| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology, Pathobiology and Genetics |
Departments of 1 Genetics, 2 Experimental Pathology, and 3 Therapeutic Radiology, Yale University School of Medicine, New Haven, Connecticut
Requests for reprints: Peter M. Glazer, Department of Therapeutic Radiology, Yale University School of Medicine, P.O. Box 208040, New Haven, CT 06520-0804. Phone: 203-737-2788; Fax: 203-785-6309; E-mail: peter.glazer{at}yale.edu
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Other factors that participate in the activation of Chk2 under various conditions include NBS1 (12, 13), 53BP1 (12, 14, 15), BRCA1 (16), and MLH1 (17). In terms of ionizing radiationinduced signaling, NBS1 and 53BP1 have been placed in parallel pathways upstream of Chk2 (12). Both proteins affect the phosphorylation of Chk2 on Thr68. In addition, work by Brown et al. (17) suggests that Chk2 phosphorylation after ionizing radiation is MLH1 dependent. Whereas MLH1 is not suspected to be a kinase, the authors suggest a scaffolding role whereby it facilitates the interaction between ATM and Chk2. In addition to modulation by these upstream factors, Chk2 has been shown to autophosphorylate following exposure of cells to ionizing radiation (14, 1820).
Solid tumors characteristically exhibit heterogeneity in vascularization, perfusion, and oxygenation, with regions of moderate to severe hypoxia. The pattern of hypoxia in tumors is dynamic with both temporal and spatial variations. Clinical studies indicate that extensive hypoxia in human tumors correlates with poor prognosis (2124), reflecting not only the radioresistance of hypoxic cancer cells but also a more aggressive phenotype.
We and others have proposed that hypoxia may contribute to tumor progression by promoting genetic instability. Increased levels of mutations have been detected in hypoxic cells (2527) and hypoxia has been found to cause decreased expression of the DNA repair genes MLH1, MSH2, and Rad51 (2830).
Because MLH1 has been suggested to play a role in Chk2 activation, we initially hypothesized that the decrease in MLH1 levels under hypoxia might cause an attenuation of Chk2 activation in response to ionizing radiation. Interestingly, however, we found that Chk2 phosphorylation is directly induced by hypoxia itself and that this induction is substantially dependent on ATM. In addition, MLH1 and NBS1 were also found to play roles in Chk2 activation by hypoxia. Furthermore, a key downstream substrate of Chk2, p53, was found to be altered under hypoxic conditions in a Chk2-dependent manner, indicating that hypoxia-induced phosphorylation of Chk2 leads to functional activation and downstream signaling. Finally, Chk2 seems to protect cells from hypoxia-induced apoptosis and, thus, plays a role in cell survival under hypoxic stress. These results identify a new mechanism by which hypoxia can influence cell signaling and DNA damage response pathways.
| Materials and Methods |
|---|
|
|
|---|
Plasmids and RNA interference. The HA-Chk2 expression vector was obtained from Dr. David F. Stern (Department of Pathology, Yale University, New Haven, CT) (ref. 18). RNA interference (RNAi) target sequences for ATM were ligated into the pSUPER vector (OligoEngine, Seattle, WA). The oligonucleotide sequences are as follows: ATM-1A, GATCCCCGCGCCTGATTCGAGATCCTAAGTTCTCTAGGATCTCGAATCAGGCGCTTTTTGGAA;ATM-1B, AGCTTTTCCAAAAAGCGCCTGATTCGAGATCCTAGAGAACTTAGGATCTCGAATCAGGCGCGGG; ATM-2A, GATCCCCTGGTGCTATTTACGGAGCTAAGTTCTCTAGCTCCGTAAATAGCACCATTTTTGGAAA; and ATM-2B, AGCTTTTCCAAAAATGGTGCTATTTACGGAGCTAGAGAACTTAGCTCCGTAAATAGCACCAGGG. Small interfering RNA (siRNA)expressing stable cell lines were made by cotransfecting pSUPER constructs with pcDNA3 (Invitrogen, Carlsbad, CA) at a ratio of 10:1 using FuGENE 6 reagent as directed by the manufacturer (Roche, Indianapolis, IN). Stable lines were selected and maintained in 0.8 mg/mL G418. RNAi directed against ATR (ATR-2 duplex, Dharmacon, Lafayette, CO), ATM (siGENOME SMARTpool reagent, Dharmacon), or luciferase (Luciferase GL-2 duplex, Dharmacon) was done transiently using Oligofectamine (Invitrogen).
Hypoxia and desferrioxamine treatments. Hypoxic cell culture conditions were established as previously described (33) using a continuous flow of a mixture of 95% N2 and 5% CO2 gas certified to contain <10 ppm O2 (Airgas Northeast, Cheshire, CT). Unless otherwise specified, experiments were done with 0.01% O2. Hypoxic cell culture experiments in which in situ lysis was done were carried out in an INVIVO2 400 chamber (Biotrace, Cincinnati, OH) with glove box capabilities to allow manipulation under hypoxia. Desferrioxamine (Sigma, St. Louis, MO) treatments were carried out by media supplementation to a final concentration of 250 µmol/L. Ionizing radiation was done with a 137Cs irradiator at a dose rate of 165 rad/min.
Phosphatase assay. Phosphatase treatments of protein samples were carried out using
-phosphatase as per instructions of the manufacturer (New England Biolabs, Beverly, MA). Briefly, 100 µg of total cell lysate were incubated with 1x reaction buffer, 2 mmol/L MnCl2, and 1 µL of
-phosphatase. Reactions were carried out for 30 minutes at 30°C. Where indicated, phosphatase inhibitors (50 mmol/L NaF and 10 mmol/L Na3VO4) were added to the reactions before the introduction of enzyme.
Western blot. Cells were lysed with radioimmunoprecipitation assay buffer (150 mmol/L NaCl, 0.1% SDS) and 100 µg of total protein per sample were resolved by SDS-PAGE. Proteins were detected by standard immunoblot protocol using the following primary antibodies: phospho-Chk2(Thr68) and p53 (D0-1) from Santa Cruz Biotechnology (Santa Cruz, CA); Chk2 (clone 7; Upstate Biotechnology, Lake Placid, NY); phospho-p53(Ser20) (9287; Cell Signaling Technologies, Beverly, MA); tubulin (clone B-5-1-2; Sigma); Hif-1
(clone 54) and NBS1 (clone 34; BD Transduction Labs, Franklin Lakes, NJ); ATM (2c1) and ATR (clone 2B5; GeneTex, San Antonio, TX); MLH1(clone G168-15; BD PharMingen, San Diego, CA); and Glut-1 (GT12-A; Alpha Diagnostic International, San Antonio, TX) and actin (Research Diagnostics, Inc., Flanders, NJ). Each experiment was carried out at least thrice and representative Western blots are shown. Band intensities were quantitated using the public domain NIH Image program (version 1.63; developed at the U.S. NIH and available online at http://rsb.info.nih.gov/nih-image/). Relative increases in Chk2 phosphorylation were calculated as follows: (ratio of phospho-Chk2 in hypoxia versus normoxia) / (ratio of total Chk2 in hypoxia versus normoxia).
Northern blot. Total RNA was isolated using the TRIzol RNA isolation reagent (Life Technologies, Carlsbad, CA). Northern blots were done as previously described (28). The following primer pairs were used to produce probes for Northern blot analysis by reverse transcription-PCR (RT-PCR) amplification of mRNA: Chk2, 5'-GCGGTCGTGATGTCTCGG-3' (sense) and 5'-TTCGTGTTCAAACCACGGA-3' (antisense); vascular endothelial growth factor, 5'-CTTCACTGGATGTATTTGACTGCTGTGG-3' (sense) and 5'-GCTAGTGACTGTCACCGATCAGGGAG-3' (antisense). RT-PCR products were confirmed by sequence analysis before use.
Cell cycle analysis. Cells cultured in normoxia or hypoxia were stained with propidium iodide. DNA content was analyzed using a Becton Dickinson FACS-Calibur flow cytometer. Histogram construction was done using BD CellQuest Pro software (Becton Dickinson, San Jose, CA). Experiments were conducted in triplicate.
Caspase activation assay. Caspase-3 activity was assayed using the CaspACE Colorimetric Assay System according to the instructions of the manufacturer (Promega Corp., Madison, WI). Absorbance readings for each sample were determined at 405 nm using a SpectraMAX Gemini XS microplate reader and SoftMax Pro software (Molecular Devices Corp., Sunnyvale, CA). The caspase specific activity for each sample was calculated using the following formula: specific activity = pmol product per hour / µg protein. P values were calculated based on unpaired two-tailed t tests using the Microsoft Excel Plug-in Analyze-it (Analyze-it Software Ltd., Leeds, United Kingdom). Caspase activation experiments were conducted in replicates of six.
| Results |
|---|
|
|
|---|
|
-phosphatase abolished this signal (Fig. 1C, lanes 7 and 11). The signal was maintained by the presence of phosphatase inhibitors to prevent Chk2 dephosphorylation (Fig. 1C, lanes 8 and 12). To confirm that Chk2 phosphorylation is induced by hypoxia per se rather than during the brief reoxygenation that can occur on removal of cell culture dishes from a hypoxic chamber before lysis, MCF-7 and RKO cells were incubated in a glove box chamber at 0.1% O2. After 48 hours, the cells were lysed in situ under hypoxia and Chk2 phosphorylation was assessed in the lysates by Western blot (Fig. 1D). As shown, Chk2 is indeed phosphorylated on Thr68 under strictly hypoxic conditions; the phosphorylation cannot be attributed simply to a reoxygenation effect. Similar to previous experiments, the relative increases in Chk2 phosphorylation were determined to be 5-fold in MCF-7 cells and 7-fold in RKO cells. Because of the limitations of the glove box chamber, this experiment was conducted under 0.1% O2, representing less severe hypoxia than the conditions for Figs. 1A and C. However, the results are consistent, indicating the reproducibility of the Chk2 phosphorylation response over a range of hypoxic conditions.
To determine the kinetics of the Chk2 phosphorylation and of the decrease in total Chk2 protein, time-course experiments were carried out with MCF-7 cells cultured in hypoxia and harvested in situ within a glove box chamber. Increased phosphorylation on Thr68 could be detected after 12 hours of exposure to hypoxia, with maximum signal achieved at 72 hours (Fig. 2A). No further increase in Chk2 phosphorylation was detected at the 96-hour time point. It is of note that cells harvested at all time points retained good viability despite prolonged growth in low oxygen conditions. The decrease in total Chk2 levels was not observed until the 48-hour time point, indicating that the protein is initially activated, but that there is a subsequent decrease in total Chk2 protein levels after exposure to hypoxia.
|
Upstream activators involved in Chk2 phosphorylation. As mentioned above, Chk2 is a substrate of the ATM kinase (5, 6). To investigate the potential role of ATM in hypoxia-induced Chk2 phosphorylation, MCF-7 cells were stably transfected with a vector designed to express siRNA directed against ATM (pSUPER-ATMi) or an empty vector control. The resulting cell lines, ATMi-32 and pSpr-7, respectively, were exposed to hypoxic (0.1% O2, 48 hours) or normoxic growth conditions. At the time of harvest for analysis, the hypoxic cells were lysed in situ within the glove box chamber. As shown in Fig. 3A, ATMi cells exhibited substantially reduced hypoxia-induced Chk2 phosphorylation when compared with the parental MCF-7 or pSpr-7 control cells. Due to the undetectable levels of Chk2 phosphorylation in normoxic samples, we were unable to quantitate the relative increases in Chk2 activation. However, by comparing the ratio of phospho-Chk2 to total Chk2 under each condition, we were able to calculate a 3-fold decrease in Chk2 phosphorylation in ATM-deficient cells in relation to control MCF-7 and pSpr cells.
|
To further test the role of ATR in hypoxia-induced Chk2 activation, we examined the effect of ATR knockdown in an ATM-deficient cell background. ATMi cells (constitutively expressing siRNA directed against ATM) were transfected with synthetic siRNA duplexes directed against either ATM or ATR. siRNA targeted to luciferase was used as a control. As shown in Fig. 3C, additional reduction of ATM expression resulted in even greater suppression of Chk2 phosphorylation under hypoxic conditions. However, knockdown of ATR expression had no effect on Chk2 activation in ATM-deficient cells. Thus, residual Chk2 phosphorylation in ATMi cells seems to be the result of the incomplete knockdown of ATM and not the result of compensatory ATR function. In fact, these results further indicate that ATR has no apparent role in Chk2 phosphorylation in response to hypoxia.
Because MLH1 has been shown to play a role in Chk2 activation following ionizing radiation exposure (17), we examined MLH1-deficient and complemented cells (31) with regard to Chk2 phosphorylation in response to hypoxia. HCT116/3-6 (MLH1+) and HCT116/2-3 (MLH1) were grown in normoxia or hypoxia for 48 hours. The MLH1-deficient cells exhibited reduced Chk2 phosphorylation under hypoxia compared with the MLH1-complemented cells, which showed a 6-fold higher ratio of phospho-Chk2 to total Chk2 (Fig. 3D). A similar dependency on MLH1 was also seen after desferrioxamine treatment (data not shown).
NBS1, a factor in DNA double-strand break repair, also signals to Chk2 after ionizing radiation exposure (12, 13). We examined NBS1-deficient and cDNA-complemented human cells (32) to test the NBS1 dependence of Chk2 phosphorylation after exposure to 48 hours of hypoxia. Cells deficient in NBS1 exhibited 3-fold lower Chk2 phosphorylation than their complemented counterparts (Fig. 3E). Under the electrophoresis conditions used, a higher mobility species of Chk2 is visible in hypoxic samples using an antibody to total Chk2 (Fig. 3E, lanes 2 and 4). Such a shift in mobility is indicative of Chk2 hyperphosphorylation. Notably, although hypoxia induces Chk2 down-regulation in both NBS1-proficient and -deficient cells, a greater proportion (
50%) of the remaining Chk2 exists as the higher mobility species in cells expressing NBS1. This observation reinforces the data obtained using the phospho-Chk2specific antibody and further indicates that Chk2 phosphorylation is attenuated in NBS1-deficient cells.
Overall, the data in Fig. 3 indicate that ATM, MLH1, and NBS1 all participate in Chk2 phosphorylation in response to hypoxia. In contrast, hypoxia-induced Chk2 phosphorylation is independent of ATR. Likewise, two other mediators of Chk2 activation, 53BP1 and BRCA1, did not affect Chk2 phosphorylation after exposure to hypoxia (data not shown).
p53 phosphorylation in response to hypoxia is dependent on Chk2 and ataxia telangiectasia mutated. To show that hypoxia-induced Chk2 phosphorylation leads to functional activation, we examined the phosphorylation of p53 as a known Chk2 target. MCF-7 cells were grown in normoxia or hypoxia for 48 hours and cell lysates were assayed by Western blot for phospho-p53 (Ser20) and total p53. As shown in Fig. 4A, p53 is phosphorylated on Ser20 after exposure to hypoxia and this phosphorylation correlates with an increase in total p53. This phosphorylation event is known to be mediated by Chk2 in response to ionizing radiation (79) and its occurrence in hypoxia indicates that Chk2 is functionally active.
|
Because we have shown that ATM contributes to Chk2 phosphorylation, we sought to determine whether ATM also affects p53 phosphorylation on Ser20. MCF-7 and ATMi cell lines were cultured in normoxia or hypoxia for 48 hours. Whereas MCF-7 cells exhibited increased p53 phosphorylation after exposure to either hypoxia or ionizing radiation, ATMi cells displayed attenuated p53 phosphorylation in response to both stimuli (Fig. 4C), consistent with a role for ATM in p53 activation under hypoxia. These data indicate that both ATM and Chk2 can be placed in a pathway leading to p53 phosphorylation in response to hypoxia.
Chk2 protects cells from hypoxia-induced apoptosis. Chk2 is known to affect a number of cellular processes, including cell cycle arrest and apoptosis. To address the possibility that Chk2 activation in hypoxia might influence cell cycle progression, Chk2-deficient and Chk2-proficient cells were cultured in normoxia or hypoxia (0.1%) for 24 hours and stained with propidium iodide to assay cellular DNA content. Hypoxic cells were treated and harvested within the hypoxia glove box chamber. We did not observe major differences in cell cycle phase redistribution in response to hypoxia in a comparison of Chk2-deficient and Chk2-proficient cells (Fig. 5A) except for a 30% increase in the sub-G1 population in Chk2-deficient cells that were exposed to hypoxia. Essentially no sub-G1 DNA content cells were seen in the Chk2-proficient cells.
|
| Discussion |
|---|
|
|
|---|
This line of investigation was prompted by work implicating MLH1 in the ATM-Chk2 signaling cascade that is initiated by ionizing radiation (17). We had previously shown that MLH1 levels are down-regulated by exposure of human cancer cells to hypoxia, and so we hypothesized that any MLH1-dependent response to ionizing radiation might consequently be compromised by hypoxia. Instead, we found that cells exposed to hypoxia alone exhibited increased Chk2 phosphorylation on the key Thr68 residue. This result was confirmed in a number of different cell types and could also be obtained by treating cells with the chemical hypoxia mimetic desferrioxamine. It is important to note that in our experiments, cell lysates that were harvested in situ within the hypoxia glove box chamber exhibited Chk2 phosphorylation. Hence, the observation of hypoxia-induced Chk2 phosphorylation reported here is a bona fide response to hypoxia and cannot be attributed to the effect of reoxygenation.
Time-course experiments with hypoxia revealed that Chk2 is initially phosphorylated and that there is a subsequent decrease in total Chk2 protein levels (Fig. 2A). The down-regulation of Chk2 was also seen at the mRNA level (Fig. 2B), suggesting that the changes in Chk2 levels are likely the result of transcriptional regulation. Note that the Chk2-expressing subclones of HCT15 cells do not show any hypoxia-induced changes in Chk2 protein levels (Fig. 4B). Because these cells express Chk2 cDNA from a heterologous promoter, the consistent protein levels support our interpretation of the results in Fig. 2B that Chk2 is transcriptionally regulated. The combined data suggest that Chk2 is likely down-regulated in hypoxia as a result of promoter repression rather than an alteration in protein or mRNA stability. Preliminary data indicate that this transcriptional regulation is not dependent on the hypoxia-inducible transcription factor HIF-1
(data not shown) although further studies will be necessary to determine which transcription regulatory factors are involved.
One recent study has suggested that certain substrates shared by the related kinases, ATM and ATR, are phosphorylated by ATR under hypoxic conditions and by ATM on reoxygenation (37, 38). However, we found that ATM is primarily responsible for Chk2 phosphorylation under hypoxia, with ATR having no detectable role. Because in our experiments the cells were lysed in situ under hypoxia within a glove box chamber, we can attribute the ATM-dependent Chk2 activation solely to hypoxia. Furthermore, the 3-fold decrease in Chk2 phosphorylation observed using ATM RNAi probably underestimates the role of ATM in hypoxia-induced Chk2 activation. Although ATM levels are substantially lower in cells stably expressing siRNA against ATM, the knockdown is not complete and the residual ATM may still mediate some phosphorylation of Chk2. In this regard, MCF-7 cells constitutively expressing siRNA against ATM, which were transfected with synthetic RNAi duplexes against ATM, showed further reduction in ATM levels and a corresponding additional suppression of Chk2 phosphorylation under hypoxia. In contrast, knockdown of ATR in ATM RNAiexpressing cells showed no further suppression of Chk2 phosphorylation under hypoxia, consistent with the lack of effect of the individual ATR knockdown above.
We also tested the roles of MLH1 and NBS1, both of which have been implicated by other studies in ionizing radiationinduced signaling to Chk2 (12, 13, 17). We found that both can influence Chk2 phosphorylation in response to hypoxia with substantial decreases in hypoxia-induced Chk2 phosphorylation in cells deficient in either factor.
Following activation by exposure to ionizing radiation or other DNA damaging agents, Chk2 phosphorylates the downstream effector p53 (79). On phosphorylation by Chk2, p53 is stabilized (10, 11), causing cell cycle arrest and regulating DNA repair. Although hypoxia-induced p53 stabilization has been previously reported (39), we have shown here in a comparison of Chk2-deficient and Chk2-proficient cells that p53 phosphorylation and stabilization under hypoxia are both Chk2 dependent. These data indicate that Chk2 phosphorylation in hypoxia is associated with functional activation and downstream consequences. Furthermore, we have shown that p53 phosphorylation is also dependent on ATM, allowing us to place Chk2 and ATM in a hypoxia-induced pathway leading to p53 phosphorylation.
Chk2 shares many substrates with the functionally related kinase Chk1. Although Chk1 has been implicated in posthypoxia cell survival (40), we have been unable to detect Chk1 phosphorylation in our cells under either hypoxia or desferrioxamine exposure (data not shown).
Chk2 is known to affect several cellular processes, including cell cycle arrest, apoptosis, and DNA repair. We have shown here that cells deficient in Chk2 are especially sensitive to low oxygen levels and are more susceptible to hypoxia-induced apoptosis (Fig. 5). We hypothesize that Chk2 either functions to stabilize stalled replication forks or contributes to the repair of DNA lesions, thereby limiting the accumulation of DNA damage and precluding the induction of apoptosis.
Based on the work reported here, we propose a model in which hypoxia can lead to ATM and/or NBS1 activation, either through altered DNA metabolism or changes in chromatin structure. ATM, which may be activated either directly or as a result of communication with NBS1, then phosphorylates Chk2. Because MLH1 has not been shown to possess kinase activity, it is likely that MLH1 acts as a scaffold to properly orient ATM and Chk2. Such a scaffolding role to position ATM together with Chk2 was previously proposed for MLH1 as a response to ionizing radiation (17).
Chk2 is constitutively phosphorylated on Thr68 in many human tumors, especially those in which p53 is mutated (41). However, the cause of this constitutive phosphorylation is unknown. Our results showing that Chk2 is phosphorylated under hypoxic conditions raise the possibility that prolonged tumor hypoxia and/or cycles of hypoxia and reoxygenation may provide a mechanism that leads to persistent Chk2 activation.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Z. Yun, D. Campisi Hegan, C. Brdlik, and L. Cabral for their help.
Received 4/ 5/05. Revised 9/ 4/05. Accepted 9/20/05.
| References |
|---|
|
|
|---|
induces genetic instability by transcriptionally down-regulating MutS
expression. Mol Cell 2005;17:793803.[CrossRef][Medline]This article has been cited by other articles:
![]() |
H. Muniyappa, S. Song, C. K. Mathews, and K. C. Das Reactive Oxygen Species-independent Oxidation of Thioredoxin in Hypoxia: INACTIVATION OF RIBONUCLEOTIDE REDUCTASE AND REDOX-MEDIATED CHECKPOINT CONTROL J. Biol. Chem., June 19, 2009; 284(25): 17069 - 17081. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Crosby, R. Kulshreshtha, M. Ivan, and P. M. Glazer MicroRNA Regulation of DNA Repair Gene Expression in Hypoxic Stress Cancer Res., February 1, 2009; 69(3): 1221 - 1229. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Bencokova, M. R. Kaufmann, I. M. Pires, P. S. Lecane, A. J. Giaccia, and E. M. Hammond ATM Activation and Signaling under Hypoxic Conditions Mol. Cell. Biol., January 15, 2009; 29(2): 526 - 537. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Chan, M. Koritzinsky, H. Zhao, R. Bindra, P. M. Glazer, S. Powell, A. Belmaaza, B. Wouters, and R. G. Bristow Chronic Hypoxia Decreases Synthesis of Homologous Recombination Proteins to Offset Chemoresistance and Radioresistance Cancer Res., January 15, 2008; 68(2): 605 - 614. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Li, X. Ma, J. Wang, J. Koontz, M. Nucci, and J. Sklar Effects of rearrangement and allelic exclusion of JJAZ1/SUZ12 on cell proliferation and survival PNAS, December 11, 2007; 104(50): 20001 - 20006. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. G. Nuciforo, C. Luise, M. Capra, G. Pelosi, and F. d'Adda di Fagagna Complex engagement of DNA damage response pathways in human cancer and in lung tumor progression Carcinogenesis, October 1, 2007; 28(10): 2082 - 2088. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Clavijo, J.-L. Chen, K.-J. Kim, M. E. Reyland, and D. K. Ann Protein kinase C{delta}-dependent and -independent signaling in genotoxic response to treatment of desferroxamine, a hypoxia-mimetic agent Am J Physiol Cell Physiol, June 1, 2007; 292(6): C2150 - C2160. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Ghosh, T. Dohi, C. M. Raskett, T. F. Kowalik, and D. C. Altieri Activated Checkpoint Kinase 2 Provides a Survival Signal for Tumor Cells Cancer Res., December 15, 2006; 66(24): 11576 - 11579. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Freiberg, E. M. Hammond, M. J. Dorie, S. M. Welford, and A. J. Giaccia DNA Damage during Reoxygenation Elicits a Chk2-Dependent Checkpoint Response. Mol. Cell. Biol., March 1, 2006; 26(5): 1598 - 1609. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |