35, 36). There seem to be two types of tumor cells based on their inability to have functional gap junctional intercellular communication: those whose connexin genes are not transcribed (37, 38) and those whose transcribed connexins have been rendered dysfunctional by a number of mechanisms, including posttranslational modification of connexin proteins by various activated oncogenes (18). Thus, one might expect to find differences in response to SAHA and trichostatin-A between normal cells that express connexins and tumor cells that express either very low levels of connexins or dysfunctional connexins. In confluent HPMC, nanomolar concentrations of SAHA generated a dose-dependent increase of Cx43 mRNA and protein, whereas SAHA induced neither cell cycling arrest nor apoptosis. On the other hand, trichostatin-A induced apoptosis at a concentration (200 nmol/L) that did not increase recovery rate. Because we observed that histone H3 and H4 acetylation was also pronounced in cells treated with nanomolar SAHA, it seems unlikely that this difference mirrors the potency of the two HDAC inhibitors.

The cell cycle checkpoint gene p21WAF1 was most commonly induced in various transformed cells cultured with SAHA (39) through histone acetylation (6, 40). In HPMC, p21WAF1 level was elevated soon after the addition of SAHA and reverted to control level in 48 hours: This time course profile did not parallel the change in Cx43 mRNA levels. Sodium butyrate, an HDAC inhibitor, has been shown to induce G1 arrest and pRb dephosphorylation in 3T3 cells lacking p21WAF1 (41). Richon et al. (6) found that the level of p21WAF1 mRNA decreased within 24 hours after the addition of SAHA similar to our observation in HPMC. In contrast, chromatin immunoprecipitation analysis showed that Cx43 gene-associated histone acetylation increased with increasing hours of culture with SAHA, similar to SAHA-induced expression of Cx43 mRNA, indicating a more probable cause-effect between the two.

Differential response between HPMC and WB-ras cells was noted for SAHA-induced apoptosis, although histones H3/H4 acetylation was observed in both cells treated with nanomolar SAHA. Previous reports have shown that mitochondria played a central role during HDAC inhibitor–mediated apoptotic response (4245). The cellular pathways via mitochondria and other apoptotic genes, targeted by SAHA, might differ between normal and malignant cells. Our results indicate that SAHA might suppress cancer cell growth through up-regulation of gap junctional intercellular communication, but does not cause damage in surrounding normal cells.

The role of SAHA in enhancing gap junctional intercellular communication in nonmalignant cells without serious adverse effects could be a beneficial for cancer prevention. Zhang et al. (46) recently reported that Cx43 displayed gap junction–independent growth inhibition of various tumor cells. Another connexin gene (i.e., Cx26) has been previously shown to be a tumor suppressor gene (47). Therefore, up-regulation of Cx43 or other connexin genes could suppress tumor growth or progression by gap junction–dependent mechanism. Gap junctional intercellular communication is essential for maintaining homeostatic balance and normal differentiation through the modulation of cell growth and arrest. It will also be important to elucidate the role of histone acetylation and related proteins in the transcriptional regulation of Cx43 and other connexin genes in selective tissues or cells. Future study will likely provide some answers to these questions.


    Acknowledgments
 
Grant support: Baxter Limited Renal Division (T. Ogawa and T. Hayashi); Grants-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology of Japan; Ministry of Health and Welfare of Japan; Smoking Research Foundation (K. Nakachi); and National Institute of Environmental Health Sciences grant 5 P42 ES04911 (J.E. Trosko).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Aton Pharma, Inc., a wholly owned subsidiary of Merck & Co., Inc., for providing SAHA.


    Footnotes
 
Note: T. Ogawa and T. Hayashi contributed equally to this work.

Received 1/24/05. Revised 7/29/05. Accepted 8/19/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Marks PA, Jiang X. Histone deacetylase inhibitors in programmed cell death and cancer therapy. Cell Cycle 2005;4:549–51.[Medline]
  2. Papeleu P, Vanhaecke T, Elaut G, et al. Differential effects of histone deacetylase inhibitors in tumor and normal cells—what is the toxicological relevance? Crit Rev Toxicol 2005;35:363–78.[Medline]
  3. Marks PA, Richon VM, Breslow R, Rifkind RA. Histone deacetylase inhibitors as new cancer drugs. Curr Opin Oncol 2001;13:477–83.[CrossRef][Medline]
  4. Melnick A, Licht JD. Histone deacetylases as therapeutic targets in hematologic malignancies. Curr Opin Hematol 2002;9:322–32.[CrossRef][Medline]
  5. Richon VM, Emiliani S, Verdin E, et al. A class of hybrid polar inducers of transformed cell differentiation inhibits histone deacetylases. Proc Natl Acad Sci U S A 1998;95:3003–7.[Abstract/Free Full Text]
  6. Richon VM, Sandhoff TW, Rifkind RA, Marks PA. Histone deacetylase inhibitor selectively induces p21WAF1 expression and gene-associated histone acetylation. Proc Natl Acad Sci U S A 2000;97:10014–9.[Abstract/Free Full Text]
  7. Butler LM, Agus DB, Scher HI, et al. Suberoylanilide hydroxamic acid, an inhibitor of histone deacetylase, suppresses the growth of prostate cancer cells in vitro and in vivo. Cancer Res 2000;60:5165–70.[Abstract/Free Full Text]
  8. Grunstein M. Histone acetylation in chromatin structure and transcription. Nature 1997;389:349–52.[CrossRef][Medline]
  9. Turner BM. Decoding the nucleosome. Cell 1993;75:5–8.[CrossRef][Medline]
  10. Van Lint C, Emiliani S, Verdin E. The expression of a small fraction of cellular genes is changed in response to histone hyperacetylation. Gene Expr 1996;5:245–53.[Medline]
  11. Sambucetti LC, Fischer DD, Zabludoff S, et al. Histone deacetylase inhibition selectively alters the activity and expression of cell cycle proteins leading to specific chromatin acetylation and antiproliferative effects. J Biol Chem 1999;274:34940–7.[Abstract/Free Full Text]
  12. Asklund T, Appelskog IB, Ammerpohl O, Ekstrom TJ, Almqvist PM. Histone deacetylase inhibitor 4-phenylbutyrate modulates glial fibrillary acidic protein and connexin 43 expression, and enhances gap-junction communication, in human glioblastoma cells. Eur J Cancer 2004;40:1073–81.
  13. Ogawa T, Hayashi T, Kyoizumi S, Ito T, Trosko JE, Yorioka N. Up-regulation of gap junctional intercellular communication by hexamethylene bisacetamide in cultured human peritoneal mesothelial cells. Lab Invest 1999;79:1511–20.[Medline]
  14. Ogawa T, Hayashi T, Yorioka N, Kyoizumi S, Trosko JE. Hexamethylene bisacetamide protects peritoneal mesothelial cells from glucose. Kidney Int 2001;60:996–1008.[CrossRef][Medline]
  15. Andreeff M, Stone R, Michaeli J, et al. Hexamethylene bisacetamide in myelodysplastic syndrome and acute myelogenous leukemia: a phase II clinical trial with a differentiation-inducing agent. Blood 1992;80:2604–9.[Abstract/Free Full Text]
  16. Loewenstein WR. The cell-to-cell channel of gap junctions. Cell 1987;48:725–6.[CrossRef][Medline]
  17. Loewenstein WR. Junctional intercellular communication and the control of growth. Biochim Biophys Acta 1979;560:1–65.[Medline]
  18. Trosko JE, Ruch RJ. Cell-cell communication in carcinogenesis. Front Biosci 1998;3:208–36.
  19. Yamasaki H, Naus CC. Role of connexin genes in growth control. Carcinogenesis 1996;17:1199–213.[Free Full Text]
  20. Bruzzone R, White TW, Paul DL. Connections with connexins: the molecular basis of direct intercellular signaling. Eur J Biochem 1996;238:1–27.[Medline]
  21. Evans WH, Martin PE. Gap junctions: structure and function (review). Mol Membr Biol 2002;19:121–36.[CrossRef][Medline]
  22. Trosko JE, Chang CC, Madhukar BV, Klaunig JE. Chemical, oncogene and growth factor inhibition gap junctional intercellular communication: an integrative hypothesis of carcinogenesis. Pathobiology 1990;58:265–78.[CrossRef][Medline]
  23. Klaunig JE, Ruch RJ. Role of inhibition of intercellular communication in carcinogenesis. Lab Invest 1990;62:135–46.[Medline]
  24. Tsao MS, Smith JD, Nelson KG, Grisham JW. A diploid epithelial cell line from normal adult rat liver with phenotypic properties of "oval" cells. Exp Cell Res 1984;154:38–52.[CrossRef][Medline]
  25. De Feijter AW, Ray JS, Weghorst CM, et al. Infection of rat liver epithelial cells with v-Ha-ras: correlation between oncogene expression, gap junctional communication, and tumorigenicity. Mol Carcinog 1990;3:54–67.[Medline]
  26. Munster PN, Troso-Sandoval T, Rosen N, Rifkind R, Marks PA, Richon VM. The histone deacetylase inhibitor suberoylanilide hydroxamic acid induces differentiation of human breast cancer cells. Cancer Res 2001;61:8492–7.[Abstract/Free Full Text]
  27. Richon VM, Webb Y, Merger R, et al. Second generation hybrid polar compounds are potent inducers of transformed cell differentiation. Proc Natl Acad Sci U S A 1996;93:5705–8.[Abstract/Free Full Text]
  28. Leoni F, Zaliani A, Bertolini G, et al. The antitumor histone deacetylase inhibitor suberoylanilide hydroxamic acid exhibits antiinflammatory properties via suppression of cytokines. Proc Natl Acad Sci U S A 2002;99:2995–3000.[Abstract/Free Full Text]
  29. Ishiyama M, Tominaga H, Shiga M, Sasamoto K, Ohkura Y, Ueno K. A combined assay of cell viability and in vitro cytotoxicity with a highly water-soluble tetrazolium salt, neutral red and crystal violet. Biol Pharm Bull 1996;19:1518–20.[Medline]
  30. Trosko JE, Chang CC, Wilson MR, Upham B, Hayashi T, Wade M. Gap junctions and the regulation of cellular functions of stem cells during development and differentiation. Methods 2000;20:245–64.[CrossRef][Medline]
  31. Wade MH, Trosko JE, Schindler M. A fluorescence photobleaching assay of gap junction-mediated communication between human cells. Science 1986;232:525–8.[Abstract/Free Full Text]
  32. Luo RX, Postigo AA, Dean DC. Rb interacts with histone deacetylase to repress transcription. Cell 1998;92:463–73.[CrossRef][Medline]
  33. de Feijter AW, Matesic DF, Ruch RJ, Guan X, Chang CC, Trosko JE. Localization and function of the connexin 43 gap-junction protein in normal and various oncogene-expressing rat liver epithelial cells. Mol Carcinog 1996;16:203–12.[CrossRef][Medline]
  34. Esinduy CB, Chang CC, Trosko JE, Ruch RJ. In vitro growth inhibition of neoplastically transformed cells by non-transformed cells: requirement for gap junctional intercellular communication. Carcinogenesis 1995;16:915–21.[Abstract/Free Full Text]
  35. Chen H, Lin RJ, Xie W, Wilpitz D, Evans RM. Regulation of hormone-induced histone hyperacetylation and gene activation via acetylation of an acetylase. Cell 1999;98:675–86.[CrossRef][Medline]
  36. Vrana JA, Decker RH, Johnson CR, et al. Induction of apoptosis in U937 human leukemia cells by suberoylanilide hydroxamic acid (SAHA) proceeds through pathways that are regulated by Bcl-2/Bcl-XL, c-Jun, and p21CIP1, but independent of p53. Oncogene 1999;18:7016–25.[CrossRef][Medline]
  37. Momiyama M, Omori Y, Ishizaki Y, et al. Connexin26-mediated gap junctional communication reverses the malignant phenotype of MCF-7 breast cancer cells. Cancer Sci 2003;94:501–7.[Medline]
  38. King TJ, Fukushima LH, Donlon TA, Hieber AD, Shimabukuro KA, Bertram JS. Correlation between growth control, neoplastic potential and endogenous connexin43 expression in HeLa cell lines: implications for tumor progression. Carcinogenesis 2000;21:311–5.[Abstract/Free Full Text]
  39. Marks PA. The mechanism of the anti-tumor activity of the histone deacetylase inhibitor, suberoylanilide hydroxamic acid (SAHA). Cell Cycle 2004;3:534–5.[Medline]
  40. Bunz F, Dutriaux A, Lengauer C, et al. Requirement for p53 and p21 to sustain G2 arrest after DNA damage. Science 1998;282:1497–501.[Abstract/Free Full Text]
  41. Vaziri C, Stice L, Faller DV. Butyrate-induced G1 arrest results from p21-independent disruption of retinoblastoma protein-mediated signals. Cell Growth Differ 1998;9:465–74.[Abstract]
  42. Zhu WG, Lakshmanan RR, Beal MD, Otterson GA. DNA methyltransferase inhibition enhances apoptosis induced by histone deacetylase inhibitors. Cancer Res 2001;61:1327–33.[Abstract/Free Full Text]
  43. Ruefli AA, Ausserlechner MJ, Bernhard D, et al. The histone deacetylase inhibitor and chemotherapeutic agent suberoylanilide hydroxamic acid (SAHA) induces a cell-death pathway characterized by cleavage of Bid and production of reactive oxygen species. Proc Natl Acad Sci U S A 2001;98:10833–8.[Abstract/Free Full Text]
  44. Medina V, Edmonds B, Young GP, James R, Appleton S, Zalewski PD. Induction of caspase-3 protease activity and apoptosis by butyrate and trichostatin A (inhibitors of histone deacetylase): dependence on protein synthesis and synergy with a mitochondrial/cytochrome c-dependent pathway. Cancer Res 1997;57:3697–707.[Abstract/Free Full Text]
  45. Herold C, Ganslmayer M, Ocker M, et al. The histone-deacetylase inhibitor trichostatin A blocks proliferation and triggers apoptotic programs in hepatoma cells. J Hepatol 2002;36:233–40.[Medline]
  46. Zhang YW, Kaneda M, Morita I. The gap junction-independent tumor-suppressing effect of connexin 43. J Biol Chem 2003;278:44852–6.[Abstract/Free Full Text]
  47. Lee SW, Tomasetto C, Sager R. Positive selection of candidate tumor-suppressor genes by subtractive hybridization. Proc Natl Acad Sci U S A 1991;88:2825–9.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
G. Zupkovitz, J. Tischler, M. Posch, I. Sadzak, K. Ramsauer, G. Egger, R. Grausenburger, N. Schweifer, S. Chiocca, T. Decker, et al.
Negative and Positive Regulation of Gene Expression by Mouse Histone Deacetylase 1
Mol. Cell. Biol., November 1, 2006; 26(21): 7913 - 7928.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
M. Vinken, T. Henkens, T. Vanhaecke, P. Papeleu, A. Geerts, E. Van Rossen, J. K. Chipman, P. Meda, and V. Rogiers
Trichostatin A Enhances Gap Junctional Intercellular Communication in Primary Cultures of Adult Rat Hepatocytes
Toxicol. Sci., June 1, 2006; 91(2): 484 - 492.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ogawa, T.
Right arrow Articles by Yorioka, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ogawa, T.
Right arrow Articles by Yorioka, N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online