Cancer Research Meeting Calendar  Genetics and Biology of Brain Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Passioura, T.
Right arrow Articles by Symonds, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Passioura, T.
Right arrow Articles by Symonds, G.
[Cancer Research 65, 797-804, February 1, 2005]
© 2005 American Association for Cancer Research


Molecular Biology, Pathobiology and Genetics

N-Ras–Induced Growth Suppression of Myeloid Cells Is Mediated by IRF-1

Toby Passioura1, Alla Dolnikov1,2, Sylvie Shen1,2 and Geoff Symonds1,2

1 School of Medical Sciences, The University of New South Wales, Kensington and 2 Children's Cancer Institute Australia, Randwick, Sydney, New South Wales, Australia

Requests for reprints: Geoff Symonds, Locked Bag 4555, Strawberry Hills, New South Wales 2012, Australia. Phone: 128-396-5800; Fax: 128-396-5811; E-mail: gsymonds{at}MEDAU.JNJ.com.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Activating mutations in ras oncogenes occur at high frequency in human malignancies and expression of activated ras in immortalized cells lines is generally transforming. However, somewhat paradoxically, ectopic expression of ras in some myeloid cell lines has been shown to induce growth suppression associated with up-regulation of the cyclin-dependent kinase inhibitor p21CIP1/WAF1 in a p16INK4a, p15INK4b, and p53 independent fashion. We have used cDNA array technology to compare the expression profile induced by activated N-ras (N-rasG13R) in growth-suppressed myeloid cells with that induced in myeloid cells, which are transformed by N-rasG13R. The expression profile induced in growth suppressed cells was consistent with differentiation and included the up-regulation of the transcription factor IFN regulatory factor-1 (IRF-1), a known transcriptional activator of p21CIP/WAF1 expression and a target of oncogenic mutations associated with myeloid leukemia. Antisense suppression of IRF-1 prevented N-rasG13R–associated growth arrest and up-regulation of p21CIP1/WAF1. These results define a novel tumor suppressive response to oncogenic signaling and provide a mechanistic link between growth suppression and differentiation in myeloid cells.

Key Words: rasIRF-1 • myeloid differentiation • AML • MDS


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Activating mutations in the N-ras gene occur at high frequency in acute myeloid leukemia (AML) and the preleukemic condition myelodysplastic syndrome (1, 2), and expression of activated N-ras in hematopoietic stem cells can induce myeloproliferative disorders including leukemias in murine models (3). Whereas the oncogenic transforming abilities of ras genes in immortalized cell lines are well documented, expression of activated ras genes in primary human fibroblasts has been shown to induce a state of permanent growth arrest indistinguishable from replicative senescence. In these fibroblast cells, this effect has been shown to be mediated by p16INK4a, p15INK4b, p14ARF, and p53, and is associated with induction of the cyclin-dependent kinase inhibitor p21CIP1/WAF1 (4–6).

In myeloid cell lines, in contrast to other cell lines, ectopic expression of activated ras genes can induce either growth suppression or oncogenic transformation (7–10). In both primary CD34+ hematopoietic progenitor cells and in some immortalized myeloid cell lines, ectopic expression of activated ras has been shown to induce differentiation, growth suppression and/or apoptosis (8, 11). In particular, expression of activated N-ras and H-ras in the K562 and U937 cell lines respectively, has been shown to induce partial differentiation and growth suppression (7–9). In K562 cells, this was associated with accumulation of p21CIP1/WAF1 in a p16INK4a, p15INK4b, p14ARF, and p53 independent fashion (7, 12–14), implying the existence of an as yet undefined tumor suppressive pathway. By contrast, expression of activated N-ras in TF-1 myeloid cells induces growth factor independence, which is characteristic of oncogenic transformation (10). To elucidate the mechanism of ras-induced growth suppression in hematopoietic cells and to examine the potential link between growth suppression and differentiation in these cells, we have used cDNA array technology to analyze the transcriptional program induced by an activated N-ras (G-to-R mutation at amino acid 13, N-rasG13R) in K562, U937, and TF-1 cells. We report here that the expression profile induced by N-rasG13R associated growth suppression was indicative of differentiation, and included up-regulation of the transcription factor IFN regulatory factor-1 (IRF-1), a known activator of p21CIP1/WAF1 transcription. Moreover, antisense targeting of IRF-1 showed that N-rasG13R–induced growth suppression of these cells was dependent on IRF-1. This defines a novel tumor–suppressive pathway that is independent of the p53 and INK4 pathways, which have previously been shown to respond to oncogenic signaling (4).


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell Culture. The PG13 viral producer cell lines were maintained in DMEM (Life Technologies, Gaithersburg, MD) supplemented with 10% FCS (Life Technologies), 0.2 mmol/L glutamine, 50 units/mL penicillin, and 50 µg/mL streptomycin. Human leukemic K562, U937, and TF-1 cells were grown in RPMI 1640 (Life Technologies) supplemented with 10% FCS (Life Technologies), 0.2 mmol/L glutamine, 50 units/mL penicillin, and 50 µg/mL streptomycin. Human recombinant IL-3 (10 ng/mL) was added to the medium for growth of TF-1 cells. All cell lines were obtained from American Type Culture Collection (Rockville, MD). For induction of polyploidy and consequent growth arrest, K562 cells were treated with 80 ng/mL Nocodazole (Sigma, St. Louis, MO). For cell cycle analysis, 106 cells were incubated in 300 µL 0.1%Triton X-100 with 10 µg/mL propidium iodide and 20 units/mL RNase A for 30 minutes at room temperature, and analysis and cell sorting were done using a FACSort flow cytometer (Becton Dickinson, Mountain View, CA). For methylcellulose colony assays, cells were suspended at 200 cells/mL in 2% methyl cellulose/RPMI supplemented with 15% FCS, 0.2 mmol/L glutamine, 50 units/mL penicillin, and 50 µg/mL streptomycin, and 1 mL was plated into 12-well plate wells. Colonies were counted after 8 days. For two-color fluorescence-activated cell sorting analyses of cell-surface antigen expression, 106 U937 or K562 were stained with PE-conjugated anti-CD11b antibody or PerCP-conjugated anti-CD41 antibody (both from Becton Dickinson), respectively.

Retroviral Gene Transfer. The L9IGFP and L9NrIGFP retroviral vectors, and the virus producer cell lines PG13/L9IGFP and PG13/L9NrIGFP have been described previously (15). Virus containing media from these cells was harvested after a 16-hour incubation at 37°C and infection was done at a multiplicity of infection of 10 in the presence of 8 µg/mL Polybrene (Sigma). Transduced cells were identified and isolated using a FACSort Flow Cytometer (Becton Dickinson).

Plasmid Construction and Transfection. The IRF-1 antisense construct pcDNA3-IRF-1A was engineered by cloning the full-length IRF-1 gene from the SV40-IRF-1A construct (ref. 16; gift of L. Manzella, Department of Biomedical Sciences, University of Catania, Catania, Italy) into the HindIII and BamHI sites of pcDNA3 (Invitrogen, San Diego, CA) in the antisense orientation. The pcDNA3 and pcDNA3-IRF-1A constructs were delivered into K562 and U937 cells by electroporation using a Bio-Rad Gene Pulser at 250 V, 960 µF. Transfected cells were selected with 500 µg/mL G418.

Expression Profiling. Expression profiling of K562 cells was done using Atlas Human Cancer arrays; expression profiling of U937 and TF-1 cells was done using Atlas Human Cancer 1.2 arrays (Clontech, Palo Alto, CA) according to the Manufacturers' instructions. Briefly, RNA was extracted from cells using the Pure Total RNA kit (Clontech), 32P-radiolabeled cDNA was generated by reverse transcription and hybridized to arrays. Arrays were visualized using a Molecular Dynamics 445 SI phosphorimager and analyzed using Atlas Image 2.01 software (Clontech). To account for differences in signal intensity between arrays, the arrays were normalized using a global normalization algorithm.

Reverse Transcription-PCR. Relative expression of IRF-1, Egr-1, and p21CIP1/WAF1 were confirmed by semiquantitative nested reverse transcription-PCR (RT-PCR). Each reaction comprised 200 µmol/L each deoxynucleotide triphosphate, 3 mmol/L MgCl2, 0.2 µmol/L forward primer, 0.4 µmol/L reverse primer, 20 units RNasin, 2.5 units AmpliTaq Gold, 25 units MMLV-RT, 1 µg DNase treated total cellular RNA; cycling conditions of 1 hour at 55°C, 10 minutes at 94°C, then 10 cycles of 94°C for 30 seconds, 55°C for 30 seconds, 72°C for 30 seconds. One microliter of each reaction was used as template for nesting PCR. Each reaction: 200 µmol/L each deoxynucleotide triphosphate, 3 mmol/L MgCl2, 0.2 µmol/L each internal primer, 4 units AmpliTaq; Cycling conditions: 10 minutes at 94°C then 30 cycles of 94°C for 30 seconds, 55°C for 30 seconds, 72°C for 30 seconds. A single round of 23 cycles of amplification using primers specific for ß-actin was used as a loading control (RT-PCR conditions as above). For quantification of ß-actin amplicon DNA, triplicate RT-PCR reactions for each time point were run on an agarose gel and quantified using ImageQuant software (Amersham Biosciences, Arlington Heights, IL).

The primers used were (5' to 3'): Egr1, external forward primer GCACCCAACAGTGGCAAC, internal forward primer AGTGAGCATGACCAACCC, external reverse primer GGGATCATGGGAACCTGG, internal reverse primer GTACTGGAGCGCTGTCCC; IRF-1, external forward primer ATGCAGATTAATTCCAAC, internal forward primer GCCAAGCATGGCTGGGAC, external reverse primer GCTCTGGTCTTTCACCTC, internal reverse primer AAGTTGGCCTTCCACGTC; p21CIP1/WAF1, external forward primer AGGGGACAGCAGAGGAAG, internal forward primer CCTGTCACTGTCTTGTACCC, external reverse primer AGGCAGAAGATGTAGAGC, internal reverse primer GGATTAGGGCTTCCTC; ß-actin, forward primer, TGAAACAACATACAATTCCATCATGAAGTGTGAC, reverse primer, AGGAGCGATAATCTTGATCTCATGGTGCT.

Northern Analysis. Cellular RNA was extracted using TRIzol reagent (Life Technologies) according to the manufacturer's instructions. Total cellular RNA (15 µg) was run under denaturing conditions on a 1.2% agarose gel and transferred to a nylon membrane by capillary transfer. Probes were generated by 10 cycles of liner amplification from cDNA fragments using a specific primer. Each reaction: 200 µmol/L dATP, 200 µmol/L dGTP, 200 µmol/L dTTP, {alpha}-[32P]-dCTP, 2.5 mmol/L MgCl2, 0.2 µmol/L primer, 20 ng template DNA, and 4 units AmpliTaq Gold. Template sequences: IRF-2 probe, XhoI digest of IRF-2 cDNA; IRF-1 probe, full-length IRF-1 cDNA; ß-actin probe, ß-actin amplicon from RT-PCR above. Primers used (5' to 3'): IRF-2 probe, GAGGATCCGAGGCTTAACAGC; IRF-1 probe, GCTCTGGTCTTTCACCTC; ß-actin probe, AGGAGCGATAATCTTGATCTCATGGTGCT. Band intensities were quantified using ImageQuant software (Amersham Biosciences).

Western Blotting. Cells (106) were lysed in radioimmunoprecipitation assay buffer and 25 µg of cell lysate was electorphoresed on a Novex 4% to 12% Bis-Tris gel (Invitrogen). Protein was transferred to a polyvinylidene difluoride membrane. Antibodies used were anti-WAF-1 mouse IgG (Ab-1; Oncogene Research, Uniondale, NY), anti-IRF-1 mouse IgG (Becton Dickinson), goat anti-mouse IgG horseradish peroxidase-conjugated (Santa Cruz Biotechnology, Santa Cruz, CA), anti-actin mouse IgM (Calbiochem, La Jolla, CA), rabbit anti-mouse IgM (Calbiochem). Signals were detected using the enhanced chemiluminescence detection kit and Hyperfilm and quantified using ImageQuant software (Amersham Biosciences).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
N-rasG13R Inhibits Proliferation of K562 and U937 Cells and Effects Tumor Progression in TF-1 Cells. It has previously been shown that expression of an activated H-ras gene induced growth suppression and alterations in ploidy in the erythroleukemic/megakaryoblastic K562 cell line and growth suppression in the monoblastic U937 cell line. By contrast, activated H-ras induced growth factor independence in the TF-1 cell line (7–9). In myeloid leukemia, activating mutations in H-ras are far less frequent than activating mutations in N-ras (17, 18), and the effects of activated ras genes upon hematopoietic cells are known to be isoform specific (19). In previous studies, we have shown that expression of N-rasG13R from the L9NrIGFP vector (Fig. 1A) induced growth suppression in K562 cells and oncogenic transformation in TF-1 cells (15). To assess the effect of its expression upon the proliferation of U937 cells, the L9NrIGFP vector and the L9IGFP control vector (Fig. 1A) were separately introduced into these cells by retroviral infection. U937 cells transduced with the L9NrIGFP vector showed marked growth suppression (as shown by the depletion of GFP-positive cells from a mixed population of transduced and untransduced cells) when compared with cells transduced with the L9IGFP control vector (Fig. 1B).



View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. N-rasG13R inhibits U937 proliferation. A, schematic illustration of vectors. L9IGFP is a Moloney-based retroviral vector in which the 5' long terminal repeat (LTR) drives expression of a transcript consisting of the internal ribosome entry site of cardiomyeitis virus (IRES) linked to the yellow-shifted green fluorescent protein topaz variant (GFP). L9NrIGFP is an identical vector with the N-rasG13R gene inserted upstream of the IRES. B, suppression of U937 proliferation by N-rasG13R. U937 cells were transduced in triplicate with either the N-rasG13R expressing L9NrIGFP vector ({blacksquare}) or the L9IGFP control vector ({bullet}). The proportion of GFP positive cells in each culture was determined by flow cytometry on the indicated days post-transduction. C, expression of differentiation-associated antigens on U937 and K562 cells. Cells were infected with the L9IGFP (white columns) and L9NrIGFP (black columns) vectors and expression of cell surface antigens (CD11b in U937 and CD41 in K562) was assayed in GFP-positive cells 48 hours after infection. D, cell cycle analysis of U937 cells expressing N-rasG13R. Purified populations of U937 cells expressing L9IGFP (white columns) or L9NrIGFP (black columns) were stained with propidium iodide and analyzed by fluorescence-activated cell sorting. Apoptotic cells were assessed by subdiploid DNA content (all experiments were done in triplicate; bars, SD).

 
Activated H-ras induced growth suppression of U937 cells was shown to be associated with increased expression of differentiation-associated cell-surface antigens (8). To assess whether N-rasG13R would also increase expression of such antigens, U937 cells were infected with the L9IGFP or L9NrIGFP vectors, stained with a phycoerythrin-conjugated anti-CD11b antigen and the proportion of cells expressing both GFP and CD11b was assessed by two-color fluorescence-activated cell sorting. Two days after infection, U937 cells expressing N-rasG13R were more than 30% positive for CD11b expression, as compared with ~10% of cells expressing the control vector (Fig. 1C). A similar analysis was done on K562 cells using an anti-CD41 antibody. K562 cells expressing N-rasG13R showed increased expression of the megakaryocytic marker CD41 (Fig. 1C). This shows that, as has been shown for activated H-ras (8), the growth suppression induced by N-rasG13R in K562 and U937 cells seems to be part of a differentiation program.

We had previously shown that growth suppression induced by N-rasG13R in K562 cells was associated with an aberrant cell cycle profile, characterized by polyploidy (a feature of megakaryocytic differentiation) and apoptosis (15). To assess the effect of N-rasG13R expression on the cell cycle of U937 cells, purified populations of U937 cells expressing either the L9IGFP or L9NrIGFP vectors (>90% GFP positive, data not shown) were obtained by fluorescence activated cell sorting. Propidium Iodide staining of these cells revealed that around 10% of cells expressing N-rasG13R were apoptotic, as assessed by subdiploid DNA content (Fig. 1D). There was also a significant (P < 0.00005) decrease in the proportion of viable cells in the S-G2-M phases of the cell cycle (Fig. 1D). This suggests that in U937 cells N-rasG13R both induces apoptosis and inhibits progression through the cell cycle.

Expression Profiling. In order to investigate the basis of the growth inhibitory effect of N-rasG13R in U937 and K562 cells, expression profiling was done and the transcriptional programs induced in these two growth-suppressed cell lines compared with that induced by N-rasG13R in TF-1 cells where N-rasG13R induces transformation rather than growth suppression. The L9NrIGFP and L9IGFP constructs were separately introduced into K562, U937 and TF-1 cells by retroviral gene transfer. Seventy-two hours after transduction, GFP positive cells were isolated by flow cytometry and following culture for 24 hours, RNA was extracted for expression profiling. In all cases, cell populations were >90% GFP positive after sorting (data not shown). In order to minimize background signal, each infection was done in five separate experiments and samples were not pooled until after RNA extraction. Triplicate expression profiles were then generated from separate pooled samples (i.e., 15 individual infection cultures per treatment per cell line in total).

The changes in gene expression induced by N-rasG13R in each of these three cell lines were found to be distinctly different (Supplementary Tables S1-S6). No genes were identified which showed significant (>2-fold) up-modulation or down-modulation across all three cell lines. Of the 588 genes assayed in K562 cells, 44 (7.5%) were up-regulated and 105 (17.9%) down-regulated. Of the 1076 genes assayed in TF-1 and U937 cells, 35 (3.3%) were up-regulated in TF-1 and 38 (3.5%) were down regulated; in U937, 88 (8.2%) were up-regulated and 43 (4.0%) were down-regulated.

The analysis sought to identify genes that showed changes in expression specific to the growth inhibitory phenotype. To achieve this, the expression profiles of L9NrIGFP-transduced cells were compared with L9IGFP-transduced cells to generate a differential expression ratio for each gene (differential expression ratio = ras signal divided by control signal). Comparison of the differential expression ratios for K562 and U937 cells (Fig. 2A) revealed three genes which showed significant (>2-fold) up-regulation in both cell lines. These genes were the transcription factor IFN regulatory factor-1 (IRF-1), rac2 (a small GTPase) and the CDK inhibitor p21CIP1/WAF1 (which was previously shown to be up-regulated during N-ras–associated growth arrest of K562 cells; ref. 7). Comparison of K562 and U937 differential expression ratios with TF-1 differential expression ratios showed that expression of these three genes was not altered in response to ectopic N-rasG13R expression in TF-1 cells (Fig. 2B and C) indicating that up-regulation of these three genes was characteristic of N-rasG13R induced growth suppression.



View larger version (18K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Comparison of expression profiles induced by N-rasG13R in K562, U937, and TF-1 cells. Total RNA from cells expressing either N-rasG13R (L9NrIGFP) or the control vector (L9IGFP) was used to generate expression profiles for each cell type. A, comparison of differential expression ratios (differential expression = ras signal/control signal) for K562 and U937 cells showing up-regulation of IRF-1, rac2, and p21CIP1/WAF1. Comparison of TF-1 with K562 (B) and U937 (C) showed that these genes were not up-regulated by N-rasG13R in TF-1 cells. The N-rasG13R gene did not appear in A and B because it was not present on the arrays used for profiling of K562 cells.

 
IRF-1 has been shown to be involved in the earliest response of murine myeloid cells to differentiation stimuli and is a direct activator of p21CIP1/WAF1 expression (20, 21). Up-regulation of rac2 has also been shown to be associated with myeloid differentiation (22), although, unlike IRF-1, there is no evidence to suggest that rac2 has a causative role in this process. Thus, the expression array data indicated that the p53-independent growth arrest of K562 and U937 cells in response to activated N-rasG13R was part of a normal differentiation process. In support of this conclusion, the expression array data showed that several genes known to be associated with myeloid differentiation were found to be up-regulated in response to N-rasG13R expression in at least one of these cells lines (K562 or U937) but not in TF-1 cells (Table 1). Of particular interest were the early growth response-1 (Egr-1) gene and MYD88 gene, both of which (along with IRF-1) have been shown to be up-regulated during the primary response of myeloid cells to differentiation stimuli (23), and are causally implicated in myeloid differentiation. MYD88 (24) and several other known IRF-1–responsive genes [i.e., p47-phox (25), (2'-5') oligoadenylate synthetase 2 (26), and CD40 (27)] showed alteration of expression in these cell lines (see Table 1). Thus, N-rasG13R induced growth inhibition in K562 and U937 cells seemed to be mediated by IRF-1 and p21CIP1/WAF1 as part of a differentiation program, involving early induction of Egr-1 (K562) and MYD88 (U937).


View this table:
[in this window]
[in a new window]

 
Table 1. Myeloid differentiation-associated genes demonstrating modulation of expression (>2-fold) in response to N-rasG13R in either K562 and/or U937 but not in TF-1 cells

 
Specificity of the N-rasG13R response. Whereas cDNA nylon arrays of the type we used are quantitative (28), the analysis of data generated by such arrays is confounded by the statistical problem of multiple testing (29, 30), which may lead to a large number of false positive signals. To confirm the N-rasG13R induced transcriptional up-regulation of the genes which are most strongly implicated as being causal of myeloid differentiation and consequent growth arrest (i.e., IRF-1 and p21CIP1/WAF1 in K562 and U937 cells, and Egr-1 in K562 cells), "semiquantitative" RT-PCR was done (Fig. 3). Although this technique is not useful for quantitating the magnitude of alterations in transcription, it is sufficient for evaluating trends (i.e., up-regulated, down-regulated, or unaltered expression) in gene expression, and, as such, is an appropriate technique for the validation of array data (30, 31) . To ensure even RNA loading, RT-PCR using primers specific for ß-actin (expression of which was not affected by N-rasG13R expression in any of the three cell lines, data not shown) was done. For this control, 23 cycles of amplification were done, since this number of cycles was experimentally determined to correspond to an early stage of linear amplification (Fig. 3E).



View larger version (35K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Confirmation of N-rasG13R induced gene up-regulation. A-C, histogram plots of the expression level of IRF-1, Egr-1, and p21CIP1WAF1, in TF-1, K562, and U937 cells expressing either N-rasG13R (L9NrIGFP) or the control vector (L9IGFP) as determined by array analysis. Ordinate axis, gene expression intensity (AtlasImage arbitrary units, AAU); bars, 99% confidence intervals. D, RT-PCR done on the same samples using primer sets specific for IRF-1, Egr-1, p21CIP1WAF1, and ß-actin. E, quantification of ß-actin amplicon DNA amplified from 1 µg U937 total cellular RNA. Points, mean of three experiments; % SD for each point was <2%. (F) expression of IRF-1 and IRF-2 in parental cell lines. Expression of IRF-1 and IRF-2 was determined in parental TF-1, K562, and U937 cells by Northern analysis. ß-Actin was used as a loading control.

 
In all cases, the RT-PCR data correlated well with the expression array data (compare Fig. 3D with Fig. 3A, B, and C). p21CIP1/WAF1 expression was only detected in K562 and U937 cells expressing N-rasG13R. IRF-1 also showed clear up-regulation in these two samples when compared with K562 and U937 cells expressing the control vector. Egr-1 was only detected in K562 cells expressing N-rasG13R.

In TF-1 cells, the basal level of IRF-1 expression was high relative to U937 and K562 cells (Fig. 3A), yet TF-1 cells do not seem to show impaired proliferation. In primary AML samples, it has been shown that expression of IRF-1 is often higher than in normal hematopoietic tissues (32). However, primary AML samples have also been shown to have relatively high expression of the IRF-1 antagonist IRF-2 (33). Despite the increase in IRF-1 expression observed in AML, the ratio of IRF-1/IRF-2 is generally lower in AML than in normal tissues (33), providing an explanation for the ability of these cells to proliferate in the presence of high IRF-1 expression. To assess whether increased expression of IRF-2 might account for the ability of TF-1 cells to proliferate in the presence of high levels of IRF-1, Northern analysis was done using RNA extracted from parental TF-1, K562 and U937 cells (Fig. 3F). IRF-2 was expressed more strongly in TF-1 cells than in U937 or K562 cells, and the IRF-1/IRF-2 ratio in TF-1 cells was intermediate between the ratio observed for U937 and K562 cells. This provides an explanation for the ability of TF-1 cells to proliferate despite high basal IRF-1 expression.

Suppression of IRF-1 Inhibits N-rasG13R–Induced Growth Arrest. We next analyzed the up-regulation of IRF-1 in response to N-rasG13R expression and its association with p21CIP1/WAF1 up-regulation during the growth arrest of U937 and K562 cells. For these experiments, an antisense gene suppression strategy was used to inhibit IRF-1 expression. A full-length IRF-1 antisense expression plasmid (pcDNA3-IRF-1A) was introduced into K562 and U937 cells by electroporation, and transduced cells were selected by treatment with G418. These cultures were then transduced with the L9IGFP or L9NrIGFP vectors, and the proportion of GFP-positive cells was monitored by flow cytometry. U937 cells expressing the IRF-1 antisense construct were completely resistant to the growth suppressive effect of N-rasG13R as evidenced by the stability of the GFP expressing population (Fig. 4A). K562 cells expressing the IRF-1 antisense construct showed inhibition of the N-rasG13R induced growth arrest at 4 days after transduction, but the GFP expressing population decreased at approximately the same rate between days 4 and 6 in both of the N-rasG13R expressing cultures (Fig. 4B), suggesting that in these cells, either the antisense suppression of IRF-1 is less effective than in U937 cells or that an alternative growth suppressive pathway is activated.



View larger version (39K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. Expression of IRF-1 antisense inhibits N-rasG13R associated growth arrest in U937 and K562 cells. U937 (A) or K562 (B) cells transduced with either the pcDNA3 control vector ({circ}, {bullet}) or the IRF-1 antisense vector pcDNA3-IRF-1A ({square}, {blacksquare}) were infected with the GFP control vector L9IGFP ({circ}, {square}, broken line) or the N-rasG13R expressing L9NrIGFP vector ({bullet}, {blacksquare}, solid line) to generate mixed populations of GFP-positive and GFP-negative cells. GFP-positive cells were purified from these cultures by flow cytometry to obtain pure populations of cells stably expressing the L9NrIGFP or L9IGFP vector. Growth of these pure populations (both K562 and U937 shown in C and D, respectively) was assessed in liquid culture (8 days after introduction of the retroviral vector) over a 72 hours time period as indicated. In K562 cells (C), IRF-1 antisense ({blacksquare}, {square}) partially offset the growth suppression induced by N-rasG13R ({bullet}, {blacksquare}). In U937 cells (D), IRF-1 antisense ({blacksquare}, {square}) completely abrogated the growth suppression induced by N-rasG13R ({bullet}, {blacksquare}). Growth of pure populations was also assessed using colony formation in semisolid media. In K562 cells, expression of N-rasG13R decreased the size of individual colonies in semisolid media without significantly affecting the number of colonies, and this was partially alleviated by expression of IRF-1 antisense (E). Colonies in semisolid media formed by U937 cells transduced with pcDNA3 and L9IGFP (F), or pcDNA3-IRF-1A and L9IGFP (H). In U937, cells transduced with pcDNA3 and L9NrIGFP colony formation is completely abolished (G) but is restored in cell expressing pcDNA3-IRF-1A and L9NrIGFP (I). Representative examples.

 
Purified populations of each cell type (K562 or U937), transduced with each combination of vectors (pcDNA3 + L9IGFP, pcDNA3 + L9NrIGFP, pcDNA3-IRF-1A + L9IGFP, and pcDNA3-IRF-1A + L9NrIGFP) were isolated by flow cytometry, to generate populations that stably expressed the N-rasG13R transgene (>90% GFP positive, data not shown). Growth of these cells was assessed in liquid culture (Fig. 4C and D). As in the mixed populations, proliferation of both K562 and U937 cells seemed to be suppessed by N-rasG13R expression. Expression of IRF-1 antisense seemed to completely restore proliferation of U937 cells and partially restore proliferation of K562 cells. Colony assays done with these pure populations showed that expression of N-rasG13R in U937 cells completely abolished colony formation in methylcellulose culture and that suppression of IRF-1 expression restored normal colony formation (Fig. 4F-I). In K562 cells the number of colonies observed in methylcellulose culture was unaffected by expression of N-rasG13R; however, the average size of each colony was smaller in N-rasG13R expressing cultures, and this was partially offset by inhibition of IRF-1 expression (Fig. 4E).

To confirm that IRF-1 expression was inhibited by the anti-sense construct, protein was extracted from the purified cell cultures and analyzed by Western blot (Fig. 5). In both cell lines, there was a clear increase in the quantity of IRF-1 protein in response to N-rasG13R expression, and this was decreased back to baseline level in K562 cells and below baseline levels in U937 cells by the expression of IRF-1 antisense. In U937 cells p21CIP1/WAF1 protein levels closely mirrored IRF-1 protein levels, both in the presence and absence of N-rasG13R, demonstrating the dependence of p21CIP1/WAF1 expression on IRF-1 expression in these cells. A similar expression pattern was observed in K562 cells, although the antisense suppression of IRF-1 seemed slightly less effective than in U937 cells and p21CIP1/WAF1 expression in response to N-rasG13R was only partially decreased by IRF-1 antisense expression. This decreased level of p21CIP1/WAF1 suppression by IRF-1 antisense in K562 cells may reflect the decreased efficacy of the antisense in this cell line (as evidenced by baseline level of IRF-1 in K562 cells expressing the antisense construct alone, Fig. 5) or may be indicative of an alternative tumor suppressive pathway in this cell line. The fact that there is up-regulation of p21CIP1/WAF1 in K562 cells in response to N-rasG13R even in the absence of detectable IRF-1 up-regulation (Fig. 5, lane 4) favors the latter explanation. This shows the existence of an alternative pathway acting in parallel to IRF-1 mediated up-regulation of p21CIP1/WAF1 in response to N-rasG13R in these cells. Thus, N-rasG13R induced growth suppression seemed completely dependent on IRF-1 in U937 cells and partially dependent on IRF-1 in K562 cells. These data further support the notion that IRF-1 mediates the tumor suppressive response to N-rasG13R in these cells.



View larger version (43K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. IRF-1 antisense suppresses WAF1 up-regulation in response to N-rasG13R. K562 or U937 cells selected for either the control (pcDNA3) or IRF-1 antisense expression (pcDNA3-IRF-1A) constructs were transduced with either the GFP control (L9IGFP) or N-rasG13R and GFP bicistronic (L9NrIGFP) retroviral vectors and GFP positive cells were isolated by flow cytometry. Analysis of these populations by Western blotting for IRF-1 and p21CIP1/WAF1 shows that expression of both IRF-1 and p21CIP1/WAF1 is increased in both K562 and U937 cells expressing the N-rasG13R gene. In U937 cells, this up-regulation was prevented by suppression of IRF-1 expression using the antisense construct. In K562 cells p21CIP1/WAF1 up-regulation is only partially inhibited by IRF-1 antisense expression despite abrogation of IRF-1 up-regulation in response to N-rasG13R. Western blots were done in triplicate. Bars, SD.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In these expression profiling experiments, a variety of genes showed altered expression in response to N-rasG13R in K562 (25.3%), TF-1 (6.8%), and U937 (12.4%) cells. In the growth suppressed cell lines K562 and U937, many of these genes were associated with myeloid differentiation. The higher percentage in K562 cells relative to both TF-1 and U937 may be due to the gross changes in morphology in these cells in response to N-rasG13R expression. In terms of these percentages, it should be noted that the gene sets on these arrays are specifically related to oncogenic transformation and regulation of proliferation.

Three of the experiments in this study used a decrease in the proportion of L9NrIGFP expressing U937 or K562 cells as a measure of growth suppression (Figs. 1 and 4). It is possible that this decrease in the proportion of cells expressing GFP reflects a loss of GFP expression (possibly caused by an expression machinery or cellular metabolism mechanism) rather than growth suppression of cells expressing L9NrIGFP. However, such transgene silencing mechanisms would have to be specific (i) for the L9NrIGFP transcript (because expression of the control vector remained stable) and (ii) for K562 and U937 cells because expression of the L9NrIGFP vector in TF-1 cells leads to stable GFP expression; ref. 15). Because activated ras genes have been shown to inhibit proliferation of K562 and U937 cells, but not TF-1 cells (7, 8, 15), growth suppression would seem to be the most likely explanation for this decrease in GFP expression observed in U937 and K562 cells. Additionally, in each case where a decrease in GFP expression was used as a measure of growth suppression, we have employed a confirmatory technique (cell cycle analysis in Fig. 1 and colony assays in Fig. 4). Thus, we are confident that the decrease in GFP expression observed is a reflection of growth suppression.

To the best of our knowledge, up-regulation of IRF-1 expression in response to ras signaling has not previously been reported, although, IRF-1 inactivation cooperates with activated H-ras and myc genes to transform primary murine fibroblasts (34). IRF-1 is involved in the process of cellular growth arrest in response to DNA damage (35) and can directly activate the p21CIP1/WAF1 promoter (21). Thus, IRF-1 seems to be a tumor suppressor gene, which provides a mechanism for induction of p21CIP1/WAF1 in response to oncogenic signaling or DNA damage in the absence of p53. In support of this, IRF-1 is commonly inactivated in AML and myelodysplastic syndrome (33, 36).

IRF-1 plays an important role during myeloid differentiation. IRF-1 is transcriptionally up-regulated during the primary response of myeloid cells to differentiation stimuli (23) and inhibition of IRF-1 is sufficient to prevent phorbol ester induced differentiation and p21CIP1/WAF1 induction in myeloid cells (16). It seems plausible to conclude, therefore, that the physiologic role of IRF-1 in inducing growth suppression is part of the myeloid differentiation process. A "two-hit" model of leukemogenesis has been proposed in which gain of function mutations in genes which promote proliferation (e.g., N-ras) cooperate with loss of function mutations in hematopoietic transcription factors, generating the highly proliferative and undifferentiated blasts that characterize leukemia (37). The present finding that N-ras mutation can up-regulate IRF-1 expression fits well with this hypothesis, since it provides a specific example of how an oncogene and a hematopoietic transcription factor (acting as a tumor suppressor) may interact during leukemogenesis.

It has been shown that IFN regulatory factor-2 (IRF-2) antagonizes IRF-1–mediated transcription (38). IRF-2 is a known oncogene and is implicated in the pathogenesis of myeloid leukemia (39). Furthermore, analysis of bone marrow samples from AML patients has revealed significantly lower IRF-1/IRF-2 ratios than normal (33), suggesting that the relative expression level of these two genes is of greater phenotypic significance than the absolute level of either. Interestingly, our study showed that the N-rasG13R–induced growth suppression resistant TF-1 cell line showed stronger expression of IRF-2 than did the N-rasG13R–induced growth suppression sensitive U937 and K562 cell lines. This provides a likely explanation for the ability of TF-1 cells to proliferate despite relatively high IRF-1 expression.

The two most effective pharmacologic therapies for the treatment of AML at present are all-trans retinoic acid and arsenic trioxide, both of which are used in the treatment of AML M3 subtype (acute promyelocytic leukemia). Both of these agents induce differentiation of the leukemic blasts by releasing the block in differentiation which is caused by the PML-RAR{alpha} oncoprotein (40). In view of this, therapeutic strategies aimed at inducing differentiation of leukemic blasts have significant potential, and oncogenes that block differentiation are attractive targets for such therapies. Thus, it may be possible to restore IRF-1 function in leukemic blasts by targeting the expression of IRF-2. Taken together with the results presented in this study, this suggests that IRF-2 may be a good target for therapies in which the ultimate goal is the induction of differentiation of the leukemic blasts.

In summary, our results show that the growth arrest of these myeloid cell lines in response to N-rasG13R expression is part of a differentiation response which is mediated by IRF-1. This novel tumor suppressive pathway activated by oncogenic signaling may explain the high incidence of IRF-1 inactivation in AML and myelodysplastic syndrome, because inactivation of this growth suppressive pathway may be necessary for N-ras–associated leukemogenesis.


    Acknowledgments
 
Grant support: National Health and Medical Research Council grant 113821 (G. Symonds, a Principal Research Fellow during this work).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online(http://cancerres.aacrjournals.org).

Received 4/13/04. Revised 10/28/04. Accepted 11/23/04.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Neubauer A, Greenberg P, Negrin R, Ginzton N, Liu E. Mutations in the ras proto-oncogenes in patients with myelodysplastic syndromes. Leukemia 1994;8:638–41.[Medline]
  2. Neubauer A, Dodge RK, George SL, et al. Prognostic importance of mutations in the ras proto-oncogenes in de novo acute myeloid leukemia. Blood 1994;83:1603–11.[Abstract/Free Full Text]
  3. MacKenzie KL, Dolnikov A, Millington M, Shounan Y, Symonds G. Mutant N-ras induces myeloproliferative disorders and apoptosis in bone marrow repopulated mice. Blood 1999;93:2043–56.[Abstract/Free Full Text]
  4. Serrano M, Lin AW, McCurrach ME, Beach D, Lowe SW. Oncogenic ras provokes premature cell senescence associated with accumulation of p53 and p16INK4a. Cell 1997;88:593–602.[CrossRef][Medline]
  5. Palmero I, Pantoja C, Serrano M. p19ARF links the tumour suppressor p53 to Ras. Nature 1998;395:125–6.[CrossRef][Medline]
  6. Malumbres M, Perez De Castro I, Hernandez MI, Jimenez M, Corral T, Pellicer A. Cellular response to oncogenic ras involves induction of the Cdk4 and Cdk6 inhibitor p15(INK4b). Mol Cell Biol 2000;20:2915–25.[Abstract/Free Full Text]
  7. Delgado MD, Vaque JP, Arozarena I, et al. H-, K- and N-Ras inhibit myeloid leukemia cell proliferation by a p21WAF1-dependent mechanism. Oncogene 2000;19:783–90.[CrossRef][Medline]
  8. Maher J, Baker D, Dibb N, Roberts I. Mutant ras promotes haemopoietic cell proliferation or differentiation in a cell-specific manner. Leukemia 1996;10:83–90.[Medline]
  9. Matsumura I, Kawasaki A, Tanaka H, et al. Biologic significance of GATA-1 activities in Ras-mediated megakaryocytic differentiation of hematopoietic cell lines. Blood 2000;96:2440–50.[Abstract/Free Full Text]
  10. Scherr M, Maurer AB, Klein S, Ganser A, Engels JW, Grez M. Effective reversal of a transformed phenotype by retrovirus-mediated transfer of a ribozyme directed against mutant N-ras. Gene Ther 1998;5:1227–34.[CrossRef][Medline]
  11. Darley RL, Hoy TG, Baines P, Padua RA, Burnett AK. Mutant N-RAS induces erythroid lineage dysplasia in human CD34+ cells. J Exp Med 1997;185:1337–47.[Abstract/Free Full Text]
  12. Law JC, Ritke MK, Yalowich JC, Leder GH, Ferrell RE. Mutational inactivation of the p53 gene in the human erythroid leukemic K562 cell line. Leuk Res 1993;17:1045–50.[CrossRef][Medline]
  13. Ogawa S, Hirano N, Sato N, et al. Homozygous loss of the cyclin-dependent kinase 4-inhibitor (p16) gene in human leukemias. Blood 1994;84:2431–5.[Abstract/Free Full Text]
  14. Otsuki T, Clark HM, Wellmann A, Jaffe ES, Raffeld M. Involvement of CDKN2 (p16INK4A/MTS1) and p15INK4B/MTS2 in human leukemias and lymphomas. Cancer Res 1995;55:1436–40.[Abstract/Free Full Text]
  15. Dolnikov A, Shen S, Millington M, et al. A sensitive dual-fluorescence reporter system enables positive selection of ras suppressors by suppression of ras-induced apoptosis. Cancer Gene Ther 2003;10:745–54.[CrossRef][Medline]
  16. Manzella L, Conte E, Cocchiaro G, et al. Role of interferon regulatory factor 1 in monocyte/macrophage differentiation. Eur J Immunol 1999;29:3009–16.[CrossRef][Medline]
  17. Farr CJ, Saiki RK, Erlich HA, McCormick F, Marshall CJ. Analysis of RAS gene mutations in acute myeloid leukemia by polymerase chain reaction and oligonucleotide probes. Proc Natl Acad Sci U S A 1988;85:1629–33.[Abstract/Free Full Text]
  18. Janssen JW, Steenvoorden AC, Lyons J, et al. RAS gene mutations in acute and chronic myelocytic leukemias, chronic myeloproliferative disorders, and myelodysplastic syndromes. Proc Natl Acad Sci U S A 1987;84:9228–32.[Abstract/Free Full Text]
  19. Maher J, Baker DA, Manning M, Dibb NJ, Roberts IA. Evidence for cell-specific differences in transformation by N-, H- and K-ras. Oncogene 1995;11:1639–47.[Medline]
  20. Abdollahi A, Lord KA, Hoffman-Liebermann B, Liebermann DA. Interferon regulatory factor 1 is a myeloid differentiation primary response gene induced by interleukin 6 and leukemia inhibitory factor: role in growth inhibition. Cell Growth Differ 1991;2:401–7.[Abstract]
  21. Coccia EM, Del Russo N, Stellacci E, et al. Activation and repression of the 2-5A synthetase and p21 gene promoters by IRF-1 and IRF-2. Oncogene 1999;18:2129–37.[CrossRef][Medline]
  22. Nisimoto Y, Ogawa H. Interaction between p21-activated protein kinase and Rac during differentiation of HL-60 human promyelocytic leukemia cell induced by all-trans-retinoic acid. Eur J Biochem 2002;269:2622–9.[Medline]
  23. Liebermann DA, Hoffman B. Myeloid differentiation (MyD) primary response genes in hematopoiesis. Oncogene 2002;21:3391–402.[CrossRef][Medline]
  24. Harroch S, Gothelf Y, Revel M, Chebath J. 5' upstream sequences of MyD88, an IL-6 primary response gene in M1 cells: detection of functional IRF-1 and Stat factors binding sites. Nucleic Acids Res 1995;23:3539–46.[Abstract/Free Full Text]
  25. Eklund EA, Kakar R. Recruitment of CREB-binding protein by PU.1, IFN-regulatory factor-1, and the IFN consensus sequence-binding protein is necessary for IFN-{gamma}-induced p67phox and gp91phox expression. J Immunol 1999;163:6095–105.[Abstract/Free Full Text]
  26. Yu F, Wang Q, Floyd-Smith G. Transcriptional induction of p69 2'-5'-oligoadenylate synthetase by interferon-{alpha} is stimulated by 12-O-tetradecanoyl phorbol-13-acetate through IRF/ISRE binding motifs. Gene 1999;237:177–84.[CrossRef][Medline]
  27. Wagner AH, Gebauer M, Pollok-Kopp B, Hecker M. Cytokine-inducible CD40 expression in human endothelial cells is mediated by interferon regulatory factor-1. Blood 2002;99:520–5.[Abstract/Free Full Text]
  28. Duggan DJ, Bittner M, Chen Y, Meltzer P, Trent JM. Expression profiling using cDNA microarrays. Nat Genet 1999;21:10–4.[CrossRef][Medline]
  29. Ewens WJ, Grant GR. Statistical methods in bioinformatics: an introduction: Springer; 2001.
  30. Chuaqui RF, Bonner RF, Best CJ, et al. Post-analysis follow-up and validation of microarray experiments. Nat Genet 2002;32:509–14.
  31. Luo J, Duggan DJ, Chen Y, et al. Human prostate cancer and benign prostatic hyperplasia: molecular dissection by gene expression profiling. Cancer Res 2001;61:4683–8.[Abstract/Free Full Text]
  32. Guzman ML, Upchurch D, Grimes B, et al. Expression of tumor-suppressor genes interferon regulatory factor 1 and death-associated protein kinase in primitive acute myelogenous leukemia cells. Blood 2001;97:2177–9.[Abstract/Free Full Text]
  33. Preisler HD, Perambakam S, Li B, et al. Alterations in IRF1/IRF2 expression in acute myelogenous leukemia. Am J Hematol 2001;68:23–31.[CrossRef][Medline]
  34. Tanaka N, Ishihara M, Kitagawa M, et al. Cellular commitment to oncogene-induced transformation or apoptosis is dependent on the transcription factor IRF-1. Cell 1994;77:829–39.[CrossRef][Medline]
  35. Tanaka N, Ishihara M, Lamphier MS, et al. Cooperation of the tumour suppressors IRF-1 and p53 in response to DNA damage. Nature 1996;382:816–8.[CrossRef][Medline]
  36. Willman CL, Sever CE, Pallavicini MG, et al. Deletion of IRF-1, mapping to chromosome 5q31.1, in human leukemia and preleukemic myelodysplasia. Science 1993;259:968–71.[Abstract]
  37. Kelly LM, Gilliland DG. Genetics of myeloid leukemias. Annu Rev Genomics Hum Genet 2002;3:179–98.[CrossRef][Medline]
  38. Harada H, Fujita T, Miyamoto M, et al. Structurally similar but functionally distinct factors, IRF-1 and IRF-2, bind to the same regulatory elements of IFN and IFN-inducible genes. Cell 1989;58:729–39.[CrossRef][Medline]
  39. Futaki M, Inokuchi K, Hanawa H, Tanosaki S, Dan K, Nomura T. Possible transforming activity of interferon regulatory factor 2 in tumorigenicity assay of NIH3T3 cells transfected with DNA from chronic myelogenous leukemia patients. Leuk Res 1996;20:601–5.[CrossRef][Medline]
  40. Zhu J, Chen Z, Lallemand-Breitenbach V, de The H. How acute promyelocytic leukaemia revived arsenic. Nat Rev Cancer 2002;2:705–13.[CrossRef][Medline]
  41. Neubauer A, Fiebeler A, Graham DK, et al. Expression of axl, a transforming receptor tyrosine kinase, in normal and malignant hematopoiesis. Blood 1994;84:1931–41.[Abstract/Free Full Text]
  42. Clay D, Rubinstein E, Mishal Z, et al. CD9 and megakaryocyte differentiation. Blood 2001;97:1982–9.[Abstract/Free Full Text]
  43. Miyazato A, Ueno S, Ohmine K, et al. Identification of myelodysplastic syndrome-specific genes by DNA microarray analysis with purified hematopoietic stem cell fraction. Blood 2001;98:422–7.[Abstract/Free Full Text]
  44. Doggett KL, Briggs JA, Linton MF, et al. Retroviral mediated expression of the human myeloid nuclear antigen in a null cell line upregulates Dlk1 expression. J Cell Biochem 2002;86:56–66.[CrossRef][Medline]
  45. Baccini V, Roy L, Vitrat N, et al. Role of p21(Cip1/Waf1) in cell-cycle exit of endomitotic megakaryocytes. Blood 2001;98:3274–82.[Abstract/Free Full Text]
  46. Kaetzel DM, Coyne DW, Fenstermaker RA. Transcriptional control of the platelet-derived growth factor subunit genes. Biofactors 1993;4:71–81.[Medline]
  47. Wickenhauser C, Hillienhof A, Jungheim K, et al. Detection and quantification of transforming growth factor ß (TGF-ß) and platelet-derived growth factor (PDGF) release by normal human megakaryocytes. Leukemia 1995;9:310–5.[Medline]
  48. Casella I, Feccia T, Chelucci C, et al. Autocrine-paracrine VEGF loops potentiate the maturation of megakaryocytic precursors through Flt1 receptor. Blood 2003;101:1316–23.[Abstract/Free Full Text]
  49. Salzberg S, Hyman T, Turm H, et al. Ectopic expression of 2-5A synthetase in myeloid cells induces growth arrest and facilitates the appearance of a myeloid differentiation marker. Cancer Res 1997;57:2732–40.[Abstract/Free Full Text]
  50. Moreb JS, Schweder M. Human A1, a Bcl-2-related gene, is induced in leukemic cells by cytokines as well as differentiating factors. Leukemia 1997;11:998–1004.[CrossRef][Medline]
  51. Major TC, Liang L, Lu X, Rosebury W, Bocan TM. Extracellular matrix metalloproteinase inducer (EMMPRIN) is induced upon monocyte differentiation and is expressed in human atheroma. Arterioscler Thromb Vasc Biol 2002;22:1200–7.[Abstract/Free Full Text]
  52. Burchert A, Notter M, Dietrich Menssen H, et al. CD82 (KAI1), a member of the tetraspan family, is expressed on early haemopoietic progenitor cells and up-regulated in distinct human leukaemias. Br J Haematol 1999;107:494–504.[CrossRef][Medline]
  53. Nykjaer A, Petersen CM, Christensen EI, Davidsen O, Gliemann J. Urokinase receptors in human monocytes. Biochim Biophys Acta 1990;1052:399–407.[Medline]
  54. Lord KA, Abdollahi A, Hoffman-Liebermann B, Liebermann DA. Proto-oncogenes of the fos/jun family of transcription factors are positive regulators of myeloid differentiation. Mol Cell Biol 1993;13:841–51.[Abstract/Free Full Text]
  55. Kozopas KM, Yang T, Buchan HL, Zhou P, Craig RW. MCL1, a gene expressed in programmed myeloid cell differentiation, has sequence similarity to BCL2. Proc Natl Acad Sci U S A 1993;90:3516–20.[Abstract/Free Full Text]
  56. Yu H, Maurer F, Medcalf RL. Plasminogen activator inhibitor type 2: a regulator of monocyte proliferation and differentiation. Blood 2002;99:2810–8.[Abstract/Free Full Text]
  57. Steinman RA, Huang J, Yaroslavskiy B, Goff JP, Ball ED, Nguyen A. Regulation of p21(WAF1) expression during normal myeloid differentiation. Blood 1998;91:4531–42.[Abstract/Free Full Text]
  58. Matikainen S, Lehtonen A, Sareneva T, Julkunen I. Regulation of IRF and STAT gene expression by retinoic acid. Leuk Lymphoma 1998;30:63–71.[Medline]
  59. Andre C, d'Auriol L, Lacombe C, Gisselbrecht S, Galibert F. c-kit mRNA expression in human and murine hematopoietic cell lines. Oncogene 1989;4:1047–9.[Medline]
  60. Galimi F, Cottone E, Vigna E, et al. Hepatocyte growth factor is a regulator of monocyte-macrophage function. J Immunol 2001;166:1241–7.[Abstract/Free Full Text]
  61. Venturelli D, Cesi V, Ransac S, Engelhard A, Perrotti D, Calabretta B. The nucleoside diphosphate kinase activity of DRnm23 is not required for inhibition of differentiation and induction of apoptosis in 32Dcl3 myeloid precursor cells. Exp Cell Res 2000;257:265–71.[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
T. A. Konrad, A. Karger, H. Hackl, I. Schwarzinger, I. Herbacek, and R. Wieser
Inducible expression of EVI1 in human myeloid cells causes phenotypes consistent with its role in myelodysplastic syndromes
J. Leukoc. Biol., October 1, 2009; 86(4): 813 - 822.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. Narayan, M. Eckert, A. Zylicz, M. Zylicz, and K. L. Ball
Cooperative Regulation of the Interferon Regulatory Factor-1 Tumor Suppressor Protein by Core Components of the Molecular Chaperone Machinery
J. Biol. Chem., September 18, 2009; 284(38): 25889 - 25899.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Kroger, A. Stirnweiss, J. E. Pulverer, K. Klages, M. Grashoff, J. Reimann, and H. Hauser
Tumor Suppression by IFN Regulatory Factor-1 Is Mediated by Transcriptional Down-regulation of Cyclin D1
Cancer Res., April 1, 2007; 67(7): 2972 - 2981.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. Petti, A. Molla, C. Vegetti, S. Ferrone, A. Anichini, and M. Sensi
Coexpression of NRASQ61R and BRAFV600E in Human Melanoma Cells Activates Senescence and Increases Susceptibility to Cell-Mediated Cytotoxicity.
Cancer Res., July 1, 2006; 66(13): 6503 - 6511.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
Z. Hao, X. Li, T. Qiao, J. Zhang, X. Shao, and D. Fan
Distribution of CIAPIN1 in Normal Fetal and Adult Human Tissues
J. Histochem. Cytochem., April 1, 2006; 54(4): 417 - 426.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Passioura, T.
Right arrow Articles by Symonds, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Passioura, T.
Right arrow Articles by Symonds, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online