Cancer Research Meeting Calendar Sign up for Cancer Research eTOC's
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ruebel, K. H.
Right arrow Articles by Lloyd, R. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ruebel, K. H.
Right arrow Articles by Lloyd, R. V.
[Cancer Research 65, 1136-1140, February 15, 2005]
© 2005 American Association for Cancer Research

Priority Reports

Effects of DNA Methylation on Galectin-3 Expression in Pituitary Tumors

Katharina H. Ruebel1, Long Jin1, Xiang Qian1, Bernd W. Scheithauer1, Kalman Kovacs2, Nobuki Nakamura1, Heyu Zhang1, Avraham Raz3 and Ricardo V. Lloyd1

1 Department of Pathology, Mayo Clinic College of Medicine, Rochester, Minnesota; 2 Department of Pathology, St. Michael's Hospital, Toronto, Canada; and 3 Department of Pathology and Tumor Progression and Metastasis Program, Karmanos Cancer Institute, Wayne State University School of Medicine, Detroit, Michigan

Requests for reprints: Ricardo V. Lloyd, Department of Pathology and Laboratory Medicine, Mayo Clinic College of Medicine, Rochester, MN 55905. Phone: 507-284-4022; Fax: 507-284-1875; E-mail: lloyd.ricardo{at}mayo.edu.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Galectin-3 (Gal-3), a ß-galactoside-binding protein is expressed in a specific cell–type manner in pituitary tumors. Here we questioned the mechanism of Gal-3 expression in pituitary tumors, by using methylation-specific PCR and DNA sequence analyses to analyze the methylation status of the promoter region of the LGALS3 gene. DNA analysis of a human pituitary tumor, breast carcinoma cell lines, and thyroid carcinoma cell lines showed that in cells expressing Gal-3 protein, the LGALS3 gene was unmethylated, whereas in Gal-3 null cells, the promoter of the LGALS3 gene was methylated. Treatment of cells with 30 µmol/L 5-aza-2'-deoxycytidine induced Gal-3 mRNA and protein expression. Among pituitary tumors, 30% (7/23), mainly in follicle-stimulating hormone/luteinizing hormone–producing (38%) and null cell (57%) adenomas, the promoter of the LGALS3 was found to be methylated and silenced, although prolactin- and adrenocorticotropic hormone–producing tumors, which were unmethylated, expressed the Gal-3 protein. These results show for the first time that Gal-3 expression is regulated in part by promoter methylation in pituitary as well as in other tumors. Because it is functionally involved in cancer progression and metastasis, Gal-3 may serve as a possible therapeutic target in the treatment of pituitary tumors.

Key Words: Galectin-3 • methylation • pituitary tumors • PCR • cell culture


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Galectins are a family of carbohydrate-binding proteins with a high affinity for ß-galactoside (1). Members of the family have specific sequence homologies for specific carbohydrate-binding motifs (1). Although there are at least 14 members of the family that are involved with ß-1,3 galactosylation (2), Galectin-3 (Gal-3) is one of the most frequently investigated members of the group due to its involvement in cancer progression and metastasis (3–8). The human Gal-3 is a 31-kDa chimeric protein with three distinct structural domains including a 12-amino acid NH2-terminal domain that controls cellular targeting, a collagen-like sequence rich in glycine, tyrosine, and proline which functions as a substrate for matrix metalloproteinases, and a carboxyl-terminal domain similar to Galectin-1 with a globular structure containing a carbohydrate-binding site (3). Gal-3 is highly expressed in a variety of human cancers and tumor cell lines including thyroid, breast, colon, pancreas, liver, and kidney (3–6). Gal-3 is involved in diverse biological processes including cell growth, differentiation, cell adhesion, angiogenesis, tumor progression, apoptosis, and metastasis (7, 8). We have recently reported that Gal-3 is expressed in anterior pituitary cells and tumors and its expression was restricted to adrenocorticotropic hormone (ACTH)- and prolactin-producing tumors (9). To examine the mechanisms regulating Gal-3 expression in normal and neoplastic pituitaries, we analyzed the LGALS3 gene (10) for possible genetic and epigenetic alterations including the methylation status of the promoter region. Our results show, for the first time, CpG island methylation in the LGALS3 promoter region of a significant percentage of tumors which did not express Gal-3 protein indicating that epigenetic regulation is important in Gal-3 expression in pituitary tumors.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cell Culture. The following cell lines and culture conditions were used, HP75 pituitary cell line developed in our laboratory (9). MDA-MB468, MDA-MB231 breast carcinoma and the HeLa cell lines obtained from American Type Culture Collection (Manassas, VA). All of these lines were cultured in DMEM with 15% horse serum, 2.5% FCS, and 1% antibiotics (Invitrogen, Carlsbad, CA). SKBR3 breast carcinoma cells (from ATCC) were cultured in McCoy's 5A medium modified with 10% fetal bovine serum (Invitrogen) and maintained at 37°C in a humidified atmosphere of 5% CO2 and 95% air.

The NPA and TPC1 thyroid papillary carcinoma cell lines were obtained from Dr. Yuri Nikiforov at the University of Cincinnati, Cincinnati OH. The TT1 follicular thyroid carcinoma cell line was developed in our laboratory. All three thyroid cell lines were cultured in DMEM with 15% horse and 2.5% FCS (Invitrogen).

The SKBR3 cells were treated with 30 µmol/L 5-aza-2'-deoxycytidine (5-Aza-CdR; Sigma Chemical Company, St. Louis, MO) for 4 and 8 days in three independent experiments. Control dishes received DMEM. Cells were harvested and used for DNA, RNA, protein analysis, and for immunostaining (9, 11) at the end of the experiments.

DNA Preparations. Genomic DNA was extracted from frozen pituitary tissues and cell lines. Tissue was incubated in a solution containing 10 mmol Tris-HCl (pH 7.4), 25 mmol EDTA, and 10 mmol NaCl at 37°C for 30 minutes. Proteinase K (Roche Diagnostics, Almeda, CA) and SDS (Sigma) were added to the solution to a final concentration of 0.2 mg/mL and 0.8%, respectively, and the tissues incubated overnight at 55°C. After incubation, 1 volume phenol/chloroform/isoamyl alcohol (Invitrogen) was added. The solutions were mixed, centrifuged, and the aqueous layer containing the DNA was transferred to a separate tube. One volume of chloroform/isoamyl alcohol (1:1) was then added, and the aqueous layer again removed. Genomic DNA was precipitated by the addition of 2.5 volumes of 100% ethanol (Sigma) and followed by a brief wash in 75% ethanol. DNA samples were resuspended in sterile water, and the concentration was determined by optical densitometry with a spectrophotometer.

Bisulfite Modification. Two micrograms of genomic DNA from each tissue specimen or cell line was bisulfite-modified using the EZ DNA methylation kit (Zymo Research, Orange, CA) according to the manufacturer's instructions. One microgram CPGenome Universally Methylated DNA (Chemicon International, Temecula, CA) was used as a methylated control and 1 µg DNA from the human placenta (Sigma) or HeLa cell was used as the unmethylated control and were treated concurrently with the samples. After treatment, the resulting bisulfite-modified DNA was eluted in 10 µL of the kit elution buffer and stored at –20°C. One microliter of the bisulfite-modified DNA was used for each PCR reaction.

Methylation-Specific PCR. PCR primers were designed using the Oligo-6.61 Primer Analysis Software (Molecular Biology Insights, Inc., Cascade, CO). Primers designed to amplify a 488-bp product within the promoter region of the LGALS3 gene included GGGAATTGCTTTGAGACTAGG (forward) and CGTTGGCTGGCTCCG (reverse). This primer set was used to verify the presence of the Gal-3 within the pituitary DNA samples and for sequencing of the promoter region.

An unmethylated (U) set of primers: GGGAGTGTTATGGAATTTAAT (forward) and CTCCAAACAACTACTAACAAAAA (reverse), and a methylated (M)-specific set of primers: GGAGCGTTACGGAATTTAAC (forward) and TCCGAACGACTACTAACGAAAA (reverse) were designed based on the positive strand of the bisulfite-converted DNA and spanned the region within the promoter's CpG island containing 36 individual CpG sites. Both the U- and M-specific products were located within the 488 bp region amplified by primer set A.

One microliter of bisulfite-modified DNA from each sample was amplified independently using the U- and M-specific primers in a 25 µL total volume reaction. Each PCR reaction contained a final concentration of 0.2 µmol of each primer, 0.2 mmol dNTPs (Roche) 1x Easy-A reaction buffer, 1.25 units of Easy-A high-fidelity PCR cloning enzyme (Stratagene, La Jolla, CA). All PCR reactions were done using a Gene Amp PCR system 9700 thermocycler (Applied Biosystems, Foster City, CA). Ten microliters of each PCR product was run on a 10% Tris-borate EDTA ready gel (Bio-Rad, Hercules, CA) in 1x Tris-borate EDTA for 40 minutes at 200 V. The gel was briefly stained with 0.1 mg/mL ethidium bromide and viewed under UV light.

Controls used for methylation-specific PCR included DNA from placenta as unmethylated DNA control (Sigma) and CpGenome Universal methylated DNA as methylated DNA control (Chemicon International).

Cloning and Sequencing. Two separate PCR reactions were amplified for each case and used for cloning. Both 25 µL PCR reactions were pooled and concentrated using a Microcon YN-100 centrifugal filter device (Millipore, Billerica, MA). The concentrated product was inserted into the pCR 4-TOPO vector and transformed into TOPO-10 chemically competent cells using a TOPO-TA cloning kit for sequencing (Invitrogen) following the manufacturer's instructions. Transformed cells were plated on LB agar containing 50 µg/µL ampicillin (Invitrogen) and incubated overnight at 37°C. Three individual colonies were selected and each inoculated into 5 mL LB broth containing 50 µg/mL ampicillin (Invitrogen) and grown overnight at 37°C. The insert-containing plasmid DNA was then extracted from the cells using the Quia-Prep spin mini-prep kit (Qiagen, Valencia, CA) and resuspended in 30 µL of the included EB buffer. Four microliters of the purified plasmid was combined with 1.6 pmol M-13 reverse primer (Invitrogen) and automatically sequenced using the 3730 XL DNA analyzer (Applied Biosystems). A minimum of three clones were analyzed for each experiment.

Reverse Transcription-PCR Analysis. Total RNA was extracted from pituitary tumors and cell lines as described and used for reverse transcription-PCR. The set of primers for Gal-3 was previously described by Lahm et al. (12): ATGGCAGACAATTTTTCGCTCC (forward) and ATGTCACCAGAAATTCCCAGTT (reverse).

Western Blot. Western blots with antibodies to Gal-3 (Vector Laboratories, Burlingame, CA) and ß-actin (Sigma) were done as previously reported (9). Twenty-five micrograms of protein were used.

Immunohistochemistry. Immunohistochemical staining of the human anterior pituitary tumors for pituitary hormones and Gal-3 were done as previously reported (9). A thyroid papillary carcinoma was used as a positive control and substitution of normal serum for the primary antibody was used as the negative control.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Galectin-3 Methylation and Protein Expression in Cell Lines. Gal-3 expression was examined in a series of cell lines including a human pituitary (HP75), HeLa, three breast carcinoma cell lines (MDA-MB-468, MDA-MB-231, and SKBR3) and three thyroid carcinoma cell lines (PTC-1, NPA, and TT1). All but one of these cell lines expressed Gal-3 protein and the LGALS3 gene promoter region was unmethylated (Fig. 1). The TT1 cell line showed both methylated and unmethylated CpG islands (Fig 1A) and expressed lower levels of Gal-3 protein compared with the other cell lines (Fig 1B). The SKBR3 breast carcinoma cell line did not express Gal-3, and methylation-specific PCR and sequencing showed that the promoter region of the LGALS3 gene in this cell line was methylated. Treatment of SKBR3 cells with 30 µmol/L of 5-Aza-CdR for 4 and 8 days resulted in Gal-3 mRNA and Gal-3 protein expression (Fig. 2). Immunohistochemical staining showed Gal-3-positive cells were absent in the untreated cells, and after treatment with 5-Aza-CdR, 10% to 25% of the cells expressed Gal-3, indicating induction of Gal-3 protein (data not shown).



View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 1. Methylation-specific PCR and Western blotting of cell lines. A, methylation-specific PCR showing the methylation status of various human cell lines. PCR with unmethylated (top) and methylated (bottom) primers are shown. Positive and negative controls were described in Materials and Methods. B, Western blot of various cell lines corresponding to the PCR samples in A showing expression of Gal-3 protein in unmethylated samples. ß-Actin was used to check for equal loading of the gel.

 


View larger version (43K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 2. Analysis of SKBR3 breast carcinoma cell line by reverse transcription-PCR and Western blotting. A, reverse transcription-PCR analysis shows that 30 µmol/L 5-Aza-CdR treatment for 4 and 8 days led to expression of Gal-3 mRNA in the SKBR3 cells. B, Western blot shows that the untreated SKBR3 cells did not express Gal-3 (left), although treatment with 30 µmol/L 5-Aza-CdR for 4 and 8 days results in Gal-3 expression. The HeLa cell line was used as a positive control. ß-Actin was used to check for equal loading of the gel.

 
Methylation-specific PCR and Gal-3 Protein Expression in Pituitary Tumors. Methylation-specific PCR using specific primers showed that normal pituitary and, prolactin-, growth hormone (GH)- and ACTH-producing tumors were unmethylated as determined after methylation-specific PCR followed by cloning and sequencing. Overall, 30% (7/23) of the pituitary tumors were methylated, whereas 38% of the follicle-stimulating hormone/luteinizing hormone (FSH/LH)–producing and 57% of the null cell adenomas were methylated in the LGALS3 promoter region (Table 1; Fig. 3A).


View this table:
[in this window]
[in a new window]

  		Table 1. Analysis of Normal and Neoplastic Pituitaries for Gal-3 Methylation and Protein Expression

 


View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 3. Methylation-specific PCR, Western blotting, and DNA sequencing in pituitary tumors. A, methylation-specific PCR showing the methylation status of normal and neoplastic pituitary tissues and a human pituitary cell line (HP75) with unmethylated primers (top) and methylated (bottom) primers. B, Western blot of normal and neoplastic pituitary tissues and cell line showing expression of Gal-3 protein in normal pituitary and prolactin- and ACTH-producing tumors, whereas the FSH/LH-producing and null cell adenomas are negative. C, methylation status and relative distribution of the 36 CpG sites located in the promoter region of the human Gal-3 gene from –237 upstream to +38 downstream. Three pituitary samples include (A) normal pituitary, (B) ACTH-producing carcinoma, and (C) null cell adenoma. Methylated CpG sites ({bullet}); unmethylated CpG sites ({circ}); start of exon 1 (->).

 
Immunohistochemical analysis revealed that Gal-3 was expressed in a subset of cells in the normal anterior pituitary (data not shown). Adenomas producing prolactin and ACTH were positive for Gal-3, whereas adenomas producing FSH/LH, GH, and most null cell adenomas were negative for Gal-3 (Table 1). Western blotting supported the immunohistochemical findings (Fig. 3B). There was some variation in the amount of Gal-3 protein expression in the two prolactin adenomas shown, although both adenomas were unmethylated in the LGALS3 promoter region (Fig. 3A and B). Sequencing showed that the percentage of the total of 36 cytosine sites that were methylated ranged from 67% to 93% (mean of 84%) for the FSH/LH-producing adenomas, and from 10% to 93% (mean of 46%) for null cell adenomas (Fig. 3C).

Amplification of a 488 bp fragment in the promoter region of the LGALS3 gene did not show any mutations in this region in a normal pituitary, in a null cell adenoma, and in an ACTH-producing carcinoma (data not shown). Reverse transcription-PCR analysis and sequencing of the amplified product of total RNA from a normal pituitary and in an ACTH-producing carcinoma did not show any mutations in the coding regions of the LGALS3 gene (data not shown).


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Galectins are involved in many biological processes including cell growth, adhesion, apoptosis, tumor progression, and metastasis (3, 7, 8). Gal-3 is expressed in many human tumors and cell lines (4–8). We recently observed a differential expression of Gal-3 in pituitary tumors (9); however, the mechanisms regulating Gal-3 gene expression in these tumors is still unknown.

In the present study, we show for the first time that Gal-3 expression in cell lines and in pituitary tumors is related to the promoter methylation status of the LGALS3 gene. These findings help to explain the observed differential expression of Gal-3 protein in pituitary tumors (9). However, promoter methylation (13) is probably not the only factor regulating Gal-3 protein expression in pituitary tumors, because some FSH/LH-producing and null cell tumors were unmethylated and did not express Gal-3 protein. Similarly, the two GH-producing adenomas which did not express Gal-3 proteins were unmethylated. These observations suggest that additional mechanisms such as histone acetylation may also contribute to the expression of Gal-3 in pituitary as well as other tumors. Our preliminary experiments using sodium butyrate to treat the SKBR3 and other methylated cell lines did not increase the level of Gal-3 expression compared with 5-Aza-CdR (data not shown). However, the role of promoter methylation in regulating Gal-3 mRNA and protein expression was shown by treatment of the Gal-3 null SKBR3 breast carcinoma cell line, which did not express Gal-3 mRNA or protein, with 5' Aza-CdR which induced Gal-3 expression in these cells.

Recent studies of other members of the galectin family including galectin-1 and galectin-7 suggest that methylation is important for the regulation of galectin expression (14–16). Benvenuto et al. (14) used restriction endonucleases and sodium bisulfite analysis of genomic DNA from expressing and unexpressing cell lines to show a correlation between gene activity and demethylation of the 5' region of the LGALS-1 gene. Moisan et al. (15) recently showed that treatment of nonaggressive lymphomas with 5-Aza CdR–induced galectin-7 gene expression. Arar et al. (16) observed that both expressing (RB-1) and nonexpressing (RCMV-5) cell lines were able to activate a reporter cell gene under the control of the regulatory gene of the LGALS3 gene in transfection experiments. It was suggested that this phenomenon was the result of a repressor acting on a genomic region not present in the reporter plasmid or by DNA methylation (16). Our own data shows, for the first time, that DNA methylation is involved in the regulation of Gal-3 expression in at least some pituitary tumors, in breast carcinoma, and in thyroid carcinoma cell lines.

Our current findings provide further insight into earlier observations that Gal-3 was differentially expressed in pituitary tumors (9). The nonfunctional tumors including FSH/LH and null cell adenomas which did not express Gal-3 proteins were frequently methylated, whereas the functional prolactin- and ACTH-producing tumors which expressed Gal-3 were unmethylated. In addition to its role as an antiapoptotic molecule (8), Gal-3 has a critical role in tumor progression and metastasis. Interestingly, the two main subtypes of pituitary tumors expressing Gal-3 are the ones associated with pituitary carcinomas, which are aggressive neuroendocrine tumors (17). These findings suggest that the expression of Gal-3 in prolactin- and ACTH-producing pituitary tumors may be associated with progression to carcinomas in association with other genetic alterations in these tumors (18), because prolactin- and ACTH-producing carcinomas constitute the majority of reported pituitary carcinomas (17).

An increasing number of studies have shown that epigenetic changes with DNA methylation probably have an important role in pituitary tumorigenesis (18, 19). These genes have included INK4A (p16), GADD45-{gamma}, RB1, DAPK, and others such as KIP1 (p27; refs. 18, 19 ). One unique aspect of LGALS3 promoter methylation in the pituitary which differs from the model of Herman and Baylin (13) is that the normal pituitary prolactin- and ACTH-producing cells also expressed Gal-3, indicating maintenance of cell and tumor type specificity in the expression of this gene product in pituitary adenomas and carcinomas. In addition to abnormal epigenetic methylation, which is observed as a pathologic process (13), methylation in endocrine tissues has also been observed as a physiologic regulatory process. For example, during the regulation of the hormonal control of prolactin and GH gene expression in rat pituitary gland during gestation and lactation, there are changes in the expression of prolactin and GH gene by altered methylation patterns (20). Because Gal-3 has a role in tumor progression and metastasis, the expression of Gal-3 in these cell types probably contribute, along with other genetic alterations, to the progression to pituitary carcinomas.

In summary, this study shows that cell specific expression of Gal-3 in various human tumor cell lines and in pituitary tumors is regulated by DNA methylation of the promoter region. It is possible that because of Gal-3 expression and function in tumor progression and metastases, the unmethylated state of some pituitary tumors may contribute to the higher incidence of pituitary carcinomas observed in functional (prolactin- and ACTH-producing) tumors. These results suggest that because it is functionally involved in cancer progression and metastasis, Gal-3 may serve as a possible therapeutic target in the treatment of pituitary tumors.


   Acknowledgments
 
Grant support: Supported in part by NIH Grant CA90249 (R.V. Lloyd) and NIH Grant CA46120 (A. Raz).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The authors thank the National Pituitary Agency (Bethesda, MD) for the pituitary hormone antibodies, Dr. Yuri Nikiforov, University of Cincinnati for the NPA and TPC1 cell lines, and Shuya Zhang for technical assistance.

Received 10/18/04. Revised 11/ 3/04. Accepted 11/21/04.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Barondes SH, Cooper DN, Gitt MA, Leffler H. Galectins. Structure and function of a large family of animal lectins. J Biol Chem 1994;269:20807–10.[Free Full Text]
  2. Amado M, Almeida R, Schwientek T, Clausen H. Identification and characterization of large galactosyltransferase gene families: galactosyltransferases for all functions. Biochim Biophys Acta 1999;1473:35–53.[Medline]
  3. Gong HC, Honjo Y, Nangia-Makker P, et al. The NH2 terminus of galectin-3 governs cellular compartmentalization and functions in cancer cells. Cancer Res 1999;59:6239–45.[Abstract/Free Full Text]
  4. Honjo Y, Inohara H, Akahani S, et al. Expression of cytoplasmic galectin-3 as a prognostic marker in tongue carcinoma. Clin Cancer Res 2000;6:4635–40.[Abstract/Free Full Text]
  5. Francois C, van Velthoven R, De Lathouwer O, et al. Galectin-1 and galectin-3 binding pattern expression in renal cell carcinomas. Am J Clin Pathol 1999;112:194–203.[Medline]
  6. Xu XC, el-Naggar AK, Lotan R. Differential expression of galectin-1 and galectin-3 in thyroid tumors. Potential diagnostic implications. Am J Pathol 1995;147:815–22.[Abstract]
  7. Inohara H, Akahani S, Koths K, Raz A. Interactions between galectin-3 and Mac-2-binding protein mediate cell-cell adhesion. Cancer Res 1996;56:4530–4.[Abstract/Free Full Text]
  8. Yoshii T, Fukumori T, Honjo Y, Inohara H, Kim HR, Raz A. Galectin-3 phosphorylation is required for its anti-apoptotic function and cell cycle arrest. J Biol Chem 2002;277:6852–7.[Abstract/Free Full Text]
  9. Riss D, Jin L, Qian X, et al. Differential expression of galectin-3 in pituitary tumors. Cancer Res 2003;63:2251–5.[Abstract/Free Full Text]
  10. Kadrofske MM, Openo KP, Wang JL. The human LGALS3 (galectin-3) gene: determination of the gene structure and functional characterization of the promoter. Arch Biochem Biophys 1998;349:7–20.[CrossRef][Medline]
  11. Jin L, Qian X, Kulig E, et al. Transforming growth factor-ß, transforming growth factor-ß receptor II, and p27Kip1 expression in nontumorous and neoplastic human pituitaries. Am J Pathol 1997;151:509–19.[Abstract]
  12. Lahm H, Andre S, Hoeflich A, et al. Comprehensive galectin fingerprinting in a panel of 61 human tumor cell lines by RT-PCR and its implications for diagnostic and therapeutic procedures. J Cancer Res Clin Oncol 2001;127:375–86.[CrossRef][Medline]
  13. Herman JG, Baylin SB. Gene silencing in cancer in association with promoter hypermethylation. N Engl J Med 2003;349:2042–54.[Free Full Text]
  14. Benvenuto G, Carpentieri ML, Salvatore P, Cindolo L, Bruni CB, Chiariotti L. Cell-specific transcriptional regulation and reactivation of galectin-1 gene expression are controlled by DNA methylation of the promoter region. Mol Cell Biol 1996;16:2736–43.[Abstract]
  15. Moisan S, Demers M, Mercier J, Magnaldo T, Potworowski EF, St-Pierre Y. Upregulation of galectin-7 in murine lymphoma cells is associated with progression toward an aggressive phenotype. Leukemia 2003;17:751–9.[CrossRef][Medline]
  16. Arar C, Gaudin JC, Capron L, Legrand A. Galectin-3 gene (LGALS3) expression in experimental atherosclerosis and cultured smooth muscle cells. FEBS Lett 1998;430:307–11.[CrossRef][Medline]
  17. Pernicone PJ, Scheithauer BW, Sebo TJ, et al. Pituitary carcinoma: a clinicopathologic study of 15 cases. Cancer 1997;79:804–12.[CrossRef][Medline]
  18. Lloyd RV. Molecular pathology of pituitary adenomas. J Neurooncol 2001;54:111–9.[CrossRef][Medline]
  19. Farrell WE, Clayton RN. Epigenetic change in pituitary tumorigenesis. Endocr Relat Cancer 2003;10:323–30.[Abstract]
  20. Kumar V, Biswas DK. Dynamic state of site-specific DNA methylation concurrent to altered prolactin and growth hormone gene expression in the pituitary gland of pregnant and lactating rats. J Biol Chem 1988;263:12645–52.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 GlycobiologyHome page
N. Miyanishi, N. Nishi, H. Abe, Y. Kashio, R. Shinonaga, S.-i. Nakakita, W. Sumiyoshi, A. Yamauchi, T. Nakamura, M. Hirashima, et al.
Carbohydrate-recognition domains of galectin-9 are involved in intermolecular interaction with galectin-9 itself and other members of the galectin family
Glycobiology, April 1, 2007; 17(4): 423 - 432.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ruebel, K. H.
Right arrow Articles by Lloyd, R. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ruebel, K. H.
Right arrow Articles by Lloyd, R. V.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online