| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Endocrinology |
Coactivator-1
on Aromatase Promoter II and Its Inhibition by Activated Retinoid X Receptor Suggest a Novel Target for Breast-Specific Antiestrogen Therapy
1 Department of Pharmacology and Cancer Biology, Duke University Medical Center, Durham, North Carolina; 2 Prince Henry's Institute of Medical Research; and 3 Department of Biochemistry, Monash University, Clayton, Victoria, Australia
Requests for reprints: Donald P. McDonnell, Department of Pharmacology and Cancer Biology, Duke University Medical Center, Box 3813, Durham, NC 27710. Phone: 919-684-6035; Fax: 919-681-7139; E-mail: Donald.McDonnell{at}duke.edu.
| Abstract |
|---|
|
|
|---|
coactivator-1
(PGC-1
) is a physiologically relevant modulator of LRH-1, and that its transcriptional activity can be inhibited effectively using receptor-interacting peptide antagonists that prevent PGC-1
recruitment. Interestingly, we note that all of these peptides also interact in an agonist-dependent manner with retinoid X receptor
(RXR
), suggesting that these two receptors may compete for limiting cofactors within target cells. In support of this hypothesis, we show that 9-cis-retinoic acid, acting through RXR, inhibits both the basal and PGC-1
induced transcriptional activity of LRH-1. The importance of this finding was confirmed by showing that LRH-1dependent, PGC-1
stimulated regulation of aromatase gene expression in primary human breast preadipocytes was effectively suppressed by RXR agonists. We infer from these data that LRH-1 is a bona fide target whose inhibition would selectively block aromatase expression in breast, while sparing other sites of expression. (Cancer Res 2005; 65(24): 11762-70) | Introduction |
|---|
|
|
|---|
For the ligand-dependent nuclear receptors, binding of agonists induces an active conformational change within the receptor, resulting in the repositioning of helix-12, which facilitates transcriptional coactivator recruitment (10). Whether or not activation of LRH-1 is ligand dependent is unclear. The crystal structure of mouse LRH-1 revealed a large, empty ligand-binding cavity (11), but that of the human LRH-1-LBD showed the presence of bacterial phospholipids (1214). However, the role of phospholipids in regulating the activity of LRH-1 remains to be established, and thus the nature and abundance of corepressors and coactivators seems to be the primary determinant of LRH-1 activity.
In this study, we show that the coactivators glucocorticoid receptor-interacting protein 1 (GRIP1) and peroxisome proliferator-activated receptor
(PPAR
) coactivator-1
(PGC-1
) both interact with and enhance LRH-1 transcriptional activity and thus are serving as "protein ligands" for this receptor. These coactivators are likely to be of physiological importance, as peptide antagonists that prevent their interaction with LRH-1 effectively inhibit the activity of this receptor at target gene promoters. This suggests that in addition to LRH-1 expression, the relative and absolute expression levels of the coactivators GRIP1 and PGC-1
will influence aromatase expression in breast adipose tissue. Exploiting this observation, we have shown that agonist-activated retinoid X receptor
(RXR
) can also block LRH-1 activity by competing for the binding of these limiting coactivators, and thus not surprisingly, RXR agonists can inhibit LRH-1/PGC-1
dependent regulation of the aromatase gene expression in primary human preadipocytes.
| Materials and Methods |
|---|
|
|
|---|
was provided by Ligand Pharmaceuticals (San Diego, CA). pcDNA 3.1 expression vector for PGC-1
was provided by Dr. B.M. Spiegelman (Dana-Farber, Boston, MA). pCMX-GRIP1 was provided by Dr. M.R. Stallcup (University of Southern California, LA, CA). PGC-1
and GRIP1 NR box mutants were generated by mutating the wild-type LXXLL within the NR box to AXXAA by PCR-directed mutagenesis using the QuickChange Site-Directed mutagenesis kit (Stratagene) following the protocol provided by the manufacturer. pcDNA.3 expression vector for PGC-1ß was provided by Dr. C.M. Newgard (Duke University Medical Center, Durham, NC). PII-516 is a CYP19 promoter II/luciferase construct containing 516/17 nucleotides of the human CYP19 promoter II as described (7).
Cell culture, transfection, and reporter gene assays. HeLa and HepG2 cells were cultured in MEM Modified Eagle Medium (Life Technologies Bethesda Research Laboratories, Grand Island, NY) supplemented with 10% fetal bovine serum (HyClone, Logan, UT), 0.1 mmol/L nonessential amino acids, and 1 mmol/L sodium pyruvate (Life Technologies Bethesda Research Laboratories) and maintained in a humidified 37°C incubator with 5% CO2. The cells were seeded overnight into 24-well cell culture plates. The cells were transfected with 1.5 µg of luciferase reporter, 0.1 µg of cytomegalovirus ß-galactosidase (pCMVßgal) per triplicate using FuGENE 6 reagent (Roche, Indianapolis, IN). The amounts of expression plasmids per transfection were 100 ng wild-type LRH-1 or empty vector. For coactivation assays, a dose from 0 to 400 ng of pCMX-GRIP1 was used and 0 to 200 ng for pcDNA-3.1 PGC-1
/ß. When the mutants were used, 250 ng of pCMX-GRIP1 wild-type or NR box mutants were transfected in the presence of LRH-1 expression vector or an empty vector. For PGC-1
NR box mutants, 100 ng expression plasmids were used. In mammalian two-hybrid assays, for a typical triplicate of transfection, 1,500 ng of 5xGal4Luc3 reporter plasmid, 400 ng of receptor-VP16 fusion, 400 ng of pM (Gal4DBD)-NR box fusion constructs, and 100 ng of normalization plasmid pCMVßgal were used. NIH-3T3 cells were cultured in DMEM supplemented with 10% fetal bovine serum. Cells were transfected with PII-516/luciferase reporter, 100 ng of pCMVßgal, and 100 ng of mouse LRH-1 expression construct (or empty vector). Cells were serum starved for 24 hours before treatment with 25 µmol/L of forskolin and 4 nmol/L phorbol 12-myristate 13-acetate (PMA; Sigma, St Louis, MO). Following a 20-hour transfection, medium was replaced with fresh media. Cells were lysed 36 to 40 hours after transfection and assayed for luciferase and ß-galactosidase activities. Luciferase activity was normalized to ß-galactosidase activity to correct for transfection efficiency. All transfections were done in triplicate. The results presented were typical of several independent transfection experiments. Ligands were dissolved in ethanol or DMSO before use in cell culture. LG100268, LG101506, and LG101208 were generous gifts of Ligand Pharmaceuticals.
Affinity selection of LRH-1-interacting peptides. Human LRH-1 was cloned into the EcoRI sites of a baculovirus shuttle vector pDW464 to make an in-frame fusion of the LRH-1 with the biotin acceptor peptide (Science Reagents, El Cajon, CA). Recombinant LRH-1 baculovirus was generated using Bac-To-BacR Baculovirus Expression System (Life Technologies Bethesda Research Laboratories) following the protocol provided by the manufacturer. LRH-1 recombinant protein was produced in Sf9 insect cells following infection with recombinant baculovirus particles. A soluble extract of infected Sf9 cells was used to affinity purify biotinylated LRH-1 fusion protein with monomeric avidin resin (Promega Corp., Madison, WI). To select for LRH-1 binding peptides, a modified protocol from that previously described (15) was used. Briefly,
2 µg of baculovirus-expressed full-length LRH-1 protein were diluted in 100 µL of PBST [137 mmol/L NaCl, 2.7 mmol/L KCl, 4.3 mmol/L Na2HPO4 (pH 7.3), 0.1% Tween 20] and applied to a single well in a DNA-coated cell culture plate. To prepare the DNA-coated plate, a 96-well Costar plate was first coated with 20 µg of Neutravidin Biotin-Binding Protein (Pierce Biotechnology, Rockford, IL) overnight at 4°C, and 2 pmol of double-stranded 5'-biotinylated oligonucleotides (diluted in PBST) containing an SF-1 response element (SFRE) were added for 1 hour at room temperature. The protein-coated plate was incubated overnight at 4°C. The wells were then blocked with 150 µL of 2% milk in NaHCO3 (pH 8.5) for an additional 1 hour at room temperature and washed five times with PBST to remove unbound proteins. Then, 25 µL of the phage peptide library (with 1010 phage particles) diluted in 100 µL of MPBS (2% nonfat dry milk in PBS) was added to the wells, and the plate was sealed and incubated for 3 hours at room temperature. Construction of the LXXLL M13-phage library was described previously (15). Nonbinding phage were removed by washing the wells five times with 300 µL of PBST. The bound phage were eluted with 100 µL of 0.1 mol/L HCl for 10 minutes. The eluent was neutralized with 50 µL of 1 mol/L Tris-HCl (pH. 7.4). Phage eluted from the target were amplified in Escherichia coli DH5
F'cells for 5 hours at 37°C, and the supernatant containing amplified phage was collected for use in subsequent rounds of panning; a total of four rounds of panning were done. A PCR reaction was then done using 1 µL of the unamplified eluent phage from both rounds 3 and 4, with mBax reverse and forward primers to amplify peptide inserts. PCR products were purified and digested with XbaI and XhoI before their cloning in a modified pM (Gal4-DBD) vector. The peptide sequences were deduced by DNA sequencing.
Primary human adipose stromal cells. Human adipose stromal cells were isolated and cultured as described previously (16). Once confluent, cells were serum starved for 24 hours before treatment with experimental agents for a further 24 hours. The method of adipocyte differentiation has also been described previously (7).
Real-time PCR. Real-time PCR quantification of mRNA expression of aromatase and LRH-1 has been described previously (7). Primers used for amplification of LRH-1, aromatase promoter II, and PGC-1 isoforms were (5'-3') as follows: LRH-1 (sense, CTGATACTGGAACTTTTGAA; antisense, CTTCATTTGGTCATCAACCTT), aromatase pII (sense, TTGGAAATGCTGAACCCGAT; antisense, CAGGAATCTGCCGTGGGAGA), PGC-1
(sense, TCAGTCCTCACTGGTGGACA; antisense, TGCTTCGTCGTCAAAAACAG), PGC-1ß (sense, TGTTCAGACAGAACGCCAAG; antisense, ACACCGGTAGTGATGAAGC).
| Results |
|---|
|
|
|---|
function as transcriptional coactivators for LRH-1. The ability of the ubiquitously expressed coactivator GRIP1/TIF2/SRC-2 to regulate LRH-1 transcriptional activity was examined using transient transfection assays in HeLa cells. Specifically, an aromatase promoter II-luciferase reporter construct was transfected into cells in the absence or presence of coexpressed LRH-1 and increasing amounts of a GRIP1 expression vector. As expected, cotransfection of LRH-1 resulted in a strong activation (10-fold) of the aromatase promoter II (Fig. 1A). Coexpression of GRIP1 significantly enhanced LRH-1-mediated transcription, up to 6-fold, at the maximal concentration of expression plasmid tested. To verify that this effect was not limited specifically to the aromatase promoter II, we repeated this experiment using another LRH-1-regulated promoter, that of the small heterodimer partner (SHP; ref. 17), and obtained similar results (data not shown).
|
Although many nuclear receptor coactivators are ubiquitously expressed, a tissue-specific coactivator, PGC-1
, has been shown to be preferentially expressed in adipose tissue, liver, and muscle (18, 19). Although originally identified as a PPAR
-specific coactivator, PGC-1
has since been shown to coactivate several other nuclear receptors (20). We therefore asked whether PGC-1
can function as a coactivator for LRH-1. To this end, HeLa cells were transfected with an aromatase promoter II reporter gene construct in the absence or presence of LRH-1 and increasing amounts of PGC-1
. In this manner, we showed that PGC-1
is a robust coactivator of LRH-1 transcriptional activity (Fig. 1D).
PGC-1
contains one consensus LXXLL sequence (L2) that has been shown to be the major binding site for many nuclear receptors. A mutation in L2 (LXXLL to AXXAA) abolished PGC-1
mediated stimulation of LRH-1 transcriptional activity, whereas a mutation in the third leucine-rich motif (L3) had no effect (Fig. 1E). Not surprisingly, mutation of both motifs (L2L3M) abolished PGC-1
dependent coactivation completely. Notably, these PGC-1
mutants had similar effects on LRH-1 transactivation in the context of a Gal4-LRH-1 fusion protein (Fig. 1F) as they did on the aromatase promoter II (Fig. 1E), suggesting that L2 is both necessary and sufficient for PGC-1
recruitment by LRH-1. We did similar experiments using PGC-1ß and found that this closely related cofactor had no effect on either LRH-1-induced aromatase promoter II activity or Gal4-LRH-1 transcriptional activity (data not shown). We conclude from these series of experiments that both the ubiquitously expressed GRIP1 and the tissue-restricted PGC-1
(but not PGC-1ß) can act as coactivators for LRH-1.
PGC-1 expression in preadipocytes. We next asked whether PGC-1
is a physiologically relevant coactivator of LRH-1, with respect to the regulation of aromatase gene expression in preadipocytes. Aromatase is expressed in undifferentiated primary human breast preadipocytes rather than in mature adipocytes, and we have previously shown that stimulation of aromatase gene transcription by LRH-1 is dramatically elevated in the presence of cyclic AMP (cAMP), an inducer of PGC-1
expression (21). To determine whether PGC-1
is coexpressed with LRH-1 in preadipocytes and regulated by cAMP, we quantified by real-time PCR the mRNA expression of PGC-1
, PGC-1ß, LRH-1, and aromatase in primary human preadipocytes treated with or without forskolin (to increase intracellular cAMP), or in cells that had been differentiated into mature adipocytes by incubation in an adipogenic medium for 14 days (Fig. 2). PGC-1
mRNA levels in preadipocytes were markedly stimulated by forskolin (
17-fold), and no difference in PGC-1
expression was evident between untreated preadipocytes and differentiated adipocytes (Fig. 2A). In contrast, PGC-1ß mRNA levels were
10-fold lower than PGC-1
mRNA in resting preadipocytes, and although forskolin increased PGC-1ß mRNA levels by
7-fold, the greatest increase in PGC-1ß mRNA occurred in differentiated adipocytes (20-fold; Fig. 2B). LRH-1 mRNA was increased by
2-fold upon forskolin treatment of preadipocytes and was undetectable in differentiated adipocytes (Fig. 2C). Aromatase mRNA levels in preadipocytes were strongly induced by forskolin (
10-fold) and, consistent with previous studies (7), significantly lower in differentiated adipocytes than in preadipocytes (Fig. 2D). Therefore, aromatase, PGC-1
, and LRH-1 are coexpressed in preadipocytes and positively regulated by cAMP. Expression of PGC-1ß, which does not coregulate LRH-1 or stimulate aromatase expression, is associated with the differentiated adipocyte rather than the undifferentiated preadipocyte phenotype.
|
for LRH-1 transcriptional activity and that their interaction with LRH-1 occurs through a specific short LXXLL sequence, we reasoned that it might be possible to develop peptide antagonists that function by specifically blocking LRH-1/coactivator interactions. To develop a peptide-screening assay, recombinant full-length LRH-1 was purified from baculovirus-infected Sf9 cells and immobilized on a plastic-bound SFRE oligonucleotide. This system was used for in vitro selection of an M13 phage library expressing short 19-mer peptides in the format (X)7LXXLL(X)7 (15). We previously determined that the diversity in the library is sufficient for identification of peptides, which display the affinity and specificity needed to be useful as antagonists of NR function in intact cells. Figure 3A shows representative peptide sequences derived from phage isolated following four successive rounds of screening. In spite of the complexity of the random phage library (exceeding 108 independent clones), clustal peptide sequence alignment of LRH-1- binding peptides shows the presence of a strong consensus sequence motif PILRXLL (Fig. 3A). Further analysis of peptide sequences revealed that the sequence of the peptide L4-1 is homologous to the third NR box of Dax-1, whereas the L3-20 peptide is more closely related to the second NR box in SHP. These two proteins are known to bind and inhibit LRH-1-mediated transcriptional activity (2224). Peptides with these sequence characteristics have previously been described as "class III-like LXXLL peptides." Interestingly, such sequences constitute the NR box regions of Dax-1, SHP, or PGC-1
(15).
|
LRH-1 peptides disrupt GRIP1 and PGC-1
coactivation of LRH-1. The peptide antagonists L4-1 and L4-16 effectively repressed LRH-1 transcriptional activity on a simple response element SFRE within intact cells (Fig. 3C). We next assessed the ability of these peptides to inhibit LRH-1 transcriptional activity on the more relevant aromatase promoter II in the presence or absence of coexpressed PGC-1
or GRIP1. HeLa cells were cotransfected with the aromatase promoter II reporter and an LRH-1 expression vector in the presence of either pM (encoding the Gal4-DBD) or increasing amounts of the Gal4-DBD fusion peptides. As expected, L4-1 and L4-16 inhibited both the basal and coactivator-induced LRH-1 transcriptional activity on the aromatase promoter II (Fig. 3D). Together, these data show that the peptides can repress LRH-1 activity on a complex promoter by competitively inhibiting LRH-1/coactivator interactions.
All LRH-1binding peptides also interact with retinoid X receptor
. To address the specificity of the LRH-1-interacting peptides identified in this screen, we assessed their ability to bind an RXR
-VP16 fusion protein in a mammalian two-hybrid assay. Interestingly, all of the LRH-1-interacting peptides identified also interacted with activated RXR bound to 9-cis-retinoic acid (9-cis-RA) or the selective RXR agonist LG100268 (Fig. 4). Treatment with the RXR antagonist LG101208 abolished both the basal and agonist-induced interaction of the peptides with RXR, indicating that they probably also interact with the canonical coactivator binding surface on this receptor (Fig. 4). These results suggest that activated RXR shares identical or highly similar surfaces with LRH-1, raising the possibility that LRH-1 and RXR can be activated by similar coregulators within target cells.
|
to compete with LRH-1 for common coactivators (i.e., antagonism independent of DNA binding). To address this possibility, we transfected HeLa cells with LRH-1 and RXR
expression vectors, and a luciferase reporter gene construct containing five copies of the SFRE. As shown in Fig. 5A, LRH-1 stimulated the SFRE reporter by
3-fold. Addition of increasing concentrations of 9-cis-RA inhibited LRH-1-mediated transcription in a concentration-dependent manner, with complete inhibition occurring at 0.1 µmol/L of 9-cis-RA. Therefore, activated RXR can completely block LRH-1-mediated transcriptional activity, and this inhibition can occur on a promoter to which RXR does not bind in a direct manner. We next asked if LRH-1 inhibition by RXR is agonist dependent. 9-cis-RA and the selective RXR ligand LG100268 are full agonists and activate RXR
-mediated transcriptional activity on a DR1 response element. In contrast, LG101208 is a full antagonist, whereas LG101506 is a partial agonist (Fig. 5B). When the 5xSFRE reporter construct was cotransfected with LRH-1 and RXR
, 9-cis-RA as well as the selective RXR ligand LG100268 fully repressed LRH-1-mediated transcription, whereas the partial agonist LG101506 had a partial inhibitory effect (Fig. 5C). Significantly, the full-antagonist LG101208 completely reversed the inhibition of LRH-1 transcriptional activity by either 9-cis-RA or LG100268 (Fig. 5C). Together, these data indicate that inhibition of LRH-1 by RXR is agonist dependent, and RXR requires an active conformation to mediate this repression. Thus, LRH-1 inhibition by activated RXR may occur as a consequence of competition for common coregulators used by these two transcription factors.
|
were coexpressed in the presence or absence of 9-cis-RA, PGC-1
, or GRIP1. We used the Gal4 system to exclude the possibility that RXR might interfere with LRH-1 binding to its response element. As shown in Fig. 5D, Gal4-LRH-1 LBD activated transcription from the 5xGal4 response element reporter construct, and this activity was further enhanced in the presence of PGC-1
or GRIP1. In this context, 9-cis-RA strongly repressed basal activity of LRH-1 LBD (Fig. 5E). More interestingly, activated RXR repressed the stimulation of LRH-1 by either PGC-1
or GRIP1 (Fig. 5E). These results indicate that in the presence of 9-cis-RA, RXR is able to compete for coactivators present within the cell required for LRH-1 transcriptional activity. 9-cis-retinoic acid inhibits transcription from promoter II of the CYP19 gene. Because LRH-1 is implicated as a key transcription factor mediating aromatase expression in breast tissue (7), we asked whether 9-cis-RA can repress LRH-1-mediated transcriptional activity on aromatase promoter II. The major inducer of aromatase expression in breast preadipocytes is prostaglandin E2 (PGE2) derived from breast tumor epithelium or macrophage infiltration (25). Here, we used forskolin and PMA to mimic PGE2 signaling through protein kinases A and C (25). NIH-3T3 cells were transfected with an LRH-1 expression vector in the presence or absence of forskolin and PMA. In the absence of stimulation, LRH-1 produced a 10-fold increase in the transcriptional activity of promoter II (Fig. 6A). In the absence of exogenous LRH-1, forskolin and PMA treatment produced a 100-fold increase in the transcriptional activity of promoter II. In combination, however, LRH-1, forskolin, and PMA had a synergistic effect, increasing promoter II activity by 500-fold. Addition of 9-cis-RA repressed LRH-1-mediated transcription (10.9- to 2.9-fold). Moreover, 9-cis-RA was able to repress LRH-1, forskolin, and PMA synergism on promoter II (by 80%). Therefore, 9-cis-RA can inhibit hormone-induced aromatase promoter activity by inhibiting LRH-1 via sequestration of coactivators by endogenously activated RXR.
|
| Discussion |
|---|
|
|
|---|
that have powerful effects on LRH-1 transcriptional activity and, more importantly, are amenable to modulation by small molecules, either positively via cAMP-induced PGC-1
expression, or negatively via rexinoid-induced RXR activation and consequent sequestration of endogenous LRH-1 coactivators.
PGC-1
is an LRH-1 coactivator. Previous studies have suggested that LRH-1 exhibits weak binding to coregulators and indeed displays little discrimination between coactivators, such as SRC-1 and corepressors, such as SMRT (11). We show here that PGC-1
(but not PGC-1ß) is a strong coactivator of LRH-1 in the context of aromatase promoter II through direct interaction via its consensus LXXLL box. The significance of this lies in the fact that unlike many other coregulators that are ubiquitously expressed and (in general) not hormonally regulated, PGC-1
exhibits marked tissue-specific expression that can be strongly regulated by cAMP. In mice, PGC-1
is expressed predominantly in brown adipose tissue, heart, kidney, and brain (18), whereas in humans, it is also expressed in white adipose tissue (26). Although expression in white adipose tissue is relatively low, we show here that PGC-1
mRNA levels in human breast preadipocytes can be markedly increased by cAMP treatment. This confirms that PGC-1
expression is regulated by cAMP in white adipose tissue, as it is in brown adipose tissue (27) and liver (28). More importantly, PGC-1
thus provides a mechanism whereby hormonal signals, via cAMP, could regulate LRH-1 transcriptional activity in the absence of any cognate ligand. The consequences of this for LRH-1 target gene expression are illustrated by the marked stimulation of both PGC-1
and aromatase mRNA expression in preadipocytes in response to forskolin (Fig. 2).
LRH-1 as a target for drug discovery in breast cancer. Although LRH-1 has been implicated in a variety of physiological processes, such as bile acid and cholesterol homeostasis (3), it is not yet clear whether modulation of its transcriptional activity will have therapeutic value. However, its role in regulating estrogen production in breast tissue presents a unique opportunity to develop more specific antiestrogen therapies for breast cancer. Adjuvant hormonal therapy for estrogen-dependent breast cancer targets the mitogenic actions of estrogen by blocking either its action at the level of the estrogen receptor (ER) or its synthesis by aromatase (29). Current phase 3 inhibitors of aromatase catalytic activity are proving superior to the ER antagonist tamoxifen in both primary and secondary end points (30, 31). However, these agents block estrogen formation in all tissues where aromatase is expressed, not only in breast, thus preventing estrogen's beneficial agonist effects in bone, brain, and the cardiovascular system. Future strategies should therefore be aimed at developing drugs that will inhibit estrogen production in sites where estrogen may promote growth of transformed cells, such as the breast, and not in tissues where estrogen action is favorable, such as the bone and brain. This can only be achieved by inhibiting aromatase expression in a tissue-specific fashion (i.e., by the development of selective aromatase modulators). The promoter used to direct aromatase expression in breast tumors, promoter II (and its overlapping partner, promoter I.3), is different from that used in any other tissue of postmenopausal women due to activation by tumor-derived PGE2 (25). It follows that a major regulator of promoter II expression in breast, LRH-1, is a potential target for the development of such selective aromatase modulators (reviewed in ref. 32).
Inhibition of LRH-1 transcriptional activity. To date, the only inhibitors of LRH-1 activity identified have been protein partners, such as SHP (2123), DAX-1 (24), and Prox1 (3335). In this study, we have identified several small LXXLL-containing peptide antagonists of LRH-1, all of which belong to the class III-like LXXLL peptide family, and act by disrupting LRH-1/coactivator interactions. Given the state of the art in the field of peptidomimetic drug design, it is possible that derivatives of the LRH-1-interacting peptides could be created, which directly interfere with the function of the AF-2 pocket of the receptor. However, our data showing that RXR and LRH-1 are likely to be regulated by similar endogenous coactivators has highlighted a more near-term clinical opportunity for a breast cancer therapeutic. Specifically, we show that 9-cis-RA inhibits PGC-1
and GRIP1-induced LRH-1 activity and potently inhibits (by up to 80%) aromatase promoter activity induced by LRH-1 and forskolin. This again provides a mechanism for the modulation, in this case, inhibition, of LRH-1 transcriptional activity and expression of LRH-1 target genes by small molecules and illustrates a level of crosstalk between the RXR and LRH-1 pathways.
RXR ligands are promising molecules for both chemoprevention and therapy of cancer (36). In particular, 9-cis-RA and RXR-selective ligands are highly efficacious in preventing breast cancer in experimental animal models (37, 38). The mechanisms by which rexinoids suppress carcinogenesis are not fully understood, in part due to their large spectra of action. However, it is likely that inhibition of local estrogen synthesis by aromatase in breast preadipocytes contributes to their efficacy. Thiazolidinediones, which are PPAR
ligands, have also been shown to inhibit proliferation of breast cancer cells (39). We previously showed that RXR and PPAR
ligands inhibit aromatase expression from promoter II and promoter I.4 in primary human preadipocytes via an indirect mechanism that does not involve binding of either RXR or PPAR
to the aromatase promoter (40). One mechanism by which rexinoids and PPAR
ligands could exert antiproliferative effects in ER-positive breast cancers is the sequesteration of LRH-1 coactivators by activated RXR with resulting inhibition of LRH-1-induced local aromatase expression and estrogen production. However, rexinoids are also effective growth inhibitor agents in ER-negative tumors (38). We have observed an increase in the proliferation rate of MCF-7 breast cancer cells that modestly (3-fold) overexpress LRH-1, associated with increased expression of cyclin D1,4 suggesting that LRH-1 directly controls cell cycle progression in breast cancer cells, as it does in colon cancer (41). Thus, we speculate that rexinoids may in part inhibit breast cancer cell proliferation through inhibiting LRH-1 transcriptional activity and cell cycle progression.
In summary, we have identified novel hormone-regulated coregulator interactions that modulate LRH-1 transcriptional activity. Because deletion of LRH-1 results in embryonic lethality in mice (42), knowledge of the signaling pathways that modulate its activity, coupled with the development of highly specific peptide antagonists of LRH-1 as described here, will greatly facilitate understanding of the roles of LRH-1 in health and disease and validate LRH-1 as a therapeutic target. In particular, the identification of small molecules, such as rexinoids that inhibit LRH-1 activation of aromatase in breast, suggests that such molecules fulfill the criteria of selective aromatase modulators, and that LRH-1 could be a target for breast-specific tumor therapy.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Drs. Mark Leibowitz and Bill Lamph (Ligand Pharmaceuticals) for the gift of rexinoid ligands; Drs. C.M. Newgard, B.M. Spiegelman, D.J. Mangelsdorf, and M.R. Stallcup for the gift of their plasmids; and members of the McDonnell lab for their useful discussions.
| Footnotes |
|---|
Received 8/ 5/05. Revised 9/30/05. Accepted 10/12/05.
| References |
|---|
|
|
|---|
and ß. Mol Cell Biol 1999;19:822639.
coactivator 1ß (PGC-1ß), a novel PGC-1-related transcription coactivator associated with host cell factor. J Biol Chem 2002;277:16458.
coactivator-1. Int J Obes Relat Metab Disord 1999;23:132732.[CrossRef][Medline]
-hydroxylase gene. Mol Endocrinol 2004;18:242439.
ligands for the treatment of breast cancer. Expert Opin Investig Drugs 2005;14:55768.
and the retinoid X receptor inhibit aromatase cytochrome P450 (CYP19) expression mediated by promoter II in human breast adipose. Endocrinology 2002;143:286371.This article has been cited by other articles:
![]() |
K. A. Brown, K. J. McInnes, N. I. Hunger, J. S. Oakhill, G. R. Steinberg, and E. R. Simpson Subcellular Localization of Cyclic AMP-Responsive Element Binding Protein-Regulated Transcription Coactivator 2 Provides a Link between Obesity and Breast Cancer in Postmenopausal Women Cancer Res., July 1, 2009; 69(13): 5392 - 5399. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Santen, H. Brodie, E. R. Simpson, P. K. Siiteri, and A. Brodie History of Aromatase: Saga of an Important Biological Mediator and Therapeutic Target Endocr. Rev., June 1, 2009; 30(4): 343 - 375. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Safi, G. G. Muramoto, A. B. Salter, S. Meadows, H. Himburg, L. Russell, P. Daher, P. Doan, M. D. Leibowitz, N. J. Chao, et al. Pharmacological Manipulation of the RAR/RXR Signaling Pathway Maintains the Repopulating Capacity of Hematopoietic Stem Cells in Culture Mol. Endocrinol., February 1, 2009; 23(2): 188 - 201. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.-J. Shin and T. F. Osborne Peroxisome Proliferator-activated Receptor-{gamma} Coactivator-1{alpha} Activation of CYP7A1 during Food Restriction and Diabetes Is Still Inhibited by Small Heterodimer Partner J. Biol. Chem., May 30, 2008; 283(22): 15089 - 15096. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. B. Mettu, T. B. Stanley, M. A. Dwyer, M. S. Jansen, J. E. Allen, J. M. Hall, and D. P. McDonnell The Nuclear Receptor-Coactivator Interaction Surface as a Target for Peptide Antagonists of the Peroxisome Proliferator-Activated Receptors Mol. Endocrinol., October 1, 2007; 21(10): 2361 - 2377. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Chen, S. Reierstad, Z. Lin, M. Lu, C. Brooks, N. Li, J. Innes, and S. E. Bulun Prostaglandin E2 Induces Breast Cancer Related Aromatase Promoters via Activation of p38 and c-Jun NH2-Terminal Kinase in Adipose Fibroblasts Cancer Res., September 15, 2007; 67(18): 8914 - 8922. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Hall and D. P. McDonnell The Molecular Mechanisms Underlying the Proinflammatory Actions of Thiazolidinediones in Human Macrophages Mol. Endocrinol., August 1, 2007; 21(8): 1756 - 1768. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kanayama, M. Arito, K. So, S. Hachimura, J. Inoue, and R. Sato Interaction between Sterol Regulatory Element-binding Proteins and Liver Receptor Homolog-1 Reciprocally Suppresses Their Transcriptional Activities J. Biol. Chem., April 6, 2007; 282(14): 10290 - 10298. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Gaillard, M. A. Dwyer, and D. P. McDonnell Definition of the Molecular Basis for Estrogen Receptor-Related Receptor-{alpha}-Cofactor Interactions Mol. Endocrinol., January 1, 2007; 21(1): 62 - 76. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |