Cancer Research Targets  Telomeres
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lipscomb, E. A.
Right arrow Articles by Mercurio, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lipscomb, E. A.
Right arrow Articles by Mercurio, A. M.
[Cancer Research 65, 10970-10976, December 1, 2005]
© 2005 American Association for Cancer Research


Cell and Tumor Biology

The {alpha}6ß4 Integrin Maintains the Survival of Human Breast Carcinoma Cells In vivo

Elizabeth A. Lipscomb, Kaylene J. Simpson, Stephen R. Lyle, Jennifer E. Ring, Aisling S. Dugan and Arthur M. Mercurio

Division of Cancer Biology and Angiogenesis, Department of Pathology, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, Massachusetts

Requests for reprints: Arthur M. Mercurio, Department of Cancer Biology, University of Massachusetts Medical School, LRB-408, 364 Plantation Street, Worcester, MA 01605. Phone: 508-856-8676; Fax: 508-856-1310; E-mail: arthur.mercurio{at}umassmed.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The {alpha}6ß4 integrin has been widely implicated in carcinoma function in vitro; however, in vivo data are scarce. To determine the importance of {alpha}6ß4 in tumor progression, a SUM-159 breast carcinoma cell line that is essentially devoid of {alpha}6ß4 expression was generated using an RNA interference strategy. Loss of {alpha}6ß4 expression inhibits colony formation in soft agar assays, suggesting a vital role for {alpha}6ß4 in survival signaling and anchorage-independent growth. Orthotopic injection of the ß4-deficient cell line into the mammary fat pad of immunocompromised mice yielded significantly fewer and smaller tumors than the control cell line, revealing a role for the {alpha}6ß4 integrin in tumor formation. Under conditions that mimicked the in vivo environment, decreased expression of the {alpha}6ß4 integrin led to enhanced apoptosis as determined by the percentage of Annexin V-FITC+, PI– cells and the presence of caspase-3 cleavage products. Recombinant vascular endothelial growth factor (VEGF) significantly inhibited the cell death observed in the ß4-deficient cell line, demonstrating the importance of VEGF expression in this survival pathway. Furthermore, loss of {alpha}6ß4 expression leads to enhanced apoptosis and reduced expression of VEGF in breast carcinoma cells in vivo. Importantly, the specificity of {alpha}6ß4 in both the in vitro and in vivo assays showed that reexpression of the ß4 subunit into the ß4-deficient cell line could rescue the functional phenotype. Taken together, these data implicate the {alpha}6ß4 integrin in tumor formation by regulating tumor cell survival in a VEGF-dependent manner.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Although the {alpha}6ß4 integrin provides a well-characterized adhesive function in normal epithelial cells by anchoring the epithelium to its underlying basement membrane (1, 2), the tumor-associated functions of this integrin are becoming increasingly recognized. Importantly, the expression of this integrin is maintained as epithelial structures dissociate during the initiation and progression of carcinomas and, moreover, several types of carcinomas express significant amounts of {alpha}6ß4 (3, 4). Numerous studies by our group and others on carcinoma-derived cell lines have revealed that {alpha}6ß4 facilitates their ability to migrate, invade, and resist apoptotic stimuli (36). The ability of {alpha}6ß4 to affect these diverse functions results largely from its effects on multiple signaling pathways, a process that may result from its association with specific growth factor receptors, tetraspanins and possibly other molecules (7). The dichotomy of {alpha}6ß4 function is summarized best by the hypothesis that {alpha}6ß4 switches from a mechanical adhesive device into a signaling competent receptor during the progression from normal epithelium to invasive carcinoma (8).

Despite this considerable data implicating {alpha}6ß4 in tumor-associated functions in vitro, there is a paucity of data on its contribution to tumor behavior in vivo. The most compelling in vivo data that exist are from studies on squamous carcinoma in which {alpha}6ß4 has been implicated in the formation of these tumors (9, 10). For other types of carcinomas including breast carcinoma, that have been studied extensively in vitro with respect to {alpha}6ß4 function, limited in vivo data exists. Moreover, the available data were obtained from model systems in which exogenous {alpha}6ß4 was expressed in cells that lack expression of this integrin (11, 12). To obtain more insight into the contribution of {alpha}6ß4 in carcinoma progression, we introduced short hairpin RNA (shRNA) oligonucleotides using RNA interference to deplete expression of this integrin in human breast carcinoma cells. Following orthotopic injection of these cell lines, we assessed the effect of the loss of {alpha}6ß4 expression on the behavior of these cells. These experiments reveal that {alpha}6ß4 is necessary for the ability of these cells to survive in vivo, a conclusion substantiated by their behavior in three-dimensional cultures. Interestingly, breast carcinoma cells deficient in {alpha}6ß4 expression produce significantly less vascular endothelial growth factors (VEGF) in vivo, a finding that relates to previously published data on the ability of {alpha}6ß4 to regulate VEGF expression in vitro as well as the importance of VEGF for the survival of breast carcinoma cells (1315).


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell lines. The SUM-159 scrambled (Scr)-shRNA and ß4-shRNA human breast carcinoma cell lines were generated and maintained as described previously (16). The ß4 subunit was reexpressed into the ß4-shRNA cell line by infecting these cells with a human ß4 retrovirus (obtained from Alex Toker, Beth Israel Deaconess Medical Center, Boston, MA) to generate the ß4-shRNA + ß4 cell line.

Biochemical analysis. For semiquantitative PCR, RNA isolation was done with the RNeasy mini kit (Qiagen, Valencia, CA) and 1 µg of total RNA was used with the Qiagen one-step reverse transcription-PCR kit as described by the manufacturer. The following primer sets were used: ß4-FWD, 5' GCATCGTGGTCATGGAGAGCAG 3'; ß4-REV, 5' CAATGTCCCTCGTGCACACAGC 3'; and glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-FWD, 5' CCTGGCCAAGGTCATCCATGAC 3', GAPDH-REV, 5' TGTCATACCAGGAAATGAGCTTG 3'.

For immunoblotting, cell lysates (30 µg) and membranes were prepared as described previously (17). The blots were incubated in a 1:5,000 dilution of rabbit polyclonal anti-ß4-integrin (505; ref. 18) or 0.5 µg/mL anti-ß-actin (Sigma, St. Louis, MO) followed by 0.04 µg/mL of peroxidase-conjugated donkey anti-rabbit secondary antibody (Jackson ImmunoResearch, West Grove, PA). All membranes were visualized by SuperSignal West Pico chemiluminescence (Pierce, Rockford, IL).

To evaluate cell surface expression, cells were incubated with 5 µg/mL of the following primary antibodies for 30 minutes at 4°C: 3E1, mouse anti-ß4 integrin monoclonal antibody (mAb; obtained from Rita Falconi, Regina Elena Cancer Institute, Rome, Italy); GOH3, rat anti-{alpha}6 integrin mAb (Immunotech, Westbrook, ME); MC13, mouse anti-ß1 integrin mAb (obtained from Steve Akiyama, NIH, Research Triangle Park, NC); P1B5, mouse anti-{alpha}3 integrin mAb (Life Technologies, Gaithersburg, MD); rat and mouse control IgG (Sigma). Cells were then conjugated with either antimouse phycoerythrin (ß4, ß1, and {alpha}3) or antirat CY2 ({alpha}6; both from Jackson ImmunoResearch) at 200 µg/mL for 30 minutes at 4°C and analyzed by flow cytometry.

Matrigel cultures. In duplicate wells of a 24-well dish, a base layer of Matrigel (BD Biosciences, Bedford, MA; 200 µL/well) was overlaid with 1 x 104 cells suspended in 300 µL of a 2:1 mixture of PBS and Matrigel. Complete serum-containing medium (0.5 mL/well) covered the cell-containing layer and was replaced every 3 days. For the experiments with recombinant growth factors, either human VEGF165 or epidermal growth factor (EGF; R&D Systems, Minneapolis, MN), both at a final concentration of 100 ng/mL, were resuspended in the medium prior to use. Binding of recombinant VEGF was aided by the presence of 10 µg/mL heparin (Sigma). Images were captured with IP Lab Spectrum software (Webster, NY). Single-cell suspensions of the Matrigel cultures were yielded by dispase treatment (BD Biosciences) for 2 hours at 37°C followed by trypsin (Life Technologies) digestion for 10 minutes at 37°C. Survival assays were done on the recovered cells as outlined below.

Survival assays. The Matrigel-recovered cells were labeled with either Annexin V-FITC and propidium iodide (PI; Biosource, Camarillo, CA) or cleaved caspase-3 (Asp175) antibody (Cell Signaling, Beverly, MA). For Annexin V-FITC, PI analysis, cells were incubated for 15 minutes with 5 µg/mL Annexin V-FITC in Annexin buffer [10 mmol/L Hepes-NaOH (pH 7.4), 140 mmol/L NaCl, 2.5 mmol/L CaCl2]. Cells were then resuspended in Annexin buffer containing 5 µg/mL PI. For cleaved caspase-3 detection, cells were prepared as outlined by the manufacturer and stained with a 1:25 dilution of rabbit anti-cleaved caspase-3 or 5 µg/mL rabbit IgG as a control (Sigma) for 30 minutes. Cells were then labeled with 200 µg/mL peroxidase-conjugated donkey anti-rabbit secondary antibody (Jackson ImmunoResearch). All labeled cells were analyzed by flow cytometry.

Soft agar assay. Cells (5.0 x 103 cells per well of a six-well plate) were suspended in 2 mL of serum-containing medium containing 0.3% agar (Life Technologies) and plated over a 1 mL base layer of 0.75% agar in triplicate. The cultures were overlaid with complete medium (0.5 mL/well) and replaced every 3 days. After 2 weeks, the total number of colonies was quantified by counting 50 fields per well using bright-field optics. Images were captured by IP Lab Spectrum software.

Mammary fat pad injections. Cells were trypsinized, washed thrice in PBS, and resuspended in 40 µL phenol-free Matrigel immediately prior to orthotopic injection. For each experiment, cell survival at the time of injection was assessed by measuring the percentage of Annexin V-phycoerythrin+ (PharMingen, San Diego, CA) cells as described previously (17). Following cell preparation, female immunocompromised mice (National Cancer Institute, Frederick, MD) at 7 to 9 weeks of age were anesthetized and injected in the mammary fat pad (2 x 106 cells per injection, one injection site per mouse). At 15 to 17 weeks of age, the animals were sacrificed and the tumors were harvested, weighed, and fixed overnight in 10% neutral-buffered formalin (Fisher, Pittsburgh, PA) for histologic processing (Rodent Histopathology Core, Dana-Farber/Harvard Cancer Center, Boston, MA). The average number of mitoses (per mm2) was determined by scoring H&E stained tumor sections for definite mitotic figures.

Terminal nucleotidyl transferase–mediated dUTP nick end labeling. Tumor tissues were analyzed for apoptosis as outlined by the manufacturer (Roche, Indianapolis, IN). Briefly, the paraffin-embedded tissues were dewaxed and rehydrated prior to treatment with 20 µg/mL proteinase K (Roche) for 30 minutes at 37°C. Tissues were incubated with or without fluorescein-labeled terminal transferase for 60 minutes at 37°C followed by incubation with a peroxidase-conjugated antifluorescein antibody for 30 minutes. The presence of peroxidase was detected by staining with 3,3'-diaminobenzidine + substrate-chromogen (DakoCytomation, Carpinteria, CA) for 10 minutes at room temperature. Tissues were counterstained in hematoxylin prior to image capture with Spot software (Diagnostic Instruments, Sterling Heights, MI).

Immunohistochemistry. Paraffin-embedded tumors were dewaxed and rehydrated, endogenous peroxidase activity was quenched for 30 minutes with 0.3% hydrogen peroxide, and trypsin pretreatment was done for 12 minutes with 0.1% trypsin (EMD Biosciences; La Jolla, CA) followed by a 5 minute incubation with 0.1 µg/mL soybean trypsin inhibitor (EMD Biosciences). To inhibit nonspecific staining, a biotin blocking system (Dako) was used as outlined in the manufacturer's protocol prior to the staining procedure. The tissues were blocked with goat serum for 60 minutes followed by overnight incubation at 4°C with 5 µg/mL antihuman VEGF antibody (Calbiochem, La Jolla, CA) or rabbit IgG (Sigma) as a negative control. Goat anti-rabbit biotinylated secondary antibody solution and immunoperoxidase detection reagents were obtained from the Vectastain Elite ABC Kit (Vector Laboratories, Burlingame, CA) and incubations were done as outlined by the manufacturer. Peroxidase activity was detected with 3,3'-diaminobenzidine substrate-chromogen for 10 minutes prior to counterstaining with hematoxylin. Tissues were then mounted and images were captured as described above.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Generation of a breast carcinoma cell line deficient in {alpha}6ß4 integrin expression. The SUM-159 breast carcinoma cell line (19, 20) was transduced with retroviruses expressing either a ß4-shRNA or a Scr-shRNA as a control. The ß4-shRNA cell line was largely devoid of ß4 expression compared with the Scr-shRNA cell line at both the mRNA (Fig. 1A) and protein (Fig. 1B) level. Moreover, cell surface expression of ß4 was decreased by 62% on the ß4-shRNA cell line compared with the Scr-shRNA cell line (Fig. 1C). The specificity of the ß4 knock-down was confirmed by comparing the cell surface expression of other integrin subunits including {alpha}3, {alpha}6, and ß1 in the ß4-shRNA and Scr-shRNA cell lines. No significant difference in the cell surface expression of {alpha}3 or ß1 subunits was observed between the two cell lines; however, the ß4-shRNA cell line showed an ~40% decrease in expression of the {alpha}6 subunit (Fig. 1D). The {alpha}6 integrin heterodimerizes with both ß1 and ß4 subunits (21, 22); however, the majority of {alpha}6 associates with ß4 in this cell line.1 Thus, the observed loss of {alpha}6 expression is a predictable consequence of reduced ß4 expression on the cell surface.



View larger version (40K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. The generation of a SUM-159 breast carcinoma cell line deficient in {alpha}6ß4 integrin expression. A, semiquantitative PCR was done with RNA isolated from Scr- and ß4-shRNA cell lines using ß4 and GAPDH primers. A sample without RNA (–) was done as a negative control. B, extracts were prepared from Scr- and ß4-shRNA cell lines and equal amounts of total protein (30 µg) were resolved by SDS-PAGE and immunoblotted for ß4 and ß-actin. C, to evaluate the cell surface expression of {alpha}6ß4, Scr-, and ß4-shRNA cell lines were incubated with either mouse anti-ß4 integrin antibody (filled histograms) or mouse IgG as a control (unfilled histograms) followed by antimouse phycoerythrin-conjugated secondary antibody and analyzed by flow cytometry. D, the cell surface expression of other integrin subunits including {alpha}3, ß1, and {alpha}6 was compared in the Scr-shRNA (unfilled histograms, heavy outline) and ß4-shRNA (unfilled histograms, light outline) cell lines. Filled histograms, analysis of the Scr-shRNA cells following incubation with either mouse IgG ({alpha}3 and ß1) or rat IgG ({alpha}6) as a control. E, to reexpress the ß4 subunit into the ß4-shRNA SUM-159 cell line, a ß4 retrovirus was used to infect ß4-shRNA cells (–) yielding a ß4-shRNA + ß4 cell line (+). Extracts (30 µg protein) were resolved by SDS-PAGE and immunoblotted for ß4 and ß-actin.

 
To control for the specificity of the ß4-shRNA in subsequent functional experiments, we reexpressed the human ß4 integrin in the ß4-shRNA cells to generate a ß4-shRNA + ß4 SUM-159 cell line (Fig. 1E). For this purpose, we took advantage of the observation that the RISC enzyme complex responsible for shRNA can be saturated (23) and we used a ß4 retrovirus to infect the ß4-shRNA cell line and consequently "swamp" the shRNA-controlling enzyme. This approach alleviated concerns that a nonhuman ß4 subunit or a mutant form of ß4 resistant to the designed shRNA sequence would not properly heterodimerize with endogenous human {alpha}6 subunits. Taken together, these data show the production of a SUM-159 breast carcinoma cell line that is specifically deficient in {alpha}6ß4 integrin expression and the generation of a ß4-shRNA + ß4 cell line as a functional control.

Loss of endogenous {alpha}6ß4 integrin expression promotes cell death in vitro. To assess the contribution of {alpha}6ß4 to the survival of breast carcinoma cells in a three-dimensional matrix, we embedded Scr-, ß4-, and ß4-shRNA + ß4 cells in Matrigel. After 10 days, cells were isolated from the cultures and the percentage of Annexin V-FITC+, PI– cells was determined. A 15% increase in the level of apoptosis was detected in the ß4-shRNA cells compared with either the ß4-shRNA + ß4 or Scr-shRNA cells (Fig. 2A). Additional evidence to link {alpha}6ß4 to survival in Matrigel was obtained by assaying for the presence of a cleaved fragment of caspase-3, a product of late stage apoptosis signaling. In these experiments, the ß4-shRNA cell line showed a 15% increase in caspase-3 cleavage compared with either the ß4-shRNA + ß4 or Scr-shRNA cells (Fig. 2B). The morphology of these cell lines in the Matrigel cultures substantiated the survival results shown in Fig. 2A and B. A healthy stellate morphology characterized the Scr-shRNA cell line (19), whereas the ß4-shRNA cell line appeared aggregated and devoid of cellular projections (Fig. 2C). Reexpression of ß4 largely restored the stellate appearance in the ß4-shRNA cells. Interestingly, the apoptosis observed in the ß4-shRNA cells was dependent on the three-dimensional architecture of the cell line and could not be induced by serum deprivation alone (data not shown). Thus, reduced {alpha}6ß4 expression promotes apoptosis in SUM-159 breast carcinoma cells when grown in three-dimensional culture conditions and this cell death can be prevented by reexpression of ß4 into the ß4-deficient cell line.



View larger version (38K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Reduced {alpha}6ß4 expression enhances apoptosis. Scr-, ß4-, and ß4-shRNA + ß4 cell lines were cultured in Matrigel for 10 days. Single-cell suspensions were isolated by dispase treatment and apoptosis was measured by flow cytometry as a percentage of Annexin V-FITC+, PI– cells or intracellular caspase-3 cleavage. A, columns, percentage of Annexin V-FITC+, PI– cells from three independent experiments done in duplicate; bars, ± SD. The level of cell death in the Scr-shRNA cell line was set at 20% in each experiment to permit comparisons between separate assays and cell lines. Loss of {alpha}6ß4 integrin expression led to a significant increase in the level of apoptosis under these growth conditions (*, two-tailed t test; P = 0.012). This cell death could be reversed to the same level as observed in the Scr-shRNA cell line by reexpressing the ß4 subunit into the ß4-shRNA SUM-159 cell line. B, columns, level of caspase-3 cleavage was measured in two independent experiments done in triplicate; bars, ± SD. For these experiments, the Scr-shRNA cell line was incubated with rabbit IgG antibody as the isotype control and the resulting nonspecific staining was set at 5% and subtracted from all values. The percentage of cleaved caspase-3 was significantly increased following loss of {alpha}6ß4 expression (*, one-tailed t test; P < 0.05) and this cell death could be rescued with the ß4-shRNA + ß4 cell line ({dagger}, one-tailed t test; P < 0.05). C, the morphology of these cell lines in Matrigel cultures illustrates the survival results shown in (A) and (B). A healthy stellate morphology characterizes the Scr-shRNA cell line (a), whereas the ß4-shRNA cell line (b) is aggregated and devoid of cellular projections. Reexpression of ß4 expression in the ß4-deficient cell line largely restores the stellate appearance observed in the Scr-shRNA cell line (c). Magnification, x10.

 
Recombinant vascular endothelial growth factor rescues the ß4-shRNA cell line from apoptosis. Given that {alpha}6ß4 can regulate VEGF expression and that VEGF is a survival factor for breast carcinoma cells (1315), we hypothesized that exogenous VEGF should prevent the increased apoptosis observed in the ß4-shRNA cells. Indeed, the presence of recombinant VEGF and heparin in the medium overlaying the three-dimensional Matrigel cultures significantly inhibited the level of cell death detected in the ß4-shRNA cell line (Fig. 3A). ß4-shRNA cells incubated with heparin alone as a control showed no difference in cell death compared with ß4-shRNA cells in the absence of exogenous factors (data not shown). The ability of VEGF to prevent the ß4-shRNA cell line from undergoing apoptosis was specific to VEGF expression and was not observed with recombinant EGF. Furthermore, recombinant VEGF, but not EGF, could rescue the stellate morphology of this cell line in Matrigel (Fig. 3B). Prior to these experiments, VEGF and EGF receptor presence was confirmed by flow cytometry analysis (data not shown).



View larger version (56K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Recombinant VEGF rescues the ß4-shRNA cell line from cell death. After 10 days in Matrigel, Scr-, ß4-shRNA, and ß4-shRNA cells overlaid with complete medium containing either recombinant VEGF or EGF (each at 100 ng/mL) were isolated and apoptosis was assessed by flow cytometry. A, columns, percentage of Annexin V-FITC+, PI– cells from two independent experiments done in duplicate; bars, ± SD. The level of cell death in the Scr-shRNA cell line was set at 20% in each experiment to permit comparison between separate assays and cell lines. Recombinant VEGF, but not EGF, significantly inhibited the cell death that occurred in the ß4-shRNA cell line (*, two-tailed t test, P = 0.02). B, representative images at x4 magnification of the ß4-shRNA cell line (a) and the ß4-shRNA cell line incubated with VEGF (b) or EGF (c) showed that the VEGF-rescued cells have extensive projections, whereas the EGF-incubated cells were rounded and aggregated and more closely resembled the ß4-shRNA cell line.

 
Loss of {alpha}6ß4 integrin expression inhibits colony formation and growth in soft agar assays. To predict the role of {alpha}6ß4 in breast tumor formation, soft agar assays with the Scr-, ß4-, and ß4-shRNA + ß4 cell lines were done. We discovered that the ß4-shRNA cell line produced 67% fewer colonies than the Scr-shRNA cell line in 2-week experiments (Fig. 4A). Reexpression of ß4 in the ß4-shRNA cell line rescued this phenomenon and significantly increased the number of colonies that formed compared with the ß4-shRNA cell line. Furthermore, those colonies that were formed by the ß4-shRNA cells were considerably smaller than the colonies that resulted from the Scr-shRNA and ß4-shRNA + ß4 cell lines (Fig. 4B). Importantly, these data suggested that the {alpha}6ß4 integrin contributes to the tumorigenicity of the SUM-159 cell line.



View larger version (38K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. The {alpha}6ß4 integrin is required for anchorage-independent survival and growth in the SUM-159 breast carcinoma cell line. A, the Scr-, ß4-, and ß4-shRNA + ß4 cell lines were grown in complete medium containing 0.3% agar for 2 weeks. Columns, mean number of colonies formed from two independent experiments; bars, ± SD. Experiments were done in triplicate and 50 fields per well were counted. The number of colonies formed was significantly less for ß4-shRNA cells than for Scr-shRNA cells (*, two-tailed t test, P < 0.001), whereas reexpression of ß4 led to a significant increase in colony number compared with the ß4-shRNA cell line ({dagger}, two-tailed t test, P = 0.005). B, representative bright-field images captured at x4 magnification, showing that the colonies formed by the ß4-shRNA cells (b) were considerably smaller than the colonies formed by either the Scr-shRNA (a) or ß4-shRNA + ß4 (c) cell lines.

 
Expression of the {alpha}6ß4 integrin is necessary for formation of orthotopic tumors. To investigate our hypothesis that {alpha}6ß4 is an important contributor to tumor formation in vivo, we injected Scr-, ß4-, and ß4-shRNA + ß4 cells into the mammary fat pad of immunocompromised mice. Prior to injection, the percentage of apoptotic cells was assessed and no significant difference in survival was found between the cell lines for any experiment (data not shown). In mice injected with ß4-shRNA cells, the frequency of tumor formation was decreased by 48% compared with mice injected with Scr-shRNA cells (Table 1). The ß4-shRNA + ß4 cell line increased the percentage of tumor formation by 24% compared with the ß4-shRNA–injected mice, thereby demonstrating a partial rescue of the ß4-shRNA phenotype. The mean tumor weight of the mice bearing ß4-shRNA tumors was ~3-fold less than the average weight of the Scr-shRNA tumors, whereas the tumors that formed following injection of the ß4-shRNA + ß4 cells were relatively the same weight, or slightly heavier, than the Scr-shRNA tumors. Further analysis revealed that the number of mitotic figures in the Scr-shRNA (41.1 ± 20.6 mm2) and ß4-shRNA (48.7 ± 16.1 mm2) tumors was statistically equivalent and indicated that a role for {alpha}6ß4 in tumor cell proliferation was not responsible for the differences in tumor formation.


View this table:
[in this window]
[in a new window]

 
Table 1. Expression of the {alpha}6ß4 integrin is necessary for tumor formation in vivo

 
Tumors deficient in {alpha}6ß4 expression exhibit elevated levels of apoptosis and decreased vascular endothelial growth factor expression. To determine whether the link between loss of {alpha}6ß4 expression and cell death extends in vivo, tumors formed following orthotopic injection of Scr-, ß4-, and ß4-shRNA + ß4 cells were analyzed for apoptosis using in situ terminal nucleotidyl transferase–mediated dUTP nick end labeling (TUNEL) technology. The nonnecrotic regions of tumors formed from ß4-shRNA injected cells showed dramatically increased levels of apoptosis compared with tumors resulting from either Scr-shRNA- or ß4-shRNA + ß4–injected cells (Fig. 5A-D). We speculated that this increased apoptosis might result from decreased VEGF expression in the absence of the {alpha}6ß4 integrin (14). To compare the expression of VEGF in tumors formed from the Scr-, ß4-, and ß4-shRNA + ß4 cells, we did immunohistochemistry using an antibody that recognizes human VEGF. This approach enabled us to distinguish VEGF produced by the human tumor cells from VEGF produced by host stromal cells. Tumors that arose from ß4-shRNA cells displayed limited VEGF immunostaining (Fig. 5E-H). In comparison, high levels of VEGF expression were observed in the tumors isolated from Scr-shRNA- and ß4-shRNA + ß4–injected mice. Taken together, these data indicate that loss of {alpha}6ß4 expression in breast carcinoma cells promotes apoptosis in vivo that is associated with decreased VEGF expression.



View larger version (67K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Increased apoptosis and decreased VEGF in mammary tumors formed in ß4-shRNA–injected mice. Assessment of the level of cell death (A-D) occurring in the mammary tumors that formed following orthotopic injection of the Scr-shRNA (B), ß4-shRNA (C), and ß4-shRNA + ß4 (D) cell lines was determined by TUNEL labeling. The red-brown staining is indicative of apoptosis and is dramatically enhanced in the tumors formed following injection of the ß4-shRNA cell line (C) compared with either the Scr-shRNA (B) or ß4-shRNA + ß4 cell lines (D). A, ß4-shRNA tumor incubated in the absence of terminal transferase enzyme as a negative (–) control. VEGF immunohistochemistry (E-H) done on tumors resulting from injection of Scr-shRNA (F), ß4-shRNA (G), and ß4-shRNA + ß4 (H) cell lines revealed a much higher level of VEGF expression in the Scr-shRNA (F) and ß4-shRNA + ß4 (H) tumors than in the ß4-shRNA (G) tumors. E, an isotype or negative (–) control-labeled sample obtained from a Scr-shRNA–injected mouse. Representative of data observed in three independent experiments that were done on a minimum of four separate mammary tumors obtained from each cell line. Bar, 50 µ.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We conclude from the data presented here that the {alpha}6ß4 integrin contributes to the survival of human breast carcinoma cells injected into immunocompromised mice. Cells that are deficient in the expression of this integrin exhibit a significant decrease in their ability to form orthotopic tumors compared with control cells because of increased apoptosis. Interestingly, loss of {alpha}6ß4 expression had no effect on the proliferative capacity of these cells in vivo as determined by the number of mitotic figures in the tumors. The ability of {alpha}6ß4 to sustain the survival of breast carcinoma cells in vivo is linked to the expression of VEGF by these cells, an observation that substantiates an important role for VEGF signaling in tumor formation (24). Collectively, our data provide an important extension of the numerous in vitro studies that have highlighted the importance of {alpha}6ß4 for the function of breast and other carcinoma cells (36), and they reinforce a limited number of studies using patient samples that have linked {alpha}6ß4 to breast cancer progression (25, 26).

Our data support the hypothesis that the most critical function for {alpha}6ß4 in cancer is to impede apoptosis and sustain tumor survival. Initially, our group showed that {alpha}6ß4 expression is necessary to prevent the apoptosis of breast carcinoma cells in response to serum and matrix deprivation by activating the phosphoinositide-3-kinase/Akt pathway (27). The ability of {alpha}6ß4 to promote survival in these studies was specific to carcinoma cells that expressed mutant forms of p53 (28). These events were not observed in carcinoma cells that expressed wild-type p53 because {alpha}6ß4 stimulated p53-dependent caspase-3 activity that led to inactivation of Akt (27). Subsequent work indicated that one mechanism by which {alpha}6ß4 sustains survival is to regulate the translation of VEGF and consequent autocrine VEGF survival signaling (14). Specifically, {alpha}6ß4 regulates 4E-BP1 phosphorylation, a translational repressor that inhibits the function of eukaryotic translation initiation factor 4E, in a phosphoinositide-3-kinase- and mTOR-dependent pathway. Moreover, {alpha}6ß4 lost its ability to prevent the cell death of carcinoma cells maintained under "stress" conditions in which VEGF expression had been reduced, thus, directly implicating VEGF as a downstream effector of {alpha}6ß4-mediated cell survival (14).

More recently, studies employing three-dimensional cultures have substantiated the importance of {alpha}6ß4 for the survival of breast carcinoma cells. Initially, it was reported that activation of {alpha}6ß4 signaling in three-dimensional mammary epithelial cells conferred resistance to apoptosis by maintaining a polarized tissue architecture (29). Additional studies have suggested that {alpha}6ß4 can mediate the anchorage-independent survival of malignant mammary epithelial cells by a mechanism that involves secretion of laminin-5 followed by ligation of {alpha}6ß4 and subsequent activation of a Rac GTPase/nuclear factor {kappa}B signaling pathway (30). Although the involvement of VEGF was not examined in these studies, it is worth noting that VEGF can activate nuclear factor {kappa}B (31), suggesting that the mechanisms that have been proposed for {alpha}6ß4-mediated survival signaling are not mutually exclusive. Taken together, the existing in vitro data support our in vivo results. The alternative hypothesis, however, that could have been predicted from the existing literature is that loss of {alpha}6ß4 expression would affect tumor invasion and metastasis and not the formation of the primary tumor. As such, our observation that loss of {alpha}6ß4 expression significantly diminished primary tumor formation is significant.

A role for {alpha}6ß4 in carcinoma formation is suggested by other recent studies on the genesis of squamous cell carcinomas. Using a model system that involves the retroviral expression of specific genes in primary, human keratinocytes, and the subsequent use of these cells for grafting on immune-deficient mice, Khavari's group reported that coexpression of oncogenic Ras with molecules that impede Ras-induced growth arrest results in invasive epidermal carcinoma resembling squamous cell carcinomas (9). Of interest, keratinocytes deficient in the expression of either the ß4 subunit or laminin-5 (isolated from patients with blistering skin disease) were unable to form tumors, but reexpression of the respective genes restored their ability to form invasive tumors (9). In a related study using a transgenic model that targeted {alpha}6ß4 expression in the suprabasal levels of the mouse epidermis, an increased frequency of papillomas, carcinomas, and metastases was observed following induction with a chemical carcinogen (10). The mechanism seems to involve the suppression of transforming growth factor-ß signaling by {alpha}6ß4 and the resulting inhibition of transforming growth factor-ß from suppressing the clonal expansion of initiated cells in the epidermal basal layer (10). Although survival was not assessed directly in these models, a link between {alpha}6ß4 and the survival of squamous carcinoma cells is a reasonable hypothesis based on our data. Given these tantalizing reports, it will be informative to assess the contribution of {alpha}6ß4 to survival in other models of carcinoma formation.

The data presented in this report strengthens the hypothesis that autocrine VEGF signaling is an important component of tumor progression. More specifically, we showed that VEGF165 functions as a survival factor in breast carcinoma cells by signaling through the neuropilin-1 receptor (13), a finding recently confirmed by others (32). In vivo, enhanced tumor growth in polyoma virus middle T-antigen mice was observed in a transgenic model targeting overexpression of VEGF to mammary epithelial cells (24). This increased tumor growth was attributed, in part, to inhibition of apoptosis by autocrine VEGF signaling. A role for autocrine VEGF in tumor formation and growth has also been observed in xenografted human leukemias and lymphomas (33, 34). Thus, the ability of exogenous VEGF to rescue the ß4-deficient breast carcinoma cells from apoptosis and the striking decrease in VEGF expression in the orthotopic tumors reported here adds to the increasing body of evidence supporting the importance of autocrine VEGF pathways in tumor formation and survival.

An issue that arises from the foregoing discussion is whether {alpha}6ß4-induced VEGF expression in breast carcinoma cells stimulates tumor angiogenesis. Indeed, VEGF produced by both tumor and stromal cells could affect angiogenesis (35). Although we did not observe gross differences in the vasculature between control and ß4-deficient tumors, we cannot exclude some effect of {alpha}6ß4 expression on angiogenesis in these experiments. With this in mind, recent studies have examined the expression of {alpha}6ß4 on endothelial cells and its possible role in angiogenesis. Based on the analysis of {alpha}6ß4 expression in vascular endothelial cells during the development of the mouse whisker pad, it was inferred that this integrin actually inhibits the angiogenic switch (36). In contrast, another study argued that {alpha}6ß4 promotes the migration and invasion of endothelial cells during the invasive phase of tumor angiogenesis (37). This conclusion was supported by the observation that mice carrying a targeted deletion of the COOH-terminal portion of the ß4-tail formed smaller and less vascularized tumors than wild-type mice following s.c. injection of cancer cells (37). Interestingly, however, loss of {alpha}6ß4 signaling in the latter study did not affect tumor angiogenesis in an orthotopic model of mammary carcinogenesis, suggesting that the role of {alpha}6ß4 in tumor angiogenesis may not be universal (37). Clearly, more studies are warranted to assess the contribution of {alpha}6ß4 to angiogenesis in breast tumors. Nonetheless, the collective data argue strongly that {alpha}6ß4 influences the survival of breast tumor cells and that one mechanism involves its ability to regulate autocrine VEGF signaling.

In summary, our data reveal a contribution of the {alpha}6ß4 integrin to tumor formation, and they substantiate the hypothesis that {alpha}6ß4 plays an important role in regulating the expression of VEGF in carcinoma cells and that VEGF functions as a survival factor in nascent tumors. We emphasize, however, that a role for {alpha}6ß4 in the survival of nascent tumors does not preclude its involvement in later stages of invasion and metastasis. With this in mind, the use of a conditional system to express ß4-shRNA at specific stages of tumor formation and progression will be valuable.


    Acknowledgments
 
Grant support: U.S. Army Medical Research Program grants BC010115 (E.A. Lipscomb) and W81XWH-04-1-0360 (K.J. Simpson), and by NIH grant CA80789 (A.M. Mercurio).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We acknowledge Robin Bachelder, David Bellovin, Isaac Rabinovitz, Janice Nagy, and Donald Senger for helpful discussions; and Luke Wanami for assistance with tissue processing.


    Footnotes
 
Note: K.J. Simpson is currently at the Department of Cell Biology, Harvard Medical School, Boston, MA 02215.

S.R. Lyle is currently at the Department of Cancer Biology, University of Massachusetts Medical School, Worcester, MA 01605.

A.S. Dugan is currently at the Department of Molecular Microbiology and Immunology, Brown University, Providence, RI 02912.

1 S.O. Yoon and A.M. Mercurio, unpublished observation. Back

Received 7/ 1/05. Revised 8/16/05. Accepted 9/ 2/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Green KJ, Jones JC. Desmosomes and hemidesmosomes: structure and function of molecular components. FASEB J 1996;10:871–81.[Abstract]
  2. Borradori L, Sonnenberg A. Structure and function of hemidesmosomes: more than simple adhesion complexes. J Invest Dermatol 1999;112:411–8.[CrossRef][Medline]
  3. Rabinovitz I, Mercurio AM. The integrin {alpha}6ß4 and the biology of carcinoma. Biochem Cell Biol 1996;74:811–21.[Medline]
  4. Mercurio AM, Rabinovitz I. Towards a mechanistic understanding of tumor invasion—lessons from the {alpha}6ß4 integrin. Semin Cancer Biol 2001;11:129–41.[CrossRef][Medline]
  5. Mercurio AM, Rabinovitz I, Shaw LM. The {alpha}6ß4 integrin and epithelial cell migration. Curr Opin Cell Biol 2001;13:541–5.[CrossRef][Medline]
  6. Giannelli G, Astigiano S, Antonaci S, et al. Role of the {alpha}3ß1 and {alpha}6ß4 integrins in tumor invasion. Clin Exp Metastasis 2002;19:217–23.[CrossRef][Medline]
  7. Lipscomb EA, Mercurio AM. Mobilization and activation of a signaling competent {alpha}6ß4 integrin underlies its contribution to carcinoma progression. Cancer Metastasis Rev. In press 2005.
  8. Santoro MM, Gaudino G, Marchisio PC. The MSP receptor regulates {alpha}6ß4 and {alpha}3ß1 integrins via 14-3-3 proteins in keratinocyte migration. Dev Cell 2003;5:257–71.[CrossRef][Medline]
  9. Dajee M, Lazarov M, Zhang JY, et al. NF-{kappa}B blockade and oncogenic Ras trigger invasive human epidermal neoplasia. Nature 2003;421:639–43.[CrossRef][Medline]
  10. Owens DM, Romero MR, Gardner C, Watt FM. Suprabasal {alpha}6ß4 integrin expression in epidermis results in enhanced tumourigenesis and disruption of TGFß signalling. J Cell Sci 2003;116:3783–91.[Abstract/Free Full Text]
  11. Shaw LM, Rabinovitz I, Wang HH, Toker A, Mercurio AM. Activation of phosphoinositide 3-OH kinase by the {alpha}6ß4 integrin promotes carcinoma invasion. Cell 1997;91:949–60.[CrossRef][Medline]
  12. Sui G, Soohoo C, Affar EB, et al. A DNA vector-based RNAi technology to suppress gene expression in mammalian cells. Proc Natl Acad Sci U S A 2002;99:5515–20.[Abstract/Free Full Text]
  13. Bachelder RE, Crago A, Chung J, et al. Vascular endothelial growth factor is an autocrine survival factor for neuropilin-expressing breast carcinoma cells. Cancer Res 2001;61:5736–40.[Abstract/Free Full Text]
  14. Chung J, Bachelder RE, Lipscomb EA, Shaw LM, Mercurio AM. Integrin ({alpha}6ß4) regulation of eIF-4E activity and VEGF translation: a survival mechanism for carcinoma cells. J Cell Biol 2002;158:165–74.[Abstract/Free Full Text]
  15. Dowell JE, Amirkhan RH, Lai WS, Frawley WH, Minna JD. Survival in small cell lung cancer is independent of tumor expression of VEGF and COX-2. Anticancer Res 2004;24:2367–73.[Abstract/Free Full Text]
  16. Chung J, Yoon SO, Lipscomb EA, Mercurio AM. The Met receptor and {alpha}6ß4 integrin can function independently to promote carcinoma invasion. J Biol Chem 2004;279:32287–93.[Abstract/Free Full Text]
  17. Lipscomb EA, Dugan AS, Rabinovitz I, Mercurio AM. Use of RNA interference to inhibit integrin ({alpha}6ß4)-mediated invasion and migration of breast carcinoma cells. Clin Exp Metastasis 2003;20:569–76.[CrossRef][Medline]
  18. Rabinovitz I, Toker A, Mercurio AM. Protein kinase C-dependent mobilization of the {alpha}6ß4 integrin from hemidesmosomes and its association with actin-rich cell protrusions drive the chemotactic migration of carcinoma cells. J Cell Biol 1999;146:1147–60.[Abstract/Free Full Text]
  19. Flanagan L, Van Weelden K, Ammerman C, Ethier SP, Welsh J. SUM-159PT cells: a novel estrogen independent human breast cancer model system. Breast Cancer Res Treat 1999;58:193–204.[CrossRef][Medline]
  20. Zajchowski DA, Bartholdi MF, Gong Y, et al. Identification of gene expression profiles that predict the aggressive behavior of breast cancer cells. Cancer Res 2001;61:5168–78.[Abstract/Free Full Text]
  21. Hemler ME, Crouse C, Sonnenberg A. Association of the VLA {alpha}6 subunit with a novel protein. A possible alternative to the common VLA ß1 subunit on certain cell lines. J Biol Chem 1989;264:6529–35.[Abstract/Free Full Text]
  22. Kajiji S, Tamura RN, Quaranta V. A novel integrin ({alpha}Eß4) from human epithelial cells suggests a fourth family of integrin adhesion receptors. EMBO J 1989;8:673–80.[Medline]
  23. Dykxhoorn DM, Novina CD, Sharp PA. Killing the messenger: short RNAs that silence gene expression. Nat Rev Mol Cell Biol 2003;4:457–67.[CrossRef][Medline]
  24. Schoeffner DJ, Matheny SL, Akahane T, et al. VEGF contributes to mammary tumor growth in transgenic mice through paracrine and autocrine mechanisms. Lab Invest 2005;85:608–23.[CrossRef][Medline]
  25. Friedrichs K, Ruiz P, Franke F, Gille I, Terpe HJ, Imhof BA. High expression level of {alpha}6 integrin in human breast carcinoma is correlated with reduced survival. Cancer Res 1995;55:901–6.[Abstract/Free Full Text]
  26. Tagliabue E, Ghirelli C, Squicciarini P, Aiello P, Colnaghi MI, Menard S. Prognostic value of {alpha}6ß4 integrin expression in breast carcinomas is affected by laminin production from tumor cells. Clin Cancer Res 1998;4:407–10.[Abstract/Free Full Text]
  27. Bachelder RE, Ribick MJ, Marchetti A, et al. p53 inhibits {alpha}6ß4 integrin survival signaling by promoting the caspase 3-dependent cleavage of AKT/PKB. J Cell Biol 1999;147:1063–72.[Abstract/Free Full Text]
  28. Bachelder RE, Marchetti A, Falcioni R, Soddu S, Mercurio AM. Activation of p53 function in carcinoma cells by the {alpha}6ß4 integrin. J Biol Chem 1999;274:20733–7.[Abstract/Free Full Text]
  29. Weaver VM, Lelievre S, Lakins JN, et al. ß4 Integrin-dependent formation of polarized three-dimensional architecture confers resistance to apoptosis in normal and malignant mammary epithelium. Cancer Cell 2002;2:205–16.[CrossRef][Medline]
  30. Zahir N, Lakins JN, Russell A, et al. Autocrine laminin-5 ligates {alpha}6ß4 integrin and activates RAC and NF{kappa}B to mediate anchorage-independent survival of mammary tumors. J Cell Biol 2003;163:1397–407.[Abstract/Free Full Text]
  31. Farahani M, Treweeke AT, Toh CH, et al. Autocrine VEGF mediates the antiapoptotic effect of CD154 on CLL cells. Leukemia 2005;19:524–30.[Medline]
  32. Castro-Rivera E, Ran S, Thorpe P, Minna JD. Semaphorin 3B (SEMA3B) induces apoptosis in lung and breast cancer, whereas VEGF165 antagonizes this effect. Proc Natl Acad Sci U S A 2004;101:11432–7.[Abstract/Free Full Text]
  33. Dias S, Hattori K, Heissig B, et al. Inhibition of both paracrine and autocrine VEGF/VEGFR-2 signaling pathways is essential to induce long-term remission of xenotransplanted human leukemias. Proc Natl Acad Sci U S A 2001;98:10857–62.[Abstract/Free Full Text]
  34. Wang ES, Teruya-Feldstein J, Wu Y, Zhu Z, Hicklin DJ, Moore MA. Targeting autocrine and paracrine VEGF receptor pathways inhibits human lymphoma xenografts in vivo. Blood 2004;104:2893–902.[Abstract/Free Full Text]
  35. Senger DR, Van De WL. VEGF expression by epithelial and stromal cell compartments: resolving a controversy. Am J Pathol 2000;157:1–3.[Free Full Text]
  36. Hiran TS, Mazurkiewicz JE, Kreienberg P, Rice FL, LaFlamme SE. Endothelial expression of the {alpha}6ß4 integrin is negatively regulated during angiogenesis. J Cell Sci 2003;116:3771–81.[Abstract/Free Full Text]
  37. Nikolopoulos SN, Blaikie P, Yoshioka T, Guo W, Giancotti FG. Integrin ß4 signaling promotes tumor angiogenesis. Cancer Cell 2004;6:471–83.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Mol Cancer ResHome page
T. H. Kim, H. I. Kim, Y. H. Soung, L. A. Shaw, and J. Chung
Integrin ({alpha}6{beta}4) Signals Through Src to Increase Expression of S100A4, a Metastasis-Promoting Factor: Implications for Cancer Cell Invasion
Mol. Cancer Res., October 1, 2009; 7(10): 1605 - 1612.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
S. M. K. Pulukuri, J. A. Knost, N. Estes, and J. S. Rao
Small Interfering RNA-Directed Knockdown of Uracil DNA Glycosylase Induces Apoptosis and Sensitizes Human Prostate Cancer Cells to Genotoxic Stress
Mol. Cancer Res., August 1, 2009; 7(8): 1285 - 1293.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
X. Yang, B. Pursell, S. Lu, T.-K. Chang, and A. M. Mercurio
Regulation of {beta}4-integrin expression by epigenetic modifications in the mammary gland and during the epithelial-to-mesenchymal transition
J. Cell Sci., July 15, 2009; 122(14): 2473 - 2480.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
G. Bon, S. E. Di Carlo, V. Folgiero, P. Avetrani, C. Lazzari, G. D'Orazi, M. F. Brizzi, A. Sacchi, S. Soddu, G. Blandino, et al.
Negative Regulation of {beta}4 Integrin Transcription by Homeodomain-Interacting Protein Kinase 2 and p53 Impairs Tumor Progression
Cancer Res., July 15, 2009; 69(14): 5978 - 5986.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
R. Sadej, H. Romanska, G. Baldwin, K. Gkirtzimanaki, V. Novitskaya, A. D. Filer, Z. Krcova, R. Kusinska, J. Ehrmann, C. D. Buckley, et al.
CD151 Regulates Tumorigenesis by Modulating the Communication between Tumor Cells and Endothelium
Mol. Cancer Res., June 1, 2009; 7(6): 787 - 798.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Yang, L. Zhang, Q. Wu, and D. D. Boyd
Unbiased Screening for Transcriptional Targets of ZKSCAN3 Identifies Integrin {beta}4 and Vascular Endothelial Growth Factor as Downstream Targets
J. Biol. Chem., December 12, 2008; 283(50): 35295 - 35304.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
U. Dutta and L. M. Shaw
A Key Tyrosine (Y1494) in the {beta}4 Integrin Regulates Multiple Signaling Pathways Important for Tumor Development and Progression
Cancer Res., November 1, 2008; 68(21): 8779 - 8787.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. Lu, K. Simin, A. Khan, and A. M. Mercurio
Analysis of Integrin {beta}4 Expression in Human Breast Cancer: Association with Basal-like Tumors and Prognostic Significance
Clin. Cancer Res., February 15, 2008; 14(4): 1050 - 1058.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
J. C. Friedland, J. N. Lakins, M. G. Kazanietz, J. Chernoff, D. Boettiger, and V. M. Weaver
{alpha}6beta4 integrin activates Rac-dependent p21-activated kinase 1 to drive NF-{kappa}B-dependent resistance to apoptosis in 3D mammary acini
J. Cell Sci., October 15, 2007; 120(20): 3700 - 3712.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. D. Merdek, X. Yang, C. A. Taglienti, L. M. Shaw, and A. M. Mercurio
Intrinsic Signaling Functions of the beta4 Integrin Intracellular Domain
J. Biol. Chem., October 12, 2007; 282(41): 30322 - 30330.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
V. Folgiero, R. E. Bachelder, G. Bon, A. Sacchi, R. Falcioni, and A. M. Mercurio
The {alpha}6{beta}4 Integrin Can Regulate ErbB-3 Expression: Implications for {alpha}6{beta}4 Signaling and Function
Cancer Res., February 15, 2007; 67(4): 1645 - 1652.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
A. Bertotti, P. M. Comoglio, and L. Trusolino
{beta}4 integrin activates a Shp2-Src signaling pathway that sustains HGF-induced anchorage-independent growth
J. Cell Biol., December 18, 2006; 175(6): 993 - 1003.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
G. Bon, V. Folgiero, G. Bossi, L. Felicioni, A. Marchetti, A. Sacchi, and R. Falcioni
Loss of {beta}4 Integrin Subunit Reduces the Tumorigenicity of MCF7 Mammary Cells and Causes Apoptosis upon Hormone Deprivation.
Clin. Cancer Res., June 1, 2006; 12(11): 3280 - 3287.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. Wilhelmsen, S. H.M. Litjens, and A. Sonnenberg
Multiple Functions of the Integrin {alpha}6{beta}4 in Epidermal Homeostasis and Tumorigenesis
Mol. Cell. Biol., April 15, 2006; 26(8): 2877 - 2886.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lipscomb, E. A.
Right arrow Articles by Mercurio, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lipscomb, E. A.
Right arrow Articles by Mercurio, A. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online