| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology, Pathobiology and Genetics |
1 Human Cancer Genetics Program and 2 Division of Endocrinology, Diabetes and Metabolism, Department of Internal Medicine, The Ohio State University, Columbus, Ohio
Requests for reprints: Lawrence S. Kirschner, Human Cancer Genetics Program, Ohio State University, 544 TMRF, 420 West 12th Avenue, Columbus, OH 43210. Phone: 614-292-1190; Fax: 614-688-4006; E-mail: Lawrence.Kirschner{at}osumc.edu.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Because patient samples are rare, we have generated a mouse model to study this condition. Mice homozygous for a null allele of Prkar1a exhibit embryonic lethality, whereas heterozygotes, like their human counterparts, are tumor prone (7–9). To determine the mechanism by which loss of Prkar1a promotes tumors, we have chosen to use primary cultures of mouse embryonic fibroblasts (MEFs), which lack secondary alterations commonly found in immortalized cell lines. Using Cre-lox technology, we generated Prkar1a–/– MEFs in vitro and compared them with otherwise genetically identical cells. We report that removal of Prkar1a from cells leads to immortalization in the absence of transformation. In probing the molecular basis for this observation, we find that there is strong up-regulation of cyclin D1, which is likely linked to the immortalized phenotype. This increase in cyclin D1 protein levels occurs independently of other known pathways, suggesting that PKA itself functions as a regulator of cyclin D1 protein levels.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Retroviral infections. High titer retroviruses were produced by transient transfection of retroviral constructs using Phoenix-Eco packaging cells (10) by calcium phosphate precipitation (ProFection calcium phosphate kit, Promega, Madison, WI). Passage 2 MEFs were infected with virus and selected for 4 days in the presence of either puromycin (2.5 µg/mL) or hygromycin (400 µg/mL). The following previously described plasmids were used: pBABE-puro, pBABE-puro-Cre, pBABE-hygro (11), and pBABE-puro-cyclin D1 (12). pBABE-hygro-hemagglutinin (HA)-R1A was prepared by subcloning the HA-tagged human PRKAR1A cDNA from pREP4-HA-R1A (13) into the pBABE-hygro vector.
Cell proliferation and synchronization. The 3T3 assay was done essentially as described (14). To assess serum-free growth, 300,000 cells were plated in 100-mm dishes containing complete medium. After 24 hours, cells were trypsinized and counted. The medium in the remaining plates was replaced by serum-free DMEM, and cells were counted every 24 hours. For cell cycle studies, subconfluent MEFs were synchronized by incubation in serum-free DMEM for 72 hours and then stimulated to proliferate by addition of DMEM containing 14% serum. Cells were harvested at the indicated times for Western blotting.
Western analyses. MEFs were lysed in M-PER protein extraction reagent (Pierce, Rockford, IL) unless otherwise stated. Proteins were resolved in SDS-PAGE gels and transferred to nitrocellulose (Pall, East Hills, NY), and the blots were developed with Western lightning reagents (Perkin-Elmer, Boston, MA). The antibodies used in this study were as follows: PKA-R1A, PKA-R2A, PKA-R2B, PKA-CA, and RB (554136) were from BD Biosciences (San Jose, CA). Cyclin D1 (SC-718), cyclin A (SC-596), cyclin E (SC-481), cyclin B1 (SC-245), proliferating cell nuclear antigen (SC-56), p16 (SC-1207), p19 (SC-1063), p21Cip1 (SC-471), cyclin-dependent kinase (CDK) 4 (SC-601), CDK2 (SC-163), and E2F1 (SC-251) were from Santa Cruz Biotechnology (Santa Cruz, CA). p27Kip1 (2552), phosphorylated extracellular signal-regulated kinase (ERK) p44/p42 (9101), ERK p44/p42 (9102), phosphorylated Creb (9196), phosphorylated glycogen synthase kinase 3ß (GSK3ß; 9336), phosphorylated p38 (9216), and p38 (9212) were from Cell Signaling Technologies (Beverly, MA). Monoclonal anti-HA (MMS-101P) was from Covance (Princeton, NJ). Actin (A5060) was from Sigma (St. Louis, MO). PTEN monoclonal antibody was a kind gift from Dr. C. Eng (The Ohio State University, Columbus, OH), and cyclin D3 monoclonal antibody was a gift from Dr. D. Guttridge (The Ohio State University, Columbus, OH).
Quantitative real-time PCR analyses. mRNA was isolated from Prkar1a+/+ and Prkar1a–/– MEFs by Trizol reagent (Invitrogen) and repurified on a RNeasy column (Qiagen, Valencia, CA). RNA (1 µg) was reverse transcribed using iScript cDNA synthesis kit (Bio-Rad, Hercules, CA). Quantitative real-time PCR (qRT-PCR) was done using an iCycler and iCycler SYBR Green reagents (Bio-Rad). Cyclin D1 primers were forward: ATGTGAAGTTCATTTCCAACCC and reverse: TTGACTCCAGAAGGGCTTCA. mRNA fold changes were calculated by the 
Ct method using Gapdh as a standard. All PCR reactions were done in triplicate, and each analysis was representative of two Prkar1a–/– and Prkar1a+/+ cell lines.
Immunofluorescence studies. MEFs were grown on glass coverslips, fixed in 4% paraformaldehyde, and permeabilized using 0.2% Triton X-100 for 6 minutes. After blocking (2% bovine serum albumin/PBS), slides were incubated at 4°C overnight with the primary antibody, washed thrice in PBS, and incubated with FITC-conjugated secondary antibodies (1 hour at room temperature). Cells were mounted using Vectashield containing 4',6-diamidino-2-phenylindole (DAPI; Vector Laboratories, Burlingame, CA) and imaged using a LSM510 confocal microscope (Carl Zeiss, Inc., Thornwood, NY).
Kinase assays. CDK2 kinase assays were done as described (15) using histone H1 as a substrate. CDK4 kinase assays were done as described (16) using glutathione S-transferase (GST)-Rb (791-928) as a substrate. For PKA assays, MEFs were washed in ice-cold PBS and lysed in buffer containing 10 mmol/L Tris-HCl (pH 7.1), 1 mmol/L EDTA, 1 mmol/L DTT, 0.5% NP40, 0.5 mmol/L phenylmethylsulfonyl fluoride, 0.1 mmol/L vanadate, 1 mmol/L NaF, and HALT protease inhibitors (Pierce). Cell lysates were centrifuged 10,000 x g for 20 minutes at 4°C and the supernatants were collected for measurement of free (–cAMP) and total (+cAMP) PKA activity. Reactions were done in 30 µL containing 30 µg protein lysate, 5 µg of 6x His-Creb, 50 mmol/L ATP, 50 mmol/L Tris, 10 mmol/L MgCl2, and 1 mmol/L DTT with and without 5 µmol/L PKA inhibitor and cAMP. The reaction was incubated 30 minutes at 30°C and terminated by boiling in sample buffer. Proteins were subject to Western blot with a phosphorylated Creb antibody and bands were quantitated with J image software.
Phosphatase treatment. Whole-cell lysates from knockout MEFs were made in radioimmunoprecipitation assay buffer containing 50 mmol/L HEPES, 150 mmol/L NaCl, 0.5 mmol/L EDTA, 2.5 mmol/L EGTA, 1 mmol/L DTT, 0.1% Tween, and 10% glycerol with protease inhibitors with and without phosphatase inhibitors (0.1 mmol/L sodium vanadate and 1 mmol/L NaF). Lysates (50 µg) without phosphatase inhibitors were treated with 
phosphatase according to the manufacturer's instructions (New England Biolabs, Beverly, MA). Protein samples were subjected to SDS-PAGE and immunoblotted for cyclin D1 as above.
Reporter assays. MEFs were plated in triplicate in six-well dishes and cotransfected using Superfect (Invitrogen) with a TK-Renilla luciferase plasmid and a plasmid containing firefly luciferase driven by a promoter carrying wild-type (WT) or a mutant (inactive) p53 response elements. After 36 hours, firefly luciferase activity was measured using the dual-luciferase reporter assay system (Promega) and normalized to Renilla luciferase activity. Ras activity was measured using the Ras activation assay kit (Upstate, Waltham, MA) according to the manufacturer's instructions.
Drug treatments. Asynchronous cells were treated with 5 µmol/L H-89 (Upstate) or 50 µmol/L forskolin (Sigma) for 12 hours. For half-life studies, MEFs were treated with cycloheximide for the indicated times and whole-cell lysates were made and then immunoblotted with cyclin D1 antibodies. For analysis of cyclin D1 degradation, asynchronous MEFs were treated with MG132 (30 µmol/L; Sigma) or calpain inhibitor 1 (100 µmol/L; Sigma) for the indicated times, and cells were harvested for preparation of whole-cell lysates. Western blots of the lysates were probed with the cyclin D1 antibody and quantitated as above.
Transient transfections. For transfections, 293T cells were seeded into 100-mm Petri dishes 1 day previously and transfected with either constitutively active PKA-C or dominant-negative PKA plasmids using Superfect (Qiagen) according to manufacturer's recommendations. After 24 hours of transfection, cells were stimulated with zinc sulfate (70 µmol/L) for further 24 hours to induce the expression of R1A after which cells were harvested for protein preparation. All transfections were done a minimum of three times before calculating means and SDs.
Treatment with DNA-damaging agents. MEFs were expanded and plated onto 100-mm plates and grew them overnight to a confluency of 60% to 70%. The cells were washed with PBS and either exposed to UV-C radiation at 40 J/m2 or treated with 3.5 µmol/L doxorubicin for 8 hours. MEFs were harvested after 8 hours of treatment for protein extraction.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Loss of Prkar1a is associated with up-regulation of cyclin D1. Owing to the functional association of cyclins with cell proliferation and cell cycle regulation, we evaluated cyclin levels in asynchronous populations of cells. Unexpectedly, we observed a striking (3.5-fold) up-regulation of cyclin D1 in Prkar1a–/– MEFs compared with the heterozygous and WT cells (Fig. 2A). This elevation in cyclin D1 was observed at early passages (passage <10), at a time when there was no significant difference in the growth rate between knockout and WT cells. Confocal microscopy confirmed the presence of increased cyclin D1 and showed that the protein has increased nuclear retention (Fig. 2B). Consistent with these observations, tumors obtained from Prkar1a+/– mice showed increased nuclear localization of cyclin D1 by immunohistochemistry (Fig. 2C). Other cyclins were not significantly altered in the knockout cells either at the mRNA level (data not shown) or at the protein level (Fig. 2A). In concert with the elevated cyclin D1 levels, an intact RB pathway was demonstrable by normal expression and phosphorylation of RB and normal S-phase reentry kinetics after serum starvation and release as shown by Western blotting (see below).
|
Up-regulation of cyclin D1 in Prkar1a–/– mouse embryonic fibroblasts is independent of other signaling pathways. Because GSK3ß is known to phosphorylate cyclin D1 at the G1-S transition and target it to the cytoplasm for further degradation (18), we examined its activity in the WT and knockout cells. There was no detectable difference between knockout and WT cells, indicating that the alterations in stability and increased nuclear retention are not due to changes in GSK3ß activity (Fig. 3A).
|
B (NF-B; refs. 19–22). GTP-loaded Ras was measured by a pull-down assay as a direct measurement of Ras activity (Fig. 3A), which showed that the active Ras levels were equivalent or even slightly decreased in Prkar1a–/– cells when compared with their WT or heterozygous counterparts. We also measured the levels of the activated (phosphorylated) form of the ERKs p42 and p44. In agreement with the Ras data, no excess accumulation of phosphorylated ERK was detected. Furthermore, changes in phosphorylated p38 levels did not account for the changes in cyclin D1, excluding the possible involvement of mitogen-activated protein kinases (MAPK) in this process (Fig. 3B). Similarly, immunoblotting with an antibody that recognizes all forms of phosphorylated Akt revealed that levels of total and phosphorylated Akt were unchanged in the knockout cells (Fig. 3B). Finally, to determine if increases in cyclin D1 could be attributed to NF-B activation, we used a luciferase reporter gene driven by NF-B response elements to assess the activity of this pathway. This experiment revealed that NF-B activity was not increased in the knockout cells and was, in fact, somewhat reduced.4 At the functional level, we tested if elevated cyclin D1 levels were associated with increased CDK activity. CDK4 and CDK2 activities were measured in WT and knockout cells and found to be essentially unchanged (Fig. 3C). This observation prompted us to look at the amounts of CDK4 physically associated with cyclin D1 by coimmunoprecipitation experiments. This experiment, done either by immunoprecipitation with anti-CDK4 and immunoblotting with cyclin D1 or in the converse fashion, showed that the amount of CDK4 bound to cyclin D1 did not change with loss of Prkar1a (data not shown). Interestingly, there is a consistent up-regulation of p16INK4a levels, a known CDK4/CDK6 inhibitor (see below; ref. 23).
Regulation of cyclin D1 by protein kinase A. To confirm that the increases in cyclin D1 were directly due to increases in PKA activity, we treated WT and knockout cells with the PKA inhibitor H-89 or with forskolin, a stimulator of adenylate cyclase. In both WT and Prkar1a–/– cells, H-89 produced a small but consistent decrease in total cyclin D1 levels at doses where the compound predominantly inhibits PKA (24), whereas forskolin did not alter total cyclin D1 levels (Fig. 4A). Interestingly, we noted a shift in the relative abundance of the cyclin D1 bands, with a decrease in the upper band noted in response to H-89, and an obvious increase in the slower migrating form of cyclin D1 on forskolin treatment. To confirm the identity of the slower migrating form of the protein as a phosphorylated isoform, protein lysates were treated in vitro with phosphatase to induce nonspecific protein dephosphorylation (Fig. 4A, rightmost lanes). This treatment abolished the upper cyclin D1 band with only minimal effects on the lower (presumably unphosphorylated) form of the protein.
|
Immortalization of Prkar1a–/– mouse embryonic fibroblasts is independent of p53/p19ARF and other pathways. To assess for possible non–cyclin D1–mediated effects and to further explore the mechanism of cellular immortalization, we sought to determine if senescence pathways remained intact. Surprisingly, measurement of p53 activity by a luciferase reporter showed that the p53 signaling pathway did not differ significantly between WT and knockout cells (Fig. 5A). Serially passaged Prkar1a–/– and Prkar1a+/+ MEFs showed intact p53, p19ARF, and p16INK4a compared with the tail tumors obtained from Prkar1a+/– mice, which showed evidence for loss of p53 and p19ARF (Fig. 5B). The levels of p16INK4a consistently remained up-regulated in knockout MEFs compared with the WT MEFs, where the levels were seen to decrease with increasing passages. Notably, even in the late-passage (passage 22) Prkar1a–/– MEFS, the p53 pathway remained intact as judged by p53 stabilization and growth arrest (shown by induction of p21Cip1) after exposure to UV and DNA-damaging agents, such as doxorubicin (Fig. 5C). Examination of the tumor suppressor genes involved in cellular senescence detected only moderate down-regulation of p21Cip1 and a marked up-regulation of p27Kip1 (Fig. 5D). Confocal microscopy of p27Kip1 confirmed the notable up-regulation of the protein and further showed that the protein remained localized in the nucleus (Fig. 5E). A similar analysis of p21Cip1 confirmed slight quantitative reductions as well as a redistribution from a predominantly nuclear localization to a mixed cytoplasmic-nuclear distribution (Fig. 5F).
|
|
To confirm that loss of Prkar1a was the primary factor responsible for the observed changes, we reintroduced HA-tagged PRKAR1A (13) into null and WT MEFs to see if the defect could be rescued. Prkar1a–/– cells into which HA-R1A had been reintroduced were synchronized by serum deprivation for 72 hours and harvested at different time points after addition of serum-containing medium. Although not fully reverted to normal, the kinetics of cyclin D1, p27Kip1, and CDK4 in HA-R1A cells were closer to those observed in WT cells (Fig. 6C). Specifically, cyclin D1 levels increased starting from 6 hours, coincident with a decrease of p27Kip1 levels; in addition, the cyclin D1 doublet was detected only at early times after release into the cell cycle, confirming a partial restoration of normal cyclin D1 dynamics. We ascribe the observation that we were only able to observe partial restoration of normal cell cycle regulation to the fact that HA-tagged R1A expression was generally quite poor in the knockout compared with robust expression in WT cells (data not shown).
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The role of increased protein kinase A activity in tumor formation. The most striking observation made in this report is that removal of Prkar1a from primary cells leads to immortalization without transformation. This finding is in contrast to prior studies indicating that down-regulation of PRKAR1A suppressed cell proliferation in a variety of cell types, including prostate and pancreatic cancer cells (27, 28). Similarly, as has been observed in Carney complex tumors (2), we found increased basal and total PKA activity in the Prkar1a knockout cells (Fig. 1C). In the literature, compounds that stimulate PKA in vitro have generated conflicting reports regarding proliferation, with some investigators reporting growth-inhibitory effects, whereas others describe growth promotion (29). The explanation for these apparent discrepancies may lie in the fact that the prior studies were done in immortalized cell lines in tissue culture, whereas we have used primary cells. Observations on cells that have undergone multiple mutations to generate a continuous cell line may not accurately reflect the situation in tumor initiation in vivo.
The fact that we are able to recapitulate one important aspect of tumorigenesis (i.e., immortalization) in this primary cell culture model bespeaks the importance of the proper model system for understanding biological observations. Consistent with the tumor suppressor function in vivo, Prkar1a deficiency prevented culture-induced senescence. In addition to the loss of replicative senescence, knockout of Prkar1a also allows the cells a gain of growth factor independence, a second key feature in the development of cancer (30). However, in order for Carney complex patients to develop aggressive tumors (e.g., thyroid cancer), secondary and/or tertiary mutations must occur in the immortalized cells. This is also modeled nicely in vitro by the fact that introduction of activated Ras into the Prkar1a-null MEFs leads to a transformed phenotype.5
The increase in PKA activity caused by loss of Prkar1a may also provide a model with which to understand benign tumorigenesis induced by activation of PKA caused by mutations in G-protein-coupled receptors (e.g., the thyrotrophin receptor in thyroid adenomas) or in G proteins themselves (e.g., McCune-Albright syndrome or somatotroph pituitary adenomas; ref. 31). In each of these cases, the establishment of autonomous hyperproliferative cells may be due to the immortalizing effect of increased PKA signaling, although, as above, there is little impetus toward malignant transformation in the absence of additional mutations. In fact, down-regulation of PRKAR1A has recently been described in sporadic growth hormone–producing adenomas (32), although mutations in PRKAR1A are rarely, if ever, observed in these tumors (33, 34).
Effects on modulators of cell senescence. Cellular immortalization is an essential step toward malignant transformation of normal cells. In primary MEFs, cellular senescence is mediated via regulators of cell cycle progression, most prominently p53 and p19ARF (35, 36). In Prkar1a knockout cells, p53/p19ARF and RB activity remained intact. We found that p16INK4a levels were up-regulated in the knockout MEFs. p16INK4a can compete with cyclin D1 for binding to CDK4, which may account for the lack of change of CDK4 activity in spite of the increased cyclin D1 levels (37). Together, these observations suggest that loss of Prkar1a immortalizes MEFs without directly impairing the function of p53/p19ARF or the RB pathway. Interestingly, we have observed a consistent up-regulation of p27Kip1, which may also occur at the post-transcriptional level (data not shown). As levels of p27 and cyclin D1 have been shown to correlate with each other (38), this finding is somewhat unsurprising. This observation is likely based on the known association of these proteins, leading to p27Kip1 inhibition of the activity of cyclin D-CDK4 and cyclin E-CDK2 complexes (39, 40). Furthermore, it has also been shown (26) that p27Kip1 stabilizes cyclin D1 and results in the formation of inactive stable complexes with CDK4; thus, up-regulation of p27Kip1 in Prkar1a–/– MEFs may partially explain the increased stability of cyclin D1 in these cells. It is somewhat unusual, however, that p27 retains its nuclear localization, as high levels of nuclear p27 have generally been noted to be growth inhibitory. The relationship between elevation in cyclin D1 and p27 are currently under further investigation.
Relationship between protein kinase A and D-type cyclins in neoplastic growth. D-type cyclins are the major common targets by which cells proliferate in response to environmental signals. Intriguingly, MEF cells that carry a knockout of the Men1 gene also exhibit increased levels of cyclin D1 (41), although if this was a transcriptional or post-transcriptional event is currently unknown. This common pathway provides a molecular link to the overlapping spectrum of tumors in patients with MEN1 and Carney complex, which includes pituitary and adrenal lesions, as well as skin abnormalities (42).
The observation that PKA can affect protein levels adds a new level of complexity to understanding cyclin-mediated cell cycle control. In vitro studies of cyclin D1 have indicated that the protein can be phosphorylated by PKA and that there are three potential PKA phosphorylation sites in the protein, including one in the cyclin box (43). Our data suggest that PKA activation leads to phosphorylation of cyclin D1, although whether this is a direct effect or the result of PKA activation of a secondary kinase is unknown at present. Our interpretation of the data presented here is that the majority of cyclin D1 runs as a singlet at Mr 36,000, whereas the PKA-mediated phosphoisoform of the protein runs at a slightly reduced mobility. The exact nature of this isoform and its immunologic characteristics are under active investigation.
Although cyclin D1 levels have been shown to be elevated in breast cancers, there has been, in general, poor association between levels of elevation and tumor progression and/or prognosis. With the finding that cyclin D1 may be subject to post-translational modification affecting its activity, this question may need to be reconsidered. Interaction between cyclin D1 and estrogen receptor (ER) has been studied in the past (44, 45). However, phosphorylation certainly has the possibility to affect this interaction, and studies have already suggested that phosphorylation of the ER can affect its estrogen responsiveness (46). The implication of these observations for clinical cancers has yet to be addressed experimentally.
Cyclin D1 and cellular immortalization. Overexpression of cyclin D1 is associated with human cancer and is the most common genetic alteration seen in many types of cancers, including breast, head and neck squamous cell carcinomas, and mantle cell lymphomas (47, 48). Although cyclin D1 is overexpressed in oral esophageal squamous cell carcinomas, inactivating mutations of pRB were not observed. Furthermore, cyclin D1 overexpression alone has extended the replicative life span of primary human keratinocytes up to 80 PDs (49). In early studies of immortalized fibroblast lines, cyclin D1 overexpression was reported to enhance cell cycle transit times, although, as seen here, no effect on transformation was observed (50). Intriguingly, in that study, overexpression of cyclin D1 was sufficient to induce partial growth factor independence, similar to what we have observed for the Prkar1a knockout cells. The fact that increased cyclin D1 levels were seen in the early passages (passages 6-8) suggests that up-regulation of cyclin D1 could be an early event in immortalization, although further experiments are needed to determine if this finding is a cyclin D1 effect or is a direct result from PKA dysregulation.
Summary. The data presented in this article provide a good in vitro model for tumor initiation as observed in patients with the Carney complex. The observations presented here indicate an unexpected role for PKA in modulating cell cycle progression through regulation of cyclin D1 and p27Kip1 protein levels. Deregulation of these key cell cycle proteins represents a previously unexplored PKA dependent mechanism for regulation of cell cycle at G0/G1 phase. The findings presented here also describe a novel relationship between PKA and D-type cyclins, with implications for both normal and tumor cell biology.
|
Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank William H. Towns for expert technical assistance, Drs. G. Leone and D. Guttridge for sharing reagents and guidance, Drs. L. Wu and C. Timmers for technical advice, Dr. J. Boss for 6x His-Creb, Dr. M-D. Tsai for GST-Rb, Dr. J. Bertherat for pREP4-HA-R1A, Drs. Stanley Mc Knight and Constantine Stratakis for the dominant-negative and constitutively active PKA plasmids, and Drs S. Jhiang and M. Ringel for critical review of the article.
|
Footnotes |
|---|
4 K.S. Nadella and L.S. Kirschner, unpublished observations.
5 L.S. Kirschner, unpublished observations.
Received 9/ 5/05. Accepted 9/ 7/05.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
regulatory subunit in patients with the Carney complex. Nat Genet 2000;26:89–92.[CrossRef][Medline]
regulatory subunit cause familial cardiac myxomas and Carney complex. J Clin Invest 2000;106:R31–8.
of protein kinase A (PRKAR1A): a tumor-suppressor gene for sporadic thyroid cancer. Genes Chromosomes Cancer 2002;35:182–92.[CrossRef][Medline]
B controls cell growth and differentiation through transcriptional regulation of cyclin D1. Mol Cell Biol 1999;19:5785–99.B p65 by PKA stimulates transcriptional activity by promoting a novel bivalent interaction with the coactivator CBP/p300. Mol Cell 1998;1:661–71.[CrossRef][Medline]
-subunit mutations and the role of genomic imprinting. Endocr Rev 2001;22:675–705. after PKA activation in breast cancer. Cancer Cell 2004;5:597–605.[CrossRef][Medline]
This article has been cited by other articles:
|
|
 |
|
  A. M. Misior, D. A. Deshpande, M. J. Loza, R. M. Pascual, J. D. Hipp, and R. B. Penn Glucocorticoid- and Protein Kinase A-Dependent Transcriptome Regulation in Airway Smooth Muscle Am. J. Respir. Cell Mol. Biol., July 1, 2009; 41(1): 24 - 39. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Bertherat, A. Horvath, L. Groussin, S. Grabar, S. Boikos, L. Cazabat, R. Libe, F. Rene-Corail, S. Stergiopoulos, I. Bourdeau, et al. Mutations in Regulatory Subunit Type 1A of Cyclic Adenosine 5'-Monophosphate-Dependent Protein Kinase (PRKAR1A): Phenotype Analysis in 353 Patients and 80 Different Genotypes J. Clin. Endocrinol. Metab., June 1, 2009; 94(6): 2085 - 2091. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. S. Nadella, G. N. Jones, A. Trimboli, C. A. Stratakis, G. Leone, and L. S. Kirschner Targeted Deletion of Prkar1a Reveals a Role for Protein Kinase A in Mesenchymal-to-Epithelial Transition Cancer Res., April 15, 2008; 68(8): 2671 - 2677. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Yin, G. N. Jones, W. H. Towns II, X. Zhang, E. D. Abel, P. F. Binkley, D. Jarjoura, and L. S. Kirschner Heart-Specific Ablation of Prkar1a Causes Failure of Heart Development and Myxomagenesis Circulation, March 18, 2008; 117(11): 1414 - 1422. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Pavel, K. Nadella, W. H. Towns II, and L. S. Kirschner Mutation of Prkar1a Causes Osteoblast Neoplasia Driven by Dysregulation of Protein Kinase A Mol. Endocrinol., February 1, 2008; 22(2): 430 - 440. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Nesterova, I. Bossis, F. Wen, A. Horvath, L. Matyakhina, and C. A. Stratakis An Immortalized Human Cell Line Bearing a PRKAR1A-Inactivating Mutation: Effects of Overexpression of the Wild-Type Allele and Other Protein Kinase A Subunits J. Clin. Endocrinol. Metab., February 1, 2008; 93(2): 565 - 571. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Mucignat-Caretta, A. Cavaggioni, M. Redaelli, M. Malatesta, C. Zancanaro, and A. Caretta Selective distribution of protein kinase A regulatory subunit RII{alpha} in rodent gliomas Neuro-oncol, January 1, 2008; 10(6): 958 - 967. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. A. Boikos and C. A. Stratakis Molecular genetics of the cAMP-dependent protein kinase pathway and of sporadic pituitary tumorigenesis Hum. Mol. Genet., April 15, 2007; 16(R1): R80 - R87. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Solodushko and B. Fouty Proproliferative phenotype of pulmonary microvascular endothelial cells Am J Physiol Lung Cell Mol Physiol, March 1, 2007; 292(3): L671 - L677. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. H. Al-Dhaheri and B. G. Rowan Protein Kinase A Exhibits Selective Modulation of Estradiol-Dependent Transcription in Breast Cancer Cells that Is Associated with Decreased Ligand Binding, Altered Estrogen Receptor {alpha} Promoter Interaction, and Changes in Receptor Phosphorylation Mol. Endocrinol., February 1, 2007; 21(2): 439 - 456. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. T. Samuelsen, P. E. Schwarze, H. S. Huitfeldt, E. V. Thrane, M. Lag, M. Refsnes, E. Skarpen, and R. Becher Regulation of rat alveolar type 2 cell proliferation in vitro involves type II cAMP-dependent protein kinase Am J Physiol Lung Cell Mol Physiol, January 1, 2007; 292(1): L232 - L239. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. J. Robinson-White, W. W. Leitner, E. Aleem, P. Kaldis, I. Bossis, and C. A. Stratakis PRKAR1A Inactivation Leads to Increased Proliferation and Decreased Apoptosis in Human B Lymphocytes Cancer Res., November 1, 2006; 66(21): 10603 - 10612. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Mavrakis, J. Lippincott-Schwartz, C. A. Stratakis, and I. Bossis Depletion of type IA regulatory subunit (RI{alpha}) of protein kinase A (PKA) in mammalian cells and tissues activates mTOR and causes autophagic deficiency Hum. Mol. Genet., October 1, 2006; 15(19): 2962 - 2971. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
