Cancer Research Meeting Calendar Sign up for Cancer Research eTOC's
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Libertini, S. J.
Right arrow Articles by Mudryj, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Libertini, S. J.
Right arrow Articles by Mudryj, M.
[Cancer Research 65, 10700-10708, December 1, 2005]
© 2005 American Association for Cancer Research

Molecular Biology, Pathobiology and Genetics

Cyclin E Both Regulates and Is Regulated by Calpain 2, a Protease Associated with Metastatic Breast Cancer Phenotype

Stephen J. Libertini1,3, Brian S. Robinson1, Navdeep K. Dhillon1, Danielle Glick1, Michael George1, Satya Dandekar1, Jeffrey P. Gregg2, Earl Sawai2 and Maria Mudryj1,3

Departments of 1 Medical Microbiology and Immunology, and 2 Pathology and Laboratory Medicine, University of California, Davis, Davis; and 3 Veterans Affairs-Northern California Health Care System, Mather, California

Requests for reprints: Maria Mudryj, Department of Medical Microbiology and Immunology, University of California, Davis, Tupper Hall, Davis, CA 95616. Phone: 530-754-6090; Fax: 530-753-8692; E-mail: mmudryj{at}ucdavis.edu.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Overexpression of cyclin E in breast tumors is associated with a poor response to tamoxifen therapy, greater genomic instability, more aggressive behavior, and a poor clinical prognosis. These tumors also express low molecular weight isoforms of cyclin E that are associated with higher kinase activity and increased metastatic potential. In the current study, we show that cyclin E overexpression in MCF7 cells transactivates the expression of calpain 2, leading to proteolysis of cyclin E as well as several known calpain substrates including focal adhesion kinase (FAK), calpastatin, pp60src, and p53. In vivo inhibition of calpain activity in MCF7-cyclin E cells impedes cyclin E proteolysis, whereas in vivo induction of calpain activity promotes cyclin E proteolysis. An analysis of human breast tumors shows that high levels of cyclin E are coincident with the expression of the low molecular weight isoforms, high levels of calpain 2 protein, and proteolysis of FAK. Lastly, studies using a mouse model of metastasis reveal that highly metastatic tumors express proteolyzed cyclin E and FAK when compared to tumors with a low metastatic potential. Our results suggest that cyclin E–dependent deregulation of calpain may be pivotal in modifying multiple cellular processes that are instrumental in the etiology and progression of breast cancer.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Cyclin E, the regulatory component of the cyclin/cyclin-dependent kinase (CDK) complex, is overexpressed in different tumor types and is often associated with a poor clinical outcome (1–9). The contribution of cyclin E to tumorigenesis has been best studied in breast cancers where overexpression is apparent in 10% to 25% of breast cancers, is a strong predictor of endocrine therapy failure (10), and an accurate predictor of a poor clinical outcome (9, 11). Studies of cyclin E–overexpressing breast tumors and tumor-derived cell lines found that cyclin E is also proteolytically processed into more active low molecular weight (LMW) isoforms (12) that are resistant to inhibition by the CDK inhibitors p21 and p27, and hence are associated with higher CDK kinase activity (13). Analyses using an in vivo melanoma model suggest that the LMW isoforms are more effective than the full-length cyclin E in enhancing angiogenesis and metastasis (14), thus establishing a link between the expression of cyclin E LMW isoforms and metastasis.

Although studies substantiate the role of cyclin E LMW isoforms in tumorigenesis, the mechanisms involved in cyclin E proteolysis are unclear. An analysis of LMW isoforms expressed in a cyclin E–overexpressing cell line suggests that elastase is instrumental in cyclin E proteolysis (12). Another study indicates that cyclin E can be cleaved by calpain to generate LMW isoforms that are similar in size to the isoforms present in tumors (15). Therefore, at present, the protease(s) that generate the LMW isoforms in breast tumors and tumor-derived cell lines are not clearly delineated.

Calpains are calcium-dependent thiol proteinases that have been implicated in many cellular processes. Calpain activity is tightly regulated by levels of expression, calcium requirement, autoproteolysis, phosphorylation, intracellular distribution, and the endogenous inhibitor calpastatin (16). In general, calpains cleave proteins at a limited number of sites to generate large polypeptide fragments (16). Over 100 calpain substrates have been identified, and many are cytoskeleton/membrane attachment proteins including focal adhesion kinase (FAK; ref. 17), {alpha}-spectrin (18), talin (19), paxillin (20), E-cadherin (21), and ß-catenin (22). Calpain also cleaves proteins that are involved in signal transduction and transcriptional regulation such as pp60src (23), p53 (24, 25), and fos (26). Therefore, deregulation of calpain activity would affect proliferation, migration, apoptosis, and metastasis.

We previously reported that cyclin E overexpression in MCF7 and T47D tumor–derived breast cells confers partial tamoxifen resistance (27). We also noted that cyclin E–overexpressing cell lines have increased levels of the LMW isoforms. The current study shows that in MCF7 cells, cyclin E transactivates calpain 2 transcription, thus, positively regulating its own proteolysis as well as the proteolysis of other calpain substrates. An analysis of human mammary tumors identified a correlation between cyclin E expression, calpain 2 levels, and calpain-dependent proteolysis. Such modifications are consistent with the aggressive behavior and poor clinical prognosis that is evident in cyclin E–overexpressing breast tumors.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cell culture. HepG2 cells, obtained from American Type Culture Collection (Manassas, VA) and the Hct116 cell line, a gift from Dr. K. Kaplan, University of California, Davis, Davis, CA, were propagated in DMEM (Life Technologies, Rockville, MD) supplemented with 10% fetal bovine serum, penicillin/streptomycin at 37°C and 5% CO2. The generation of the MCF7 and T47D cell lines has been previously described (27, 28).

Microarray analysis. Labeling of samples, hybridization to U133A GeneChips (Affymetrix, Santa Clara, CA), staining, and scanning were done as described in the Affymetrix Expression Analysis Technical Manual.

Fluorescence intensity values (.CEL files) generated from hybridized, stained GeneChips were analyzed with R statistical software (v.2.01, and "affy" BioConductor package) and BRB Array Tools to identify genes that were differentially expressed. The settings used for Robust Multichip Analysis in R included Microarray Suite 5.0-based background correction, quantile normalization, and Robust Multichip Analysis–based algorithms for calculation of expression values using perfect match only fluorescence intensities. A detection P ≤ 0.05 and a mean fold change of ≥1.5-fold (P ≤ 0.01) were used as criteria for filtering genes for clustering analyses. Hierarchical clustering and comparative fold-change analysis were used to identify and group similar patterns of gene regulation. Assignment of genes to functional categories was done by annotation of gene lists with the program, Database for Annotation, Visualization, and Integrated Discovery (http://apps1.niaid.nih.gov/david) and literature-based classification was done by hand. Statistically overrepresented (Fisher exact probability score <0.05) biological processes within clusters were identified using Expression Analysis Systematic Explorer v.1.0 analysis software (29).

In vivo calpain induction. MCF7 cells were plated in six-well plates and cultured overnight. Cells were pretreated with 20 µmol/L of the calpain inhibitor calpeptin (Calbiochem, La Jolla, CA) or DMSO for 15 minutes and then treated with 10 µmol/L ionomycin (Calbiochem) for 20 minutes, harvested, washed with ice-cold PBS, and lysed in radioimmunoprecipitation assay buffer.

In vivo calpain inhibition. MCF7 cells were plated in six-well plates and cultured overnight. Cells were treated with DMSO, 5 or 20 µmol/L of calpeptin, and 2.3 or 23 µmol/L of N-acetyl-Leu-Leu-methional (ALLM; Calbiochem) for 24 or 48 hours, at which time they were washed with ice-cold PBS and harvested.

Transfection. Cells were transfected with Superfect reagent (Qiagen, Valencia, CA) and 5 µg of pRcCMV-cyclin E or pRcCMV plasmid DNA following the manufacturer's recommendation. For the promoter studies, cells were transfected with FuGENE 6 (Roche Applied Science, Indianapolis, IN) and capnP-luc2, SVß-gal, pRcCMV-cyclin E380, pRcCMV, or p21 plasmids. Forty-eight hours after transfection, cells were harvested and subjected to analysis as previously described (28). pRcCMV-cyclin E380 harbors a site-directed mutation converting the tyrosine 380 residue to alanine, thus enhancing cyclin E stability. The mutation was generated using the following primers: 5'CCCAGTGGGCTCGCCCCGCCACAGAGC3' and 5'GCTCTGTGGCGGGGCGAGGAGCCCACTGGG3'.

Northern blot analysis. Total RNA was isolated using the Trizol reagent (Life Technologies) following the manufacturer's recommendation. Total RNA (10 µg) was electrophoresed on a 1% agarose gel and transferred to Duralon-UV membrane (Stratagene, La Jolla, CA). The following primers were used to generate calpain 2–specific RT-PCR products: 5'AGGATGAGGACGAGGAGGAT3' and 5'TTTCAGAAAAGACCGGATG3'. The RT-PCR products were labeled with a 32P-dCTP. The hybridization and wash conditions have been previously described (27).

Generation of the calpain 2 promoter luciferase plasmid. Sequences corresponding to –43 to –25 region (5'GCCCTGAACTTTGTGCCAAA 3') and the –481 to –462 region (5'TTTGGCACAAAGTTCAGGGC3') of the calpain 2 promoter were used to PCR-amplify the human calpain 2 promoter using purified human DNA. The PCR product was cloned into the pCR2.1-TOPO (Invitrogen, Carlsbad, CA) vector to generate pCAPNpro-TOPO. The promoter sequence was excised by digestion with SacI and XhoI and cloned into the SacI and XhoI site of the pGL3 basic (Promega, Madison, WI) luciferase reporter plasmid to generate capnP-luc. The promoter sequence was identical to the one previously reported (31) (National Center for Biotechnology Information accession no. J04700.1).

Western immunoblot analysis. Cells were directly placed in a radioimmunoprecipitation assay lysis buffer that contained E64, leupeptin and calpeptin, and a protease inhibitor cocktail (Sigma, St. Louis, MO). Thirty micrograms of protein were separated on 8%, 10%, or 12% SDS-PAGE gels and transferred to BA-85 membrane (Schleicher & Schuell, Keene, NH). The membrane was blocked with 5% nonfat dry milk in PBS and 0.1% Tween before the addition of specific antibodies. The following antibodies were used: cyclin E antibody was a generous gift from Dr. G. Lozano. Actin (sc-8432 horseradish peroxidase), p53 (FL-393; sc-6243), and c-Src (B-12; sc-8056) antibodies were from Santa Cruz (Santa Cruz, CA). I{kappa}B{alpha} (Ab-2; PC142), calpain 2-domain III (208755), p53 (Ab-6; clone DO-1; OP43), and calpastatin, domain IV (208903), antibodies were from Calbiochem. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH; RGM2) antibodies were from Advanced ImmunoChemical, Inc. (Long Beach, CA), and FAK (clone 4.47; 05-537) antibodies were from Upstate (Charlottesville, VA). After incubation with secondary mouse monoclonal or rabbit polyclonal horseradish peroxidase–linked NIF 825 antibodies (Amersham Pharmacia, Piscataway, NJ), proteins were detected using enhanced chemiluminescence (Amersham Pharmacia) following the manufacturer's recommendations. Histone HI in vitro kinase assays were done as previously described (28).

In vitro calpain assay. MCF7-RcCMV control cells were resuspended in calpain assay buffer [50 mmol/L Hepes buffer (pH 7.4), 150 mmol/L NaCl, 1 mmol/L EDTA, and 1% Triton X-100], calpain was activated with differing amounts of CaCl2, and the extracts were incubated at room temperature for 60 minutes. To detect cyclin E proteolysis by purified calpain, MCF7-RcCMV control cells were resuspended in calpain assay buffer, increasing concentrations of calpain 2 (Calbiochem) were added to the reactions and incubated at room temperature for 60 minutes. The reactions were terminated by boiling.

Preparation of human tumor samples. Tumor tissue was obtained from the Department of Pathology and Laboratory Medicine, University of California, Davis, Davis, California. The samples were flash-frozen in liquid nitrogen, and all identifiers were removed. A total of 11 samples (10 tumors and 1 normal mammary tissue) consisting of a minimum of 100 mg of breast cancer tissue were available. This study was approved by the Institutional Review Board of the School of Medicine, University of California, Davis, Davis, CA.

Mouse metastasis assay. The metastasis studies were conducted as previously described (30). The tumor transplant lines, PD5 and PD6, were developed from rare pulmonary metastases and were transplanted into the no. 4 mammary fat pad.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Generation of cyclin E–overexpressing clones. Cyclin E–overexpressing MCF7 mammary cell lines were generated to define cyclin E–dependent alterations in gene expression. Two clones, MCF7-CycE1 and MCF7-CycE3F that expressed intermediate and high levels of cyclin E, and had elevated levels of cyclin E–dependent kinase activity were chosen for further studies (Fig. 1A and B). Notably, MCF7-CycE1 and MCF7-CycE3F cells had abundant amounts of the LMW isoforms of cyclin E that have been previously detected in cyclin E–overexpressing tumors (12, 15), whereas MCF7 control cells expressed only trace amounts of these isoforms. Overexpression of cyclin E in ZR75, LNCaP, PC3, HEK293, and T24 cells also resulted in the expression of the same-sized LMW isoforms (data not shown). These observations raised the possibility that cyclin E, when overexpressed, might promote its own processing.



View larger version (34K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 1. Calpain transcription is transactivated in cyclin E–overexpressing MCF7 cells. A, expression of cyclin E and actin in MCF7-RcCMV (control, lane 1), MCF7-CycE1, and MCF7-CycE3F (cyclin E–overexpressing) cells (lanes 2 and 3). Full-length (FL; arrows) and low molecular weight (LMW; brackets) forms. B, cyclin E–associated kinase activity in MCF7-RcCMV, MCF7-CycE1, and MCF7-CycE3F cells. C, calpain 2 mRNA expression in MCF7-RcCMV, MCF7-CycE1, and MCF7-CycE3F cells. D, transactivation of the calpain 2 promoter (capnP) by cyclin E. MCF7 cells were transfected with the capnP-luc along with RcCMV vector alone, cyclin E expression plasmid, or an equal amount of cyclin E and p21 expression plasmids. RcCMV was included to maintain constant levels of DNA.

 
Cyclin E overexpression transactivates genes involved in catabolism. To determine the effects of cyclin E overexpression in MCF7 cells, microarray analysis was used to analyze changes in gene transcription. The analysis was conducted in triplicate for each line. Statistical analysis of the microarray data resulted in identification of 645 genes that were differentially expressed (fold change ≥1.5; P ≤ 0.01) in cyclin E–overexpressing MCF7 cells. As expected, MCF7-CycE1 and MCF7-CycE3F expressed increased levels of cyclin E, as well as decreased levels of genes that we previously found to be repressed in cyclin E–overexpressing cells—Bcl-2 (28) and RB.4 Hierarchical clustering of differentially expressed genes revealed similar patterns of regulation in both cyclin E–overexpressing cell lines (Fig. 2A). Interestingly, one subcluster of genes up-regulated by cyclin E expression are genes involved in catabolism (Fig. 2B). This subcluster contained calpain 2, which was previously implicated in cyclin E proteolysis.



View larger version (37K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 2. Hierarchal cluster analysis of gene transcription in MCF7-RcCMV, MCF7-CycE1, and MCF7-CycE3F cells. Hierarchal clustering of the microarray data was used to identify similar patterns of altered transcription in cyclin E–overexpressing cells. Clusters containing functionally related genes revealed several biological processes including catabolism that were deregulated in cyclin E–overexpressing cells. B, a representative list of up-regulated catabolic genes in cyclin E–overexpressing cells includes calpain 2.

 
Calpain 2 expression is elevated in cyclin E–overexpressing MCF7 cells. The elevated expression of calpain 2 in cyclin E–overexpressing MCF7 cells was confirmed by Northern blot analysis of mRNA isolated from MCF7 control and cyclin E–overexpressing cells (Fig. 1C). Western immunoblot analysis established that calpain 2 protein levels were elevated in cyclin E–overexpressing cells (Fig. 3A). GAPDH and ß-actin served as gel loading controls.



View larger version (37K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 3. Cyclin E overexpression in MCF7 cells results in increased calpain 2 protein expression and activity. A, calpain 2 protein levels are increased in cyclin E–overexpressing cells (lanes 2 and 3). The FL and LMW forms of cyclin E are marked. Calpain substrates FAK, calpastatin, pp60src, and p53 are proteolytically processed in cyclin E–overexpressing (lanes 2 and 3), but not in control cells (lane 1) indicating an increase in calpain activity. Arrows, different isoforms of calpain 2, FAK, c-src, and p53. B, calpain substrate FAK is proteolytically processed in cyclin E–overexpressing (lanes 2, 3, 5 and 7), but not in control cells (lanes 1, 4 and 6).

 
To determine if cyclin E directly transactivates calpain 2 transcription, we cloned the human calpain 2 promoter into the pGL3 luciferase expression vector. The 456 bp promoter contained sequences from –25 to –481 of the translational start site. Previous analyses found that this promoter has multiple transcriptional start sites, and harbors Sp1, Ap–1, Ap-2, E-box, and E2F-binding sites (31). The capnP-luc reporter construct was transfected into MCF7 cells along with the cyclin E expression plasmid or with a vector control plasmid (pRcCMV). As shown in Fig. 1D, cyclin E transactivates luciferase expression. To determine if CDK kinase activity was instrumental in promoter transactivation, cells were transfected with the capnP-luc plasmid, the cyclin E expression plasmid, and the p21 CDK inhibitor expression plasmid. Inclusion of p21 resulted in decreased promoter activity, arguing that cyclin E–dependent kinase activity is required for calpain 2 transactivation.

Proteolysis of known calpain substrates in cyclin E–overexpressing cells. Calpain cleaves a number of cellular substrates to generate LMW isoforms; therefore, detection of these cleaved forms would be indicative of elevated calpain activity. Previous studies have shown that FAK, a 120 kDa protein, is cleaved by calpain to a 90 kDa form (17). MCF7 control cells predominantly expressed the 120 kDa full-length form of the protein (Fig. 3A). MCF7-CycE1 cells expressed full-length and cleaved FAK, whereas MCF7-CycE3F expressed mostly cleaved FAK. Therefore, progressively higher levels of cyclin E result in a dose-dependent increase in calpain proteolysis of FAK.

Calpastatin, an endogenous inhibitor of calpain is a very sensitive calpain substrate (32). Whereas calpastatin is encoded by a single gene, multiple calpastatin isoforms were detected in MCF7 control cells (Fig. 3A). In contrast, calpastatin was barely detected in MCF7-CycE1 cells and was undetectable in MCF7-CycE3F cells. In this system, an increase in cyclin E causes a drastic decrease in calpastatin expression.

Another calpain substrate, pp60c-src, is proteolyzed by calpain to a 48 kDa form in platelets (23). This truncated protein has a deletion of the NH2-terminal region which harbors the myristoylation site as well as a deletion of part of the SH3 domain. As shown in Fig. 3A, the MCF7 control and MCF7-CycE1 cells expressed low, but detectable levels of the 48 kDa isoform. However, MCF7-CycE3F cells expressed equal amounts of the full-length and the truncated 48 kDa form of pp60c-src. Therefore, whereas pp60c-src is cleaved by calpain in vivo, it is not as sensitive to calpain-dependent proteolysis as calpastatin or FAK.

In vitro studies showed that human and mouse p53 are calpain substrates (24, 25). Human p53 is cleaved to a 48 kDa NH2-terminally truncated isoform. The full-length, but not the LMW isoform, can be detected by an antibody directed against the NH2-terminal domain of the molecule (DO-1). An antibody generated against the full-length p53 detects the full-length and the calpain-cleaved isoform of p53. As shown in Fig. 3A, the NH2-terminal antibody detected the p53 protein in MCF7 control and MCF7-CycE1 cells. MCF7-CycE3F cells seemed to have very low levels of p53. To detect the truncated p53, the blot was stripped and reanalyzed with an antibody directed against the full-length p53 protein. This analysis revealed that MCF7-CycE3F expressed p53, but most of the protein was cleaved to the NH2-terminally truncated form. Also, the amount of p53 was reduced in the MCF7-CycE3F cells, suggesting that the truncated form of the protein may be more labile. This result supports the hypothesis that calpain cleavage of p53 may be an alternative mechanism of p53 degradation (24).

Cyclin E overexpression transactivates calpain 2 in other cell lines. T47D (breast), HCT116 (colon), and HepG2 (hepatocellular carcinoma) cells were used to determine if cyclin E overexpression in other cellular backgrounds resulted in a similar transactivation of calpain 2. Cyclin E–overexpressing T47D clones (T47D-CycE4 and T47D-CycE18) expressed higher amounts of the cyclin E LMW isoforms, higher levels of calpain protein, and a dose-dependent decrease in FAK expression (Fig. 3B). Transient expression of cyclin E in HCT116 resulted in increased expression of the cleaved isoform of calpain 2 and the complete proteolysis of FAK to the 90 kDa form (Fig. 3B). HepG2 transiently transfected with the cyclin E plasmid expressed the LMW cyclin E isoforms and had elevated levels of calpain 2. Cyclin E–overexpressing HepG2 cells had very low levels of FAK, suggesting that the protein may be completely proteolyzed (Fig. 3B). Previous studies found that the 90 kDa FAK isoform is further degraded to 45 and 40 kDa fragments and ultimately is completed degraded (17). This analysis suggests that cyclin E–dependent transactivation of calpain may be a feature of other tumors.

Cyclin E is a calpain substrate in vitro. To confirm that cyclin E can be cleaved by calpain, cellular extracts prepared from MCF7 control cells were treated with increasing amounts of CaCl2. Figure 4A shows a CaCl2 dose-dependent increase in cyclin E proteolysis to the LMW isoforms in MCF7 cells (lanes 1-4). Additionally, the cyclin E–overexpressing clones expressed LMW isoforms of similar mass (lanes 5 and 6). To confirm that calpain activity was activated by the inclusion of CaCl2, the immunoblot was stripped and reprobed with a FAK-specific antibody. Increasing concentrations of CaCl2 also resulted in the cleavage of FAK. The same analysis was used to detect the sensitivity of calpastatin to calpain–dependent proteolysis. C-rel, a protein that has not been described as a calpain substrate, served as a negative control. Increasing concentrations of CaCl2 had no effect on c-rel, therefore, the degradation of cyclin E, FAK, and calpastatin are calpain-specific and not due to a general degradation of the cellular extracts.



View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 4. Activation of calpain promotes proteolytic cleavage of cyclin E and FAK. A, treatment of MCF7-RcCMV control cellular extracts with increasing concentrations of Ca2+ causes progressively greater cleavage of cyclin E (lanes 1-4). The proteolytic fragments are identical in size to the forms present in cyclin E–overexpressing MCF7 clones (lanes 5 and 6). Cleavage of calpain substrates FAK and calpastatin served as positive controls, whereas c-rel served as negative control. B, addition of increasing amounts of purified calpain 2 to MCF7-RcCMV cellular extracts (lanes 4-9) promoted proteolysis of cyclin E to the same-size LMW isoforms that are expressed in cyclin E–overexpressing MCF7 clones (lanes 1 and 2).

 
An alternative method was used to confirm that cyclin E is a calpain 2 target. MCF7 control cellular extracts were treated with increasing concentrations of purified calpain 2. As shown in Fig. 4B, calpain 2 addition resulted in a dose-dependent proteolysis of cyclin E into the same-size LMW isoforms detected in cyclin E–overexpressing MCF7 cells. The two complementary analyses show that, in vitro, cyclin E is a calpain substrate.

In vivo activation and inhibition of cyclin E proteolysis. Although previous studies reported calpain-dependent cyclin E cleavage in vitro (15), it was unknown if calpain-dependent proteolysis occurred in vivo. To address this issue, proliferating MCF7 control cells that expressed only trace amounts of the LMW isoforms were treated with the calcium ionophore, ionomycin. Previous studies have shown that ionomycin activates endogenous calpain (21). As shown in Fig. 5A, ionomycin treatment resulted in cleavage of cyclin E into LMW isoforms. Inclusion of the cell-permeable calpain inhibitor, calpeptin, prevented cyclin E proteolysis. To confirm that calpain was activated, the immunoblot was stripped and reprobed with a FAK-specific antibody. This shows that cyclin E is a calpain substrate in vivo.



View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 5. In vivo induction of calpain activity promotes cyclin E and FAK cleavage, whereas in vivo inhibition of calpain activity prevents cleavage. A, to induce calpain activity, MCF7-RcCMV control cells were treated with the calcium ionophore ionomycin (lanes 3 and 4) in the presence or absence of the calpain inhibitor calpeptin for 20 minutes. Control cells were treated with the vehicle DMSO (lane 1) or calpeptin alone (lane 2). Ionomycin treatment of cells resulted in cyclin E and FAK cleavage, whereas inclusion of calpeptin inhibited cleavage. B, calpain activity was inhibited by treating MCF7 cyclin E–overexpressing cells with two different concentrations of calpeptin (lanes 2, 3, 7 and 8) or ALLM (lanes 4, 5, 9 and 10) for 24 (lanes 1-5) or 48 hours (lanes 6-10). Calpeptin was very effective in preventing cyclin E and FAK cleavage, indicating that cyclin E proteolysis in MCF7 cyclin E–overexpressing cells is dependent on calpain activity.

 
If cyclin E cleavage in MCF7-CycE3F cells is indeed due to calpain, then in vivo inhibition of calpain activity would prevent cyclin E proteolysis. To test this hypothesis, MCF7-CycE3F cells were treated with the vehicle DMSO or with two different concentrations of the calpain inhibitors calpeptin or ALLM for 24 or 48 hours. As shown in Fig. 5B, calpeptin treatment effectively prevented cyclin E cleavage in a dose-dependent manner. ALLM inhibited cyclin E proteolysis, but to a lesser extent than calpeptin. The immunoblot was stripped and reprobed with FAK antibodies. Inhibition of FAK cleavage served as a positive control for the inhibition of calpain activity. Our ability to modulate the expression of cyclin E LMW isoforms by activation or inhibition of calpain activity in vivo showed that in MCF7 cells, the LMW isoforms were generated by calpain-dependent proteolysis.

Previous reports indicate that the cyclin E LMW forms are associated with higher cyclin E–dependent kinase activity. To test this hypothesis in vivo, cellular extracts prepared from MCF7-CycE3F treated with 20 µmol/L calpeptin or DMSO for 24 hours were used to detect cyclin E–associated kinase activity. Cyclin E–dependent kinase activity was reduced 1.8-fold by calpeptin treatment, arguing that the LMW isoforms are associated with higher kinase activity (data not shown).

Cyclin E overexpression, calpain 2 levels, and focal adhesion kinase proteolysis in human breast tumors. Cyclin E is overexpressed in 10% to 25% of human breast tumors and these tumors also express the LMW isoforms of the protein (9, 11). Therefore, we asked if there is a correlation between cyclin E overexpression, calpain 2 levels, and calpain-dependent proteolysis of a known calpain substrate. Ten frozen mammary tumor samples and one control (normal mammary tissue) were used in the analysis. Equal amounts of protein extracts were analyzed for the expression of cyclin E. GAPDH was used to confirm equal protein loading. As shown in Fig. 6A, one tumor, 3440, expressed high levels of cyclin E, whereas tumors 571 and 3040 expressed a moderate amount of cyclin E. Tumor 3440 also expressed cyclin E LMW isoforms. Tumor 571 had a small amount of one LMW isoform. The MCF7-CycE3F extract served as marker for the expression of the LMW cyclin E isoforms. Consistent with the hypothesis that cyclin E transactivates calpain 2 expression, tumors 3440, 3040, and 571 had elevated levels of calpain 2 when compared with normal mammary tissue (1827). FAK was almost completely proteolyzed to the 90 kDa form in tumors 3440, 3040, and 571, indicative of elevated calpain activity. In contrast, tumor 2385 had low levels of calpain 2 and expressed abundant levels of full-length FAK. This tumor analysis supports the hypothesis that LMW isoforms of cyclin E are associated with increased calpain-dependent proteolysis.



View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 6. Cyclin E overexpression correlates with increased calpain 2 expression and proteolysis of FAK. A, Western immunoblot analysis was used to detect cyclin E, calpain 2, and FAK expression in 10 human mammary tumors (lanes 2-11) and normal mammary tissue (1827, lane 1). MCF7-CycE3F cellular extracts served as a marker for the expression of the LMW isoforms (lane 12). Arrows, tumors with elevated cyclin E levels. GAPDH served as a gel loading control. B, analysis of PyV-mT transgenic mouse mammary carcinomas with differing metastatic potentials. Extracts prepared from the nonmetastatic (Db7, lane 1), weakly metastatic (PD6 and PD5, lanes 2 and 3), and very metastatic (lane 4) tumors were analyzed using Western immunoblots. Highly metastatic (lane 4) mouse tumors have higher levels of calpain 2, a decrease in FAK, and proteolytically cleaved cyclin E when compared with the nonmetastatic tumor (Db7, lane 1).

 
Cyclin E and focal adhesion kinase proteolysis in nonmetastatic and metastatic tumors. Many calpain substrates are cytoskeleton/membrane attachment proteins. These proteins are important for cellular adhesion, a process that is modified by calpain proteolysis. Alterations in cellular adhesion may have a role in tumor invasion and/or metastasis. Therefore, a mouse breast tumor metastasis model (30, 33) was used to determine if (a) calpain may have a role in this process and (b) if cyclin E proteolysis is associated with metastasis. The study employed four related polyomavirus-middle T (PyV-mT) transgenic mouse mammary carcinoma transplant lines that display differences in metastatic potential (33). Importantly, PyV-mT has been used as a surrogate for Her2/neu overexpression and interacts with and activates the 85 kDa regulatory phosphoinositide-3-kinase (PI3K) subunit. The Met line, derived from transgenic mice constructed with the wild-type PyV-mT line, develops rapid mammary carcinoma in all animals with 100% pulmonary metastasis. The Db7 line is derived from animals with double site-directed mutations of the PyV-mT that decouple it from the PI3K pathway. The Db7 model has 100% penetrance of mammary tumor but exhibits significantly fewer pulmonary metastases (9%). The PD5 and PD6 transplantable tumor lines are derived from rare metastases of the Db7 line. The order of metastatic potential from least metastatic to most metastatic is Db7, PD6, PD5, and Met. Extracts prepared from these tumors were used to detect expression of FAK, calpain 2, and cyclin E. ß-Actin and GAPDH served as gel loading controls. As shown in Fig. 6B, FAK is poorly cleaved in the Db7 tumor, intermediately cleaved in PD6 and PD5, and greatly cleaved in the Met tumor. Calpain 2 autolysis results in a more active, but less stable, form of calpain 2 (34). The Met tumor expressed a smaller form of calpain 2, further suggesting that this tumor had higher calpain activity. Finally, the Met tumor, but not the Db7 tumor, expressed LMW isoforms of cyclin E, demonstrating that cyclin E proteolysis correlated with calpain activity. These results suggest that calpain-dependent proteolysis is associated with metastasis.

In summary, this study supports the hypothesis that cyclin E transactivates calpain 2 expression thus regulating its own proteolysis as well as the proteolysis of additional calpain substrates. This conclusion is substantiated by studies of human mammary tumors. Further analysis using a mouse mammary tumor model suggests that calpain-dependent proteolysis may have a role in mammary metastasis.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
This study identifies a link between cyclin E overexpression and enhanced expression and activity of calpain 2, indicating that cyclin E both regulates and is regulated by calpain 2. Similar autoregulatory loops have been described for cyclin E and the CDK inhibitor p27, as well as cyclin E and the E2F/RB transcription factor complex (35–38). The cyclin E–dependent activation of calpain 2 results in increased calpain-mediated proteolysis of cyclin E into LMW isoforms that are refractory to inhibition by p21 and p27, resulting in higher cyclin E–associated kinase activity. Moreover, the increase in calpain 2 expression affects proteolysis of the calpain inhibitor and substrate calpastatin. Calpastatin proteolysis further shifts the calpain/calpastatin homeostasis in favor of increased calpain activity, thus leading to the proteolysis of additional calpain substrates.

Calpain-dependent proteolysis has been implicated in signal transduction, adhesion and metastasis. Calpain's proteolytic activity is distinct from other proteases because calpains have a limited and complex site specificity (16) that is determined by both the sequence and conformation of the polypeptide (39). The sequence specificity is not dependent on an exact sequence, but rather by preferred amino acids in distinct sites (39). This rather nebulous definition of calpain cleavage sites makes it difficult to predict substrate specificity in the absence of experimental data. Because calpain specificity is dependent in part upon conformation, posttranslational modifications such as phosphorylation, significantly affect the rate of proteolysis (40, 41). Therefore, the cleavage of specific calpain substrates in a cell may be dependent on posttranslational modifications of the substrates as well as the rates of calpain cleavage.

Increased calpain 2 activity promotes proteolysis of FAK, which is cleaved to a readily detectable 90 kDa form (17). We found that FAK is a sensitive calpain substrate and the extent of FAK proteolysis is proportional to cyclin E expression. Therefore, FAK proteolysis is a useful measure of calpain activity. FAK is thought to coordinate cell adhesion and migration. Previous studies in platelets reported that proteolysis of FAK resulted in a reduction in its autokinase activity and led to its dissociation from the cytoskeleton. Interestingly, cells devoid of FAK exhibit reduced in vitro mobility and an increase in the number of focal adhesions, suggesting that FAK may have a role in focal adhesion turnover (42). A recent study reported a novel role for FAK that is independent of its kinase activity—the recruitment of calpain into focal adhesions where it might potentially cleave other focal adhesion proteins (43), modifying cell adhesion and migration.

Cells overexpressing high, but not intermediate levels of cyclin E, exhibited proteolysis of pp60src to a 48 kDa form. The interaction between c-src and calpain is complex because studies have shown that c-src is involved in increasing calpain levels (44). Calpain-dependent proteolysis of pp60src to a 48 kDa isoform has been previously described in platelets and the cleavage site was localized to the NH2-terminal region of the molecule. We found a consensus calpain site at amino acids 125 to 135 which would generate a 48 kDa polypeptide. This 48 kDa protein would have a deletion of the myristoylation site and part of the SH3 domain, but would retain the SH2 and catalytic domains, suggesting that the kinase activity of this molecule would not be abolished. However, deletion of the myristoylation site may alter subcellular localization (23), and deletion of part of the SH3 domain may modify pp60src kinase activity as well as interactions with specific proteins including paxillin (45).

Calpain also cleaves proteins that are instrumental in transcriptional regulation including p53. In vitro studies found that calpain cleaves p53 at the NH2-terminal end to generate a 48 kDa protein. Removal of the NH2-terminal region would promote p53 degradation in a ubiquitin-independent manner, thus diminishing the levels of this tumor suppressor (24). The current study is the first to report the detection of the 48 kDa p53 isoform in vivo. Cells overexpressing high levels of cyclin E expressed only trace amounts of the full-length p53, but the 48 kDa form was readily detectable. However, the total amount of p53 was reduced, supporting the hypothesis that calpain proteolysis promotes p53 degradation. A reduction in the levels of p53 would facilitate transversal of DNA damage checkpoints, contribute to genome instability, modify apoptotic responses, and hence, promote tumorigenesis.

Several studies have suggested a link between increased calpain activity and metastasis (21, 46, 47). The mechanisms by which calpain may be involved in this process is poorly explored. Using a mouse model of mammary tumor metastasis (30, 33), that in part mimics Her2/neu overexpression, we found that calpain cleavage of FAK and cyclin E is coincident with increased metastatic potential. The metastatic phenotype of the Met cells is dependent on the PyV-mT protein initiating a signaling cascade through an interaction with the PI3K pathway (33). How is this pathway linked to calpain activity? Sonenshein and coworkers found that activation of the PI3K pathway by overexpression of the HER2/neu leads to a calpain-dependent proteolysis of I{kappa}B and subsequent activation of NF{kappa}B-dependent transcription (48). The exact mechanism involved in calpain activation is unknown. Studies have also shown that extracellular signal-regulated kinase, a kinase that is instrumental in growth factor–initiated signal transduction can directly phosphorylate and activate calpain 2 (49). HER2/neu is overexpressed in ~20% to 30% of all breast cancers and, like cyclin E overexpression, is predictive of a poor clinical outcome (50). Therefore, signaling pathways that are perturbed in breast cancer and are associated with a poor clinical outcome may share a common feature—an augmentation of calpain activity.

The expression of calpain and calpastatin in human mammary tumors has been largely unexplored. One study indicates that calpain activity is higher in human breast tumors than in normal mammary tissue (51). Studies of other tumor types have provided evidence that increased calpain expression is associated with tumorigenesis. Calpain 2 expression is elevated in prostate tumors (21) and in colorectal adenocarcinomas (52). Calpain 1 expression is increased in renal cell carcinomas (53). There are no studies on calpastatin expression in human breast tumors, but the expression of calpastatin is decreased in nasopharyngeal carcinomas and in colorectal adenocarcinomas (52, 54). These studies suggest that a deregulation of the calpain/calpastatin equilibrium may have a role in tumor progression, but further studies are needed to clearly define the role of these proteins in mammary tumorigenesis.

In conclusion, this study shows that cyclin E–overexpressing MCF7 cells, human mammary tumors overexpressing cyclin E, and mammary metastatic tumors derived from mouse PyV-mT expressing cells exhibit an increase in calpain-dependent proteolysis. Together, these results suggest that cyclin E–dependent deregulation of calpain 2 may be the pivotal feature that confers a cellular phenotype of aggressive behavior and genomic instability associated with cyclin E–overexpressing tumors.


   Acknowledgments
 
Grant support: Cancer Research Coordinating Committee (M. Mudryj), the University of California, Davis, Health Systems grant (M. Mudryj), a VA Merit grant (M. Mudryj), and a President's Undergraduate Fellowship (B.S. Robinson). This investigation was conducted in a facility constructed with support from the Research Facilities Improvement Program grant no. C06 RR-12088-01 from the National Center for Research Resources, NIH.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Drs. Michael Seldin, Gigi Lozano, and Martin Privalsky for reading the manuscript and providing useful comments.


   Footnotes
 
4 B. Robinson, and M. Mudryj, unpublished data. Back

Received 5/13/05. Revised 8/ 4/05. Accepted 9/16/05.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Keyomarsi K, O'Leary N, Molnar G, Lees E, Fingert HJ, Pardee AB. Cyclin E, a potential prognostic marker for breast cancer. Cancer Res 1994;54:380–5.[Abstract/Free Full Text]
  2. Kitahara K, Yasui W, Kuniyasu H, et al. Concurrent amplification of cyclin E and CDK2 genes in colorectal carcinomas. Int J Cancer 1995;62:25–8.[Medline]
  3. Erlanson M, Portin C, Linderholm B, Lindh J, Roos G, Landberg G. Expression of cyclin E and the cyclin-dependent kinase inhibitor p27 in malignant lymphomas—prognostic implications. Blood 1998;92:770–7.[Abstract/Free Full Text]
  4. Marone M, Scambia G, Giannitelli C, et al. Analysis of cyclin E and CDK2 in ovarian cancer: gene amplification and RNA overexpression. Int J Cancer 1998;75:34–9.[CrossRef][Medline]
  5. Sakaguchi T, Watanabe A, Sawada H, et al. Prognostic value of cyclin E and p53 expression in gastric carcinoma. Cancer 1998;82:1238–43.[CrossRef][Medline]
  6. Fukuse T, Hirata T, Naiki H, et al. Prognostic significance of cyclin E overexpression in resected non-small cell lung cancer. Cancer Res 2000;60:242–4.[Abstract/Free Full Text]
  7. Xiangming C, Natsugoe S, Takao S, et al. The cooperative role of p27 with cyclin E in the prognosis of advanced gastric carcinoma. Cancer 2000;89:1214–9.[CrossRef][Medline]
  8. Hedberg Y, Davoodi E, Ljungberg B, Roos G, Landberg G. Cyclin E and p27 protein content in human renal cell carcinoma: clinical outcome and associations with cyclin D. Int J Cancer 2002;102:601–7.[CrossRef][Medline]
  9. Keyomarsi K, Tucker SL, Buchholz TA, et al. Cyclin E and survival in patients with breast cancer. N Engl J Med 2002;347:1566–75.[Abstract/Free Full Text]
  10. Span PN, Tjan-Heijnen VC, Manders P, Beex LV, Sweep CG. Cyclin-E is a strong predictor of endocrine therapy failure in human breast cancer. Oncogene 2003;22:4898–904.[CrossRef][Medline]
  11. Loden M, Stighall M, Nielsen NH, et al. The cyclin D1 high and cyclin E high subgroups of breast cancer: separate pathways in tumorigenesis based on pattern of genetic aberrations and inactivation of the pRb node. Oncogene 2002;21:4680–90.[CrossRef][Medline]
  12. Porter DC, Zhang N, Danes C, et al. Tumor-specific proteolytic processing of cyclin E generates hyperactive lower-molecular-weight forms. Mol Cell Biol 2001;21:6254–69.[Abstract/Free Full Text]
  13. Akli S, Zheng PJ, Multani AS, et al. Tumor-specific low molecular weight forms of cyclin E induce genomic instability and resistance to p21, p27, and antiestrogens in breast cancer. Cancer Res 2004;64:3198–208.[Abstract/Free Full Text]
  14. Bales E, Mills L, Milam N, et al. The low molecular weight cyclin E isoforms augment angiogenesis and metastasis of human melanoma cells in vivo. Cancer Res 2005;65:692–7.[Abstract/Free Full Text]
  15. Wang XD, Rosales JL, Magliocco A, Gnanakumar R, Lee KY. Cyclin E in breast tumors is cleaved into its low molecular weight forms by calpain. Oncogene 2003;22:769–74.[CrossRef][Medline]
  16. Goll DE, Thompson VF, Li H, Wei W, Cong J. The calpain system. Physiol Rev 2003;83:731–801.[Abstract/Free Full Text]
  17. Cooray P, Yuan Y, Schoenwaelder SM, Mitchell CA, Salem HH, Jackson SP. Focal adhesion kinase (pp125FAK) cleavage and regulation by calpain. Biochem J 1996;318:41–7.
  18. Stabach PR, Cianci CD, Glantz SB, Zhang Z, Morrow JS. Site-directed mutagenesis of {alpha}II spectrin at codon 1175 modulates its mu-calpain susceptibility. Biochemistry 1997;36:57–65.[CrossRef][Medline]
  19. Franco SJ, Rodgers MA, Perrin BJ, et al. Calpain-mediated proteolysis of talin regulates adhesion dynamics. Nat Cell Biol 2004;6:977–83.[CrossRef][Medline]
  20. Yamaguchi R, Maki M, Hatanaka M, Sabe H. Unphosphorylated and tyrosine-phosphorylated forms of a focal adhesion protein, paxillin, are substrates for calpain II in vitro: implications for the possible involvement of calpain II in mitosis-specific degradation of paxillin. FEBS Lett 1994;356:114–6.[CrossRef][Medline]
  21. Rios-Doria J, Day KC, Kuefer R, et al. The role of calpain in the proteolytic cleavage of E-cadherin in prostate and mammary epithelial cells. J Biol Chem 2003;278:1372–9.[Abstract/Free Full Text]
  22. Rios-Doria J, Kuefer R, Ethier SP, Day ML. Cleavage of ß-catenin by calpain in prostate and mammary tumor cells. Cancer Res 2004;64:7237–40.[Abstract/Free Full Text]
  23. Oda A, Druker BJ, Ariyoshi H, Smith M, Salzman EW. pp60src is an endogenous substrate for calpain in human blood platelets. J Biol Chem 1993;268:12603–8.[Abstract/Free Full Text]
  24. Kubbutat MH, Vousden KH. Proteolytic cleavage of human p53 by calpain: a potential regulator of protein stability. Mol Cell Biol 1997;17:460–8.[Abstract]
  25. Pariat M, Carillo S, Molinari M, et al. Proteolysis by calpains: a possible contribution to degradation of p53. Mol Cell Biol 1997;17:2806–15.[Abstract]
  26. Hirai S, Kawasaki H, Yaniv M, Suzuki K. Degradation of transcription factors, c-Jun and c-Fos, by calpain. FEBS Lett 1991;287:57–61.[CrossRef][Medline]
  27. Dhillon NK, Mudryj M. Ectopic expression of cyclin E in estrogen responsive cells abrogates antiestrogen mediated growth arrest. Oncogene 2002;21:4626–34.[CrossRef][Medline]
  28. Dhillon NK, Mudryj M. Cyclin E overexpression enhances cytokine-mediated apoptosis in MCF7 breast cancer cells. Genes Immun 2003;4:336–42.[CrossRef][Medline]
  29. Hosack DA, Dennis G, Jr., Sherman BT, Lane HC, Lempicki RA. Identifying biological themes within lists of genes with EASE. Genome Biol 2003;4:R70.[CrossRef][Medline]
  30. Jessen KA, Liu SY, Tepper CG, et al. Molecular analysis of metastasis in a polyomavirus middle T mouse model: the role of osteopontin. Breast Cancer Res 2004;6:R157–69.[CrossRef][Medline]
  31. Hata A, Ohno S, Akita Y, Suzuki K. Tandemly reiterated negative enhancer-like elements regulate transcription of a human gene for the large subunit of calcium-dependent protease. J Biol Chem 1989;264:6404–11.[Abstract/Free Full Text]
  32. Wang KK, Posmantur R, Nadimpalli R, et al. Caspase-mediated fragmentation of calpain inhibitor protein calpastatin during apoptosis. Arch Biochem Biophys 1998;356:187–96.[CrossRef][Medline]
  33. Webster MA, Hutchinson JN, Rauh MJ, et al. Requirement for both Shc and phosphatidylinositol 3' kinase signaling pathways in polyomavirus middle T-mediated mammary tumorigenesis. Mol Cell Biol 1998;18:2344–59.[Abstract/Free Full Text]
  34. Elce JS, Hegadorn C, Arthur JS. Autolysis, Ca2+ requirement, and heterodimer stability in m-calpain. J Biol Chem 1997;272:11268–75.[Abstract/Free Full Text]
  35. Swanson C, Ross J, Jackson PK. Nuclear accumulation of cyclin E/Cdk2 triggers a concentration-dependent switch for the destruction of p27Xic1. Proc Natl Acad Sci U S A 2000;97:7796–801.[Abstract/Free Full Text]
  36. Geng Y, Eaton EN, Picon M, et al. Regulation of cyclin E transcription by E2Fs and retinoblastoma protein. Oncogene 1996;12:1173–80.[Medline]
  37. Toyoshima H, Hunter T. p27, a novel inhibitor of G1 cyclin-Cdk protein kinase activity, is related to p21. Cell 1994;78:67–74.[CrossRef][Medline]
  38. Lundberg AS, Weinberg RA. Functional inactivation of the retinoblastoma protein requires sequential modification by at least two distinct cyclin-cdk complexes. Mol Cell Biol 1998;18:753–61.[Abstract/Free Full Text]
  39. Tompa P, Buzder-Lantos P, Tantos A, et al. On the sequential determinants of calpain cleavage. J Biol Chem 2004;279:20775–85.[Abstract/Free Full Text]
  40. Elvira M, Diez JA, Wang KK, Villalobo A. Phosphorylation of connexin-32 by protein kinase C prevents its proteolysis by mu-calpain and m-calpain. J Biol Chem 1993;268:14294–300.[Abstract/Free Full Text]
  41. Shen J, Channavajhala P, Seldin DC, Sonenshein GE. Phosphorylation by the protein kinase CK2 promotes calpain-mediated degradation of I{kappa}B{alpha}. J Immunol 2001;167:4919–25.[Abstract/Free Full Text]
  42. Ilic D, Furuta Y, Kanazawa S, et al. Reduced cell motility and enhanced focal adhesion contact formation in cells from FAK-deficient mice. Nature 1995;377:539–44.[CrossRef][Medline]
  43. Carragher NO, Westhoff MA, Fincham VJ, Schaller MD, Frame MC. A novel role for FAK as a protease-targeting adaptor protein: regulation by p42 ERK and Src. Curr Biol 2003;13:1442–50.[CrossRef][Medline]
  44. Carragher NO, Westhoff MA, Riley D, et al. v-Src-induced modulation of the calpain-calpastatin proteolytic system regulates transformation. Mol Cell Biol 2002;22:257–69.[Abstract/Free Full Text]
  45. Weng Z, Taylor JA, Turner CE, Brugge JS, Seidel-Dugan C. Detection of Src homology 3-binding proteins, including paxillin, in normal and v-Src-transformed Balb/c 3T3 cells. J Biol Chem 1993;268:14956–63.[Abstract/Free Full Text]
  46. Xu L, Deng X. Tobacco-specific nitrosamine 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone induces phosphorylation of mu- and m-calpain in association with increased secretion, cell migration, and invasion. J Biol Chem 2004;279:53683–90.[Abstract/Free Full Text]
  47. Mamoune A, Luo JH, Lauffenburger DA, Wells A. Calpain-2 as a target for limiting prostate cancer invasion. Cancer Res 2003;63:4632–40.[Abstract/Free Full Text]
  48. Pianetti S, Arsura M, Romieu-Mourez R, Coffey RJ, Sonenshein GE. Her-2/neu overexpression induces NF-{kappa}B via a PI3-kinase/Akt pathway involving calpain-mediated degradation of I{kappa}B-{alpha} that can be inhibited by the tumor suppressor PTEN. Oncogene 2001;20:1287–99.[CrossRef][Medline]
  49. Glading A, Chang P, Lauffenburger DA, Wells A. Epidermal growth factor receptor activation of calpain is required for fibroblast motility and occurs via an ERK/MAP kinase signaling pathway. J Biol Chem 2000;275:2390–8.[Abstract/Free Full Text]
  50. Slamon DJ, Godolphin W, Jones LA, et al. Studies of the HER-2/neu proto-oncogene in human breast and ovarian cancer. Science 1989;244:707–12.[Abstract/Free Full Text]
  51. Shiba E, Kambayashi JI, Sakon M, et al. Ca2+-dependent neutral protease (calpain) activity in breast cancer tissue and estrogen receptor status. Breast Cancer 1996;3:13–7.[Medline]
  52. Lakshmikuttyamma A, Selvakumar P, Kanthan R, Kanthan SC, Sharma RK. Overexpression of m-calpain in human colorectal adenocarcinomas. Cancer Epidemiol Biomarkers Prev 2004;13:1604–9.[Abstract/Free Full Text]
  53. Braun C, Engel M, Seifert M, et al. Expression of calpain I messenger RNA in human renal cell carcinoma: correlation with lymph node metastasis and histological type. Int J Cancer 1999;84:6–9.[CrossRef][Medline]
  54. Sriuranpong V, Mutirangura A, Gillespie JW, et al. Global gene expression profile of nasopharyngeal carcinoma by laser capture microdissection and complementary DNA microarrays. Clin Cancer Res 2004;10:4944–58.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Cancer Res.Home page
N. A. Delk, K. K. Hunt, and K. Keyomarsi
Altered Subcellular Localization of Tumor-Specific Cyclin E Isoforms Affects Cyclin-Dependent Kinase 2 Complex Formation and Proteasomal Regulation
Cancer Res., April 1, 2009; 69(7): 2817 - 2825.
[Abstract] [Full Text] [PDF]

Home page
 JCBHome page
C. L. Cortesio, K. T. Chan, B. J. Perrin, N. O. Burton, S. Zhang, Z.-Y. Zhang, and A. Huttenlocher
Calpain 2 and PTP1B function in a novel pathway with Src to regulate invadopodia dynamics and breast cancer cell invasion
J. Cell Biol., March 5, 2008; 180(5): 957 - 971.
[Abstract] [Full Text] [PDF]

Home page
 JCOHome page
L. Harris, H. Fritsche, R. Mennel, L. Norton, P. Ravdin, S. Taube, M. R. Somerfield, D. F. Hayes, and R. C. Bast Jr
American Society of Clinical Oncology 2007 Update of Recommendations for the Use of Tumor Markers in Breast Cancer
J. Clin. Oncol., November 20, 2007; 25(33): 5287 - 5312.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
S. J. Libertini, C. G. Tepper, V. Rodriguez, D. M. Asmuth, H.-J. Kung, and M. Mudryj
Evidence for Calpain-Mediated Androgen Receptor Cleavage as a Mechanism for Androgen Independence
Cancer Res., October 1, 2007; 67(19): 9001 - 9005.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Libertini, S. J.
Right arrow Articles by Mudryj, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Libertini, S. J.
Right arrow Articles by Mudryj, M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online