| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell and Tumor Biology |
1 Department of Cell Biology, Harvard Medical School; 2 Department of Pathology, Harvard Medical School, Molecular Pathology Research Unit, Massachusetts General Hospital; 3 Children's Hospital, Harvard Medical School, Boston, Massachusetts; and 4 Brown University, Providence, Rhode Island
Requests for reprints: Joan S. Brugge, Department of Cell Biology, Harvard Medical School, 240 Longwood Avenue, Boston, MA 02115. Phone: 617-432-3974; Fax: 617-432-3969; E-mail: joan_brugge{at}hms.harvard.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The Ets family of transcription factors regulate a number of biological processes including cell proliferation, differentiation, and invasion and are thought to play an important role in oncogenesis. Several Ets factors including Ets1, Ets2, and ESE-1 are overexpressed in both murine and human mammary tumors and are thought to be predictors of poor prognosis (15). In addition, overexpression of an inhibitory mutant of Ets2 was sufficient to revert Ras transformation of NIH 3T3 cells and to block anchorage-independent growth and invasion in various breast tumor cell lines (610). Notably, both Ets1 and Ets2 are primarily detected in the stromal compartment of tumors and thought to alter the tumor microenvironment by regulating matrix-remodeling proteins (3, 1113). However, the mechanisms by which these and other Ets factors influence tumorigenesis are not clearly understood.
Ets family proteins share a unique DNA binding domain, known as the Ets domain that binds to a consensus GGA(A/T) sequence within the promoters of target genes. Ets targets include other transcription factors such as Fos and matrix remodeling proteins such as collagenase, stromelysin, and urokinase-type plasminogen activator receptor (14, 15). Prostate derived Ets factor (PDEF) is a recently identified Ets factor with homologues in both mouse (mPSE) and Drosophila (D-Ets), respectively (16). Domain analysis of PDEF revealed a COOH-terminal Ets DNA binding domain and an NH2-terminal regulatory region that includes the Pointed domain, which is present in a subset of Ets proteins and is thought to mediate target specificity (16, 17). PDEF also contains two PEST motifs that render the PDEF protein highly unstable as well as an optimal mitogen-activated protein kinase (MAPK) phosphorylation site homologous to those of Ets1 and Ets2 (16, 18, 19).
Unlike the majority of Ets factors, PDEF is expressed exclusively in tissues with a high epithelial content such as the prostate and breast (16, 20, 21). Furthermore, several studies showed PDEF to be one of the most highly overexpressed mRNAs in human and mouse mammary tumors (5, 2022). Because the majority of human cancers are epithelial in origin, it is important to better understand the role of such epithelial-specific transcription factors in tumor development and progression.
Here we report the identification of PDEF from a genetic screen for factors that stimulate growth factorindependent migration of MCF-10A cells. In addition, we found that PDEF can cooperate with activated growth factor receptors including ErbB2 and colony-stimulating factor receptor (CSF-1R) to significantly enhance MCF-10A cell motility. Furthermore, coexpression of PDEF with ErbB2 or hyperactivated CSF-1R provoked a dramatic change in the morphology of structures formed by MCF-10A cells in three-dimensional cultures, converting spheroid-like structures into protrusive cords that invade into the basement membrane gel. Constitutive activation of the extracellular signalregulated kinase (ERK)/MAPK pathway induced a similar morphologic conversion of PDEF-expressing cells. In addition, we found that PDEF promoted anchorage-independent growth of MCF-10A cells expressing ErbB2 or CSF-1R/CSF-1 cells. Finally, we found PDEF to be overexpressed in the epithelial cells isolated from a large percentage of breast tumors. Collectively, our findings suggest that PDEF may play an important role during breast tumorigenesis, particularly in the presence of constitutively activated receptor tyrosine kinases (RTK) such as ErbB2 and CSF-1R. To our knowledge, this is the first report supporting a role for PDEF as a promigratory and invasive cDNA in human mammary epithelial cells and its cooperation with the growth factor receptors ErbB2, CSF-1R, and the ERK/MAPK signaling pathway.
| Materials and Methods |
|---|
|
|
|---|
-PDEF and
-actin antibodies were obtained from Zymed (San Francisco, CA) and Santa Cruz Biotechnology (Santa Cruz, CA), respectively. pBabe-MEK2DD and pBabe-ErbB2 were generously provided by S. Meloche (University of Montreal, Montreal, Canada) and Danielle Lynch (Harvard Medical School, Boston, MA). HMECs were obtained from Clonetics (East Rutherford, NJ) and the A375 and Lovo cell lines were kind gifts from S. Mani and R. Weinberg (Massachusetts Institute of Technology, Cambridge, MA). All other cell lines were obtained from American Type Culture Collection (ATCC, Manassas, VA) and cultured according to the guidelines provided. Library construction. Total RNA was isolated from MCF7 cells using RNA-STAT-60 (Tel-Test, Inc., Friendswood, TX). Poly(A) RNA was isolated using the Oligotex kit (Qiagen, Valencia, CA). The Superscript Choice System (Invitrogen, Carlsbad, CA) was used for cDNA synthesis. BstX1/EcoR1 adaptors (Invitrogen) were ligated to the cDNA using T4 DNA ligase (New England Biolabs, Ipswich, MA). The cDNA was then size fractionated on a low-melt agarose gel (American Bioanalytical, Natick, MA) into two fractions, >3 and 1 to 3 kb. Each fraction was purified with agarose treatment according to the protocol of the manufacturer (Roche, Palo Alto, CA). The cDNA was ligated into the nonpalindromic BstXI sites in the purified BstXI-digested pEYK3.1 vector. The ligation mixture was purified with phenol-chloroform extraction and electroporated into Electromax DH10B (Invitrogen). For amplification of the library, the bacteria were plated on LB plates containing 100 µg/mL of ampicillin and 50 mg/mL of zeocin (Invitrogen). After incubating at 37°C for 16 to 18 hours, the plates were scraped and the plasmid DNA was isolated using Qiagen Megaprep columns (Qiagen).
Retroviral vectors and constructs. The PDEF mutant T50A was created by site-directed mutagenesis using the primers 5'-AGTCCACCCGCCGCGCCCGAGCAGGGC-3' and 5'-GCCCTGCTCGGGCGCGGCGGGTGGACT-3' and cloned into the EcoRI site of pEYK3.1. Full-length PDEF, the T50A mutant, the NH2-terminal region (1-248 amino acids), and the COOH-terminal DNA binding domain (245-335 amino acids) of PDEF were cloned into pBabe-puro and PMX-N-GFP by PCR amplification with primers including a 5' EcoRI site and a 3' XhoI or EcoRI site. pBabe-CSF-1R and pMSCV-CSF-1 were created as previously described (24).
Generation of stable cell lines and analyses of protein lysates. MCF-10A cells expressing stable levels of the above genes were generated by infection with retrovirus as described (23). Populations of MCF-10A cells stably expressing CSF-1R/CSF-1 were obtained as described (24). MCF-10A cells overexpressing ErbB2/PDEF and CSF-1R/PDEF were created by sequential infection of ErbB2 and PDEF or CSF-1R/CSF-1 and PDEF. Cells were selected with 2 µg/mL puromycin or 200 µg/mL G418 after each round of infection. Protein lysates from MCF-10A cells were prepared in NP40 buffer, separated by SDS-PAGE, and analyzed by immunoblot as previously described (25).
Transwell migration assay. All MCF-10Aderived cell lines (ErbB2, CSF-1R/CSF-1, and MEK2DD) were starved overnight in assay medium (MCF-10A growth medium containing 2% serum and no EGF). The starved cells were trypsinized, 1 x 105 cells were added to the top chambers of the transwell (8 µm pore size; BD Bioscience, Bedford, MA), and assay medium was added to the bottom chambers and incubated for 16 to 20 hours. For all other cell lines (HMEC, SKBR3, MDA-MB-231, and MDA-MB-435), the appropriate growth medium as recommended by ATCC was used instead of assay medium. After overnight incubation, the migratory cells were fixed, stained with 4',6-diamidino-2-phenylindole, and quantified as previously described (25). Each cell line was assayed in duplicate per experiment and repeated at least thrice. Paired Student's t test analysis was done to determine significance of PDEF activity over control cells for each cell line over multiple experiments.
For the migration screen, 1 x 106 MCF-10A cells expressing the cDNA library were plated onto six-well transwell chambers in assay medium. After a 16-hour incubation, the migratory cells on the bottom of the filters were trypsinized, propagated, and rescreened twice.
Rescue of prostate epitheliumderived Ets transcription factor from migratory cells. To rescue pEYK3.1 PDEF, genomic DNA was isolated (Puregene, Gentra Systems Inc., Minneapolis, MN) from MCF-10A cells harvested after the third round of migration, digested with NotI, and self-ligated to create a provirus encoding PDEF (26, 27). The resulting proviral DNA was amplified in bacteria, purified by Maxi prep (Qiagen), and sequence verified.
Wound healing assays. MCF-10A cells were seeded onto six-well dishes at 1 x 105 per well in growth medium. Confluent monolayers were starved overnight in assay medium and a single scratch wound was created using a micropipette tip. Cells were washed with PBS to remove cell debris, supplemented with assay medium, and monitored. Images were captured by phase microscopy using a 10x objective at 0, 12, and 24 hours post wounding. To quantify the wounded area, we measured the area of the wound at the time of wounding (0 hours) and at 12 (MEK) or 24 hours (10A, ErbB2, and CSF) post wounding to calculate the area of wound healing (Metamorph image analysis software). This area is represented as a percentage of the initial wound. The percentage of wound healing for each of the cell lines expressing vector control or PDEF was averaged over four experiments and statistical significance was calculated using Student's t test.
Three-dimensional cell culture. Cells were cultured in basement membrane gels composed of a 50:50 mixture of growth factor-reduced Matrigel (BD Bioscience) and bovine dermal collagen I (Vitrogen, Cohesion Technologies, Palo Alto, CA) as described (25). MCF-10A cells expressing vector control or PDEF alone were supplemented with 5 ng/mL EGF to allow proliferation whereas ErbB2, CSF-1R/CSF-1, and MEK2DD cells were cultured in the absence of EGF.
Soft agar assay. A mixture of 5,000 cells in assay medium and 0.3% agarose was seeded on to a solidified bed of 0.6% agarose on six-well plates. The plates were allowed to solidify at 4°C and incubated at 37°C. The cultures were fed once a week with assay medium containing 0.3% agarose. Each cell line was seeded in duplicate per experiment and was repeated at least thrice. The cultures were imaged and the number of colonies was counted after 15 days. The experiment was repeated thrice and the statistical significance was calculated using Student's t test.
Laser capture microdissection. All laser capture microdissection and tissue sectionderived RNA samples were prepared and amplified as described (28). RNA samples were subjected to DNase treatment before cDNA synthesis and RNA amplification. Briefly, 2 µg of amplified RNA were converted into double-stranded cDNA and quantified with Picogreen (Molecular Probes, Eugene, OR) using a spectrofluorometer (Molecular Devices, Sunnyvale, CA). For each case, 12 ng of cDNA in triplicates were used for real-time PCR with an ABI 7900HT (Applied Biosystems, Foster City, CA). The sequences of the PCR primer pairs and fluorogenic probe (5'
3') used for PDEF analysis are as follows: forward primer, TCCATCCGCCAGTATTACAAGA; reverse primer, GGTGCACGAACTGGTAGACGA; probe, CATCCGGAAGCCAGACATCTCCCA.
| Results |
|---|
|
|
|---|
|
PDEF induces migration in normal and cancer cell lines. To determine if PDEF can also induce migration in other nontumorigenic breast epithelial cells, we introduced PDEF by retroviral infection into human mammary epithelial cells (HMECs). PDEF overexpression caused an
8-fold increase in HMEC motility in transwell migration assays (Fig. 2). Furthermore, PDEF likewise increased motility in the nonmetastatic breast carcinoma cell lines MCF7 and SKBR3 and the metastatic cell line MDA-MB-468 (Fig. 2). In contrast, PDEF overexpression decreased motility of the invasive breast cancer cell line MDA-MB-231 as previously described (29). However, we found that PDEF also promoted motility in melanoma (A375 and MDA-MB-435) as well as colon carcinoma (Lovo) cell lines (Fig. 2). Taken together, these findings show that, with the exception of MDA-MB-231 cells, PDEF can promote cell motility in multiple cell lines derived from both normal and tumorigenic epithelia.
|
|
|
PDEF promotes invasive activity in three-dimensional basement membrane cultures. To examine the effects of PDEF activity in a context that more closely resembles in vivo mammary architecture, we assessed the consequences of PDEF overexpression on the formation of MCF-10Abased acini. To this end, we cultured PDEF-expressing cells in a mixture of Matrigel and collagen I. The majority of MCF-10A cells overexpressing PDEF formed normal acini in three-dimensional (3D) cultures; a subset of these acini (22%) contained short projections but did not form highly invasive structures at later days in culture (Fig. 4A and data not shown). Overexpression of ErbB2 or CSF-1R/CSF-1 in MCF-10A cells promotes the formation of hyperproliferative acini (24).5 In addition, overexpression of CSF-1R/CSF-1 also causes a disruption in cell-cell adhesion leading to a discohesive phenotype (24). However, neither of these receptors (ErbB2 or CSF-1R/CSF) stimulated invasive activity in MCF-10A cells when cultured in 3D (Fig. 4B and C, left). In contrast, ErbB2/PDEF and CSF-1R/PDEF cells formed highly invasive acini on basement membrane (Fig. 4B and C, right). By day 8, the invasive projections emanating from these acini formed a network of multicellular cords that penetrated the basement membrane (Fig. 4B and C). By day 12 in culture, invasive structures were detected in
100% of ErbB2/PDEF acini and 75% of CSF-1R/PDEF acini (Fig. 4). Taken together, these results show that PDEF profoundly affects the behavior of cells expressing activated RTKs such as ErbB2 and CSF-1R, leading to a highly invasive phenotype in 3D culture.
|
Domain analysis of PDEF in motility and invasion. PDEF consists of a highly conserved COOH-terminal Ets DNA binding domain and an NH2-terminal regulatory region. Whereas the activity of most Ets family transcription factors is dependent on the DNA binding domain, ESE-1, which belongs to the same subgroup as PDEF, functions in the cytoplasm independent of this domain (30). Therefore, we examined whether the NH2-terminal region of PDEF (1-248 amino acids), which contains the Pointed domain as well as the aforementioned consensus MAPK phosphorylation site, or the COOH-terminal region of PDEF (245-335 amino acids), comprising the DNA binding domain, would be sufficient to induce motility and invasion. In addition, we created a mutant PDEF protein that contains a threonine-to-alanine substitution at the consensus MAPK phospho-acceptor site (T50A) to determine whether this site is required for PDEF activity. We found that both deletion constructs and the T50A mutant failed to induce migration or invasion in MCF-10A cells coexpressing ErbB2, CSF-1R/CSF-1, or MEK2DD (Fig. 5 and data not shown). These results indicate that neither the NH2-terminal regulatory domain nor the DNA binding domain is sufficient for PDEF function. In addition, these findings suggest that the optimal MAPK phosphorylation site at T50 is essential for PDEF-induced motility and invasion.
|
100) after 15 days in culture, suggesting that the synergy between ErbB2 and PDEF allows these cells to grow in soft agar. Whereas control CSF-1R/CSF-1 cells formed a few colonies in soft agar, CSF-1R/PDEF cells formed
10-fold more colonies (Fig. 6A and B). These results show that PDEF promotes anchorage-independent growth of both ErbB2 and CSF-1R/CSF-1 cells.
|
| Discussion |
|---|
|
|
|---|
In addition to stimulating motility of normal mammary epithelial cell lines such as MCF-10A and HMECs, PDEF expression also enhanced motility in several tumorigenic epithelial cell lines with the exception of MDA-MB-231 cells (29). These findings suggest that PDEF, similar to many other transcription factors, may play differing roles depending on cell context. Our finding that PDEF enhances motility of several epithelial cell lines also shows that the promigratory activity of PDEF is not restricted to MCF-10A cells.
PDEF induced a 2- to 5-fold increase in motility of parental MCF-10A cells and a robust 10- to 30-fold increase in motility when coexpressed with the growth factor receptors ErbB2 or CSF-1R. Furthermore, ErbB2/PDEF and CSF-1R/PDEF cells formed highly invasive structures in three-dimensional cultures. The ability of PDEF to induce invasive activity is consistent with previous reports that other Ets factors including Ets1, Ets2, and ESE-1 also promote invasion (1, 7, 10, 3335). Because expression of ErbB2 or CSF-1R/CSF-1 alone does not stimulate motility or invasion of MCF-10A cells, our findings suggest that PDEF can synergize with hyperstimulated RTKs, such as ErbB2 or CSF-1R/CSF-1, to promote these cellular processes. Coexpression of PDEF with other oncogenes, such as AKT and cyclin D1, did not enhance motility or invasion, indicating the specificity of this synergy. Our finding that MEK2DD/PDEF cells are highly motile and invasive suggests a similar synergy between PDEF and MEK2DD and a role for the Ras/MAPK pathway in PDEF-induced motility and invasion.
Previous work has shown that both Ras and ErbB2 regulate other Ets factors by promoting Ras/MAPK phosphorylation (17). Ets1, Ets2, and Pointed each contain a highly conserved MAPK phosphorylation site (PxTP) that is required for the transcriptional activity of these proteins (17, 18, 33, 36, 37). Furthermore, MMTV-PyMT transgenic mice expressing Ets2 with a mutation at the MAPK phosphorylation site formed fewer and smaller breast tumors with decreased levels of stromal matrix metalloproteinase 3 (MMP3) and MMP9 (13). In our studies, a PDEF variant bearing a similar mutation at an optimal MAPK phosphorylation site (T50A) failed to promote migratory and invasive activity, suggesting that the MAPK pathway may likewise regulate PDEF activity. The T50A mutant was able to localize to the nucleus and activate basal transcription of an Ets promoter element (data not shown), suggesting that this mutation does not interfere with the subcellular targeting or basal transactivation capacity of PDEF. Whereas our results show that this putative MAPK phosphorylation site is essential for PDEF-induced invasive activity, further studies will be required to confirm the regulation of PDEF activity by the Ras-ERK pathway.
Multiple studies have shown that Ets proteins, including Ets1, Ets2, and ESE-1, are overexpressed in breast tumors (25). Although a recent study reported that PDEF protein levels were reduced in several breast tumors (29), previous studies have shown that PDEF mRNA is overexpressed in a large number of breast cancer cell lines and tumors (20, 21). For instance, a SAGE analysis of a collection of breast tumor and cell line cDNA showed that a majority of breast tumor cells express 32-240 PDEF tags/200,000 tags compared with <2 in normal epithelial cells (http://cgap.nci.nih.gov/SAGE/FreqsOfTag?ORG=Hs&METHOD=SS10,LS10&FORMAT=html&TAG=GTGCAGGGAG&TISS=mammary+gland&HIST=neoplasia&CELL=2&NOT=fetus). Furthermore, murine PDEF (mPSE) was found to be significantly elevated in mammary tumors in both PyMT and ErbB2 tumor models (5). Because most Ets factors, including Ets1 and Ets2, are mainly expressed in the stromal cells, we used laser capture microdissection and quantitative RT-PCR to determine PDEF expression in the epithelial cells of human breast tumor samples and found that PDEF is overexpressed in the epithelial cells in a majority (>75%) of breast tumors. Our findings are supported by a recent SAGE analysis (http://cgap.nci.nih.gov/SAGE/BreastCellViewer?TAG=GTGCAGGGAG&ORG=Hs&METHOD=SS10,LS10) showing that luminal epithelial cells in breast tumors express PDEF whereas tumor-associated myoepithelial and stromal cells do not (22). Although most tumors displayed only a 2- to 5-fold increase in PDEF mRNA levels, analysis of epithelial cells from a number of advanced tumors revealed a 5- to 10 or >10-fold enhancement of PDEF expression compared with the adjacent normal epithelium (Fig. 6C). However, a larger sample size will be required to determine if there is a significant correlation between tumor stage and PDEF expression.
Overall, our studies reveal that PDEF can promote migration and, in the context of hyperstimulation of the ERK/MAPK pathway, can induce invasion and anchorage independence of breast epithelial cells. The absence of invasive activity in MCF-10A cells expressing PDEF alone and the presence of elevated levels of PDEF in the epithelia of early, noninvasive stages of breast carcinoma suggest that PDEF expression alone is insufficient to induce invasive activity. However, elevated levels of PDEF may initiate transforming activity and/or sensitize these cells to additional insults, such as the amplification or mutational activation of a RTK, to promote tumor progression. Consistent with an early role for Ets factors in tumorigenesis, we found that PDEF supports anchorage-independent growth when coexpressed with ErbB2 or CSF-1R/CSF-1. This finding suggests that PDEF may regulate phenotypic effects other than motility and invasion in human tumors. Therefore, we speculate that PDEF could be important in promoting distinct phenotypic effects at different stages of tumorigenesis, particularly in tumors with genetic alterations that can lead to the hyperstimulation of RTKs, such as ErbB2 or CSF-1R, which regulate the ERK pathway. The dramatic morphologic changes and invasive activity of ErbB2/PDEF and CSF-1R/PDEF cells in three-dimensional cultures may reflect some aspects of tumor invasion during later stages of tumor progression in vivo.
Collectively, our data suggest that PDEF is a promigratory gene that synergizes with the oncogenes ErbB2 and CSF-1R to promote various aspects of tumor progression including enhanced cell motility, invasion, and anchorage-independent growth of mammary epithelia. Currently, we are identifying downstream targets of PDEF to determine the mechanism by which PDEF stimulates these activities in mammary epithelial cells.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Laura Selfors for guidance on the statistical analysis of the data in this manuscript as well as past and present members of the Brugge lab for stimulating discussions and helpful technical advice during the preparation of this article; Jason Smith, Tobias Schmelze, and Kaylene Simpson for critical reading of the manuscript; T. Libermann (BIDMC) for helpful discussions; D. Lynch and S. Meloche for plasmids; R. Mulligan for VSV-GPG viral packaging of cells; M. Roussel for the CSF-1R; and S. Mani and R. Weinberg for cancer cell lines.
| Footnotes |
|---|
Received 4/ 6/05. Revised 9/ 9/05. Accepted 9/29/05.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
A. K. Sood, J. Wang, P. Mhawech-Fauceglia, B. Jana, P. Liang, and J. Geradts Sam-Pointed Domain Containing Ets Transcription Factor in Luminal Breast Cancer Pathogenesis Cancer Epidemiol. Biomarkers Prev., June 1, 2009; 18(6): 1899 - 1903. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Nakamura, F. Tanaka, Y. Yoshikawa, K. Mimori, H. Inoue, K. Yanaga, and M. Mori PDGF-BB is a Novel Prognostic Factor in Colorectal Cancer Ann. Surg. Oncol., August 1, 2008; 15(8): 2129 - 2136. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Kumar, S. Koul, L. Khandrika, R. B. Meacham, and H. K. Koul Oxidative Stress Is Inherent in Prostate Cancer Cells and Is Required for Aggressive Phenotype Cancer Res., March 15, 2008; 68(6): 1777 - 1785. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Gu, L. F. Zerbini, H. H. Otu, M. Bhasin, Q. Yang, M. G. Joseph, F. Grall, T. Onatunde, R. G. Correa, and T. A. Libermann Reduced PDEF Expression Increases Invasion and Expression of Mesenchymal Genes in Prostate Cancer Cells Cancer Res., May 1, 2007; 67(9): 4219 - 4226. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Schmelzle, A. A. Mailleux, M. Overholtzer, J. S. Carroll, N. L. Solimini, E. S. Lightcap, O. P. Veiby, and J. S. Brugge Functional role and oncogene-regulated expression of the BH3-only factor Bmf in mammary epithelial anoikis and morphogenesis PNAS, March 6, 2007; 104(10): 3787 - 3792. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. P. Turner, O. Moussa, M. Sauane, P. B. Fisher, and D. K. Watson Prostate-Derived ETS Factor Is a Mediator of Metastatic Potential through the Inhibition of Migration and Invasion in Breast Cancer Cancer Res., February 15, 2007; 67(4): 1618 - 1625. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Lacroix Significance, detection and markers of disseminated breast cancer cells Endocr. Relat. Cancer, December 1, 2006; 13(4): 1033 - 1067. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Chen, M. Dokmanovic, W. D. Stein, R. J. Ardecky, and I. B. Roninson Agonist and Antagonist of Retinoic Acid Receptors Cause Similar Changes in Gene Expression and Induce Senescence-like Growth Arrest in MCF-7 Breast Carcinoma Cells. Cancer Res., September 1, 2006; 66(17): 8749 - 8761. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Overholtzer, J. Zhang, G. A. Smolen, B. Muir, W. Li, D. C. Sgroi, C.-X. Deng, J. S. Brugge, and D. A. Haber Transforming properties of YAP, a candidate oncogene on the chromosome 11q22 amplicon PNAS, August 15, 2006; 103(33): 12405 - 12410. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |