
[Cancer Research 65, 1150-1157, February 15, 2005]
© 2005 American Association for Cancer Research
Molecular Biology, Pathobiology and Genetics |
Differential Expression of Cell Cycle Regulators in Phenotypic Variants of Transgenically Induced Bladder Tumors: Implications for Tumor Behavior
Antonio Garcia-España1,7,
Edgard Salazar1,
Tung-Tien Sun2,3,4,
Xue-Ru Wu4,5,6 and
Angel Pellicer1
Departments of 1 Pathology, 2 Dermatology, 3 Pharmacology, 4 Urology, and 5 Microbiology, New York University Cancer Institute; and 6 Veterans Affairs Medical Center in Manhattan, New York, New York; and 7 Unitat de Recerca, University Hospital Joan XXIII, Universitat Rovira i Virgili, Tarragona, Spain
Requests for reprints: Angel Pellicer, Department of Pathology MSB594, New York University School of Medicine, 550 First Avenue, New York, NY 10016. Phone: 212-263-5342; Fax: 212-263-8211; E-mail: pellia01{at}med.nyu.edu.
 |
Abstract
|
|---|
Proteins controlling cell growth, differentiation, apoptosis, and oncogenic stress are often deregulated in tumor cells. However, whether such deregulations affect tumor behavior remains poorly understood in many tumor types. We recently showed that the urothelium-specific expression of activated H-ras and SV40 T antigen in transgenic mice produced two distinctive types of tumors strongly resembling the human superficial papillary tumors and carcinoma in situ of the bladder, respectively. Here we assessed the expression of a key set of cell cycle regulators in these mouse tumors and in a new transgenic line expressing a cyclin D1 oncogene in the urothelium. We found that urothelia of the wild-type and cyclin D1 transgenic mice exhibited a profile of cell cycle regulators found in quiescent (G0) cells, indicating that urothelium overexpressing the cyclin D1 (an 8-fold increase) is reminiscent of normal urothelium and remains slow-cycling. Low-grade superficial papillary tumors induced by activated H-ras had no detectable Rb family proteins (Rb, p107, and p130) and late cell cycle cyclins and kinases (cyclin A, E, and CDK1), but had increased level of p16, p53, and MDM2. These data suggest that the inactivation of the Rb pathway plays an important role in H-ras-induced superficial papillary tumors and that oncogenic H-ras can induce a compensatory activation of alternative tumor suppressor pathways. In contrast, carcinoma in situ of the bladder induced by SV40 T antigen had increased expression of cell cycle regulators mainly active in post-G1 phases. The fact that phenotypically different bladder tumors exhibit different patterns of cell cycle regulators may explain why these tumors have different propensity to progress to invasive tumors. Our results indicate that the transgenic mouse models can be used not only for studying tumorigenesis but also for evaluating therapeutic strategies that target specific cell cycle regulators.
Key Words: bladder cancer transgenic mice H-ras SV40 large T antigen cyclin D1
 |
Introduction
|
|---|
Bladder cancer is a very common malignancy, afflicting more than 2 million people on a global scale. In the United States, it ranks as the fifth most frequent neoplasm with about 54,000 new cases diagnosed annually (1). In the developed countries where schistosomiasis is not a problem, bladder neoplasias are predominately of the transitional cell carcinoma type, which is heterogeneous, exhibiting various histologic morphologies and biological behaviors (24). Seventy percent to 80% of transitional cell carcinomas present as low-grade, superficial papillary tumors that frequently recur, but rarely progress to the muscle-invasive stage. By contrast, the remaining 20% to 30% had muscle invasion at diagnosis, and they carry a high risk of spreading locally as well as advancing to incurable metastatic stage. It has been suggested that different genetic alterations underlie these different biological behaviors, although direct experimental evidence is lacking. Therefore, an improved understanding of the molecular basis underlying bladder tumor pathways is of clear importance in helping to better predict bladder tumor progression and devise optimal management strategies for different transitional cell carcinomas.
The identification of the urothelium-specific uroplakin II promoter (5) has made it possible to express specific oncogenes in the urothelium of transgenic mice. Mice expressing a constitutively activated H-ras oncogene developed urothelial hyperplasia and low-grade superficial papillary tumors (6). In contrast, mice expressing an SV40 T antigen, which functionally inactivates the p53 and pRb tumor suppressors, developed carcinoma in situ (CIS) and invasive bladder tumors (7), a finding also supported by the transgenic expression of SV40 T antigen in the urothelium driven by the cytokeratin 19 gene regulatory elements (8). These results provided direct experimental evidence supporting the notion that phenotypically different bladder tumors are caused by different genetic defects.
To further characterize the molecular events underlying urothelial tumorigenesis, we have generated transgenic mouse lines expressing cyclin D1, an oncogene that is amplified and/or overexpressed in about 20% of human bladder tumors (3). We have analyzed the molecular alterations elicited by the urothelial expression of cyclin D1, and compared those with mice expressing an activated H-ras or an SV40 T antigen. We found that the normal mouse urothelium exhibits the molecular characteristics of a quiescent tissue consistent with the known slow turnover of the epithelium (9, 10) . Overexpression of a wild-type cyclin D1 correlates with increased levels of the cell cycle inhibitors p21 and p27 with no noticeable morphologic abnormality in the urothelium. In urothelial hyperplasia and low-grade superficial papillary tumors induced by the activated H-ras oncogene, there is a dramatic reduction of Rb family proteins. This is accompanied by an induction of the cell cycle inhibitor p16 and of p53 and MDM2 only in low-grade superficial papillary tumors but not in hyperplasia. In contrast, in CIS lesions induced by the SV40 T antigen, there is a specific increase of cell cycle regulators commonly affecting the post-G1 phases of the cell cycle. These changes in cell cycle regulators strongly resemble those occurring in human bladder cancers and may provide a molecular explanation as to why the two distinctive variants of bladder tumors have different propensity to progress (11).
 |
Materials and Methods
|
|---|
Generation of UPII-cyclin D1 Transgenic Mice. The mouse uroplakin II promoter was used to drive the urothelium-specific overexpression of the wild-type cyclin D1. Briefly, a 1.9-kb full-length human cyclin D1 cDNA coding region plus SV40 small tumor antigen intron and poly A signal was released from pXcycD1 (12) and inserted downstream of the 3.6-kb mouse UPII promoter that was previously cloned into pBluescript (5). The orientation of the chimeric gene was confirmed by restriction digestions and DNA sequencing. The UPII-CD1 chimeric gene was excised from pBluescript by digestion with KpnI-BamHI, purified by agarose gel electrophoresis, dialysis, phenol/chloroform extraction and filtration through 0.22-µm filters before being injected into fertilized eggs of FVB/N inbred mice for transgenic mice production.
Southern Blot Analysis. Transgenic mice were identified by Southern blot analysis of the genomic DNA isolated from the mouse tail biopsies. DNA was digested with NcoI, resolved by gel electrophoresis, and hybridized with a 550-bp BamHI-StuI fragment located at the 3' end of the mouse UPII promoter, which allowed the detection of both the endogenous UPII gene and UPII-CD1 transgene.
Northern Blot Analysis. The urothelia from six bladders of each different cyclin D1 transgenic line were processed for total RNA extraction with Trizol. The RNA was resolved by agarose-formaldehyde gel (15-20 µg/lane), transferred onto nylon membrane, and probed for cyclin D1 expression with an SV40 3' untranslated region cDNA probe.
Reverse TranscriptionPCR. Trizol extracts of urothelial RNA were treated with DNAase, reverse transcribed, and subjected to PCR using primers designed to flank the small SV40 intron (66 bp) in the 3' untranslated region of the UPII-cyclin D1 construct. The sense and antisense primers were GAGATGTCTCTAAATTTCGAGA and CTACCGTAAAGAAGACTCGT. These primers yielded two PCR products that differ between spliced UPII-cyclin D1 cDNA (115 bp) and contaminating genomic (181 bp) cyclin D1 transgene. The PCR conditions were 30 cycles of 93°C for 30 seconds, 72°C for 45 seconds, and 58°C for 45 seconds.
Histopathology. Mouse bladders were fixed in 10% buffered formalin and embedded in paraffin. Sections (3-5 µm) were stained with H&E and examined microscopically for pathologic changes.
Preparation of Urothelial Proteins and Western Blotting. Urothelial cells were scraped from the normal mouse bladder mucosa and the various tumor lesions of the transgenic mice with a clinical spatula as described (13). The cells were collected by centrifugation and lysed in a buffer containing 25 mmol/L Tris-HCl, 2 mmol/L EDTA, and 2% SDS. Lysates were quickly frozen and thawed thrice, sonicated, and centrifuged at 10,000 x g for 10 minutes. Soluble proteins were quantitated by the bichinconic acid method (Pierce, Rockford, IL). Lysates were brought to 3 µg/µL with concentrated sample loading buffer, stored in aliquots, and kept at 80°C.
The lysates (30-45 µg of the total protein) were resolved by 7.5%, 10%, or 15% SDS-PAGE and transferred onto nitrocellulose membranes. After the membranes were reversibly stained with 0.1% Ponceau Red solution, they were blocked with 3% nonfat dry milk dissolved in TBST solution (10 mmol/L Tris-HCl, pH 7.5, 100 mmol/L NaCl, and 0.1% Tween 20) and incubated for 1 hour at room temperature with the primary antibodies in TBST with 1% nonfat dry milk [the antibodies were diluted 1:100, except for p53, p53 Ser15-P, MDM2 and CDK4 (1:200); cyclin D1, CDK1, cyclin A, and cyclin E (1:500); and Erk1,2 (1:5000)]. After washing in TBST solution, the secondary antibodies, diluted in 1% nonfat dry milk in TBST, were added for 1 hour at room temperature. The membranes were rinsed four times with water and twice with TBST before being developed by an enhanced chemiluminescence detection system (ECL, Pierce) according to the manufacturer's instructions. West Pico reagent was used for highly expressed proteins, whereas the West Femto reagent was used to detect low-level proteins. The antibodies were optimized with cell line extracts and/or recombinant proteins. The antibodies were obtained from the following vendors: proliferating cell nuclear antigen (PCNA; Signal Transduction, Toms River, NJ), Cdk1 (ABCAM, Cambridge, United Kingdom), Erk1,2 (Promega, Madison, WI), p16 (Upstate Biotechnology, Lake Placid, NY), p53 and P53 Ser15-P (Oncogene Research Products, Boston, MA), and Rb, p21, and p27 (BD PharMingen, San Diego, CA). All other antibodies were obtained from Santa Cruz Biotechnology (Berkeley, CA). Cyclin D1 protein expression was quantified by densitometry using NIH image 1.63 software (Bethesda, MD).
 |
Results
|
|---|
Urothelial Overexpression of Cyclin D1 Induced p21, p27, and PCNA. Although amplification and overexpression of the cyclin D1 gene was found in about 20% of human bladder tumors, little is known about the potential of cyclin D1 in transforming urothelial cells in vivo. (3). To address this issue, we generated transgenic mouse lines in which the cyclin D1 expression was driven by the well-characterized urothelium-specific promoter of the UPII gene (Fig. 1A; refs. 57). Four independent transgenic mouse lines were obtained (Fig. 1B) expressing the cyclin D1 transgene in urothelia as evidenced by reverse transcriptionPCR (RT-PCR; Fig. 1C), Northern blotting (Fig. 1D), and Western blotting (Fig. 1E). The level of cyclin D1 protein in transgenic lines B and D was 7.5 ± 1.8- and 8.1 ± 1.5-fold higher, respectively, than that in nontransgenic urothelium (Fig. 1F).

View larger version (29K):
[in this window]
[in a new window]
|
Figure 1. Generation and characterization of UPII/cyclin D1 transgenic mice. A, a chimeric gene consisting of the 3.6-kb UPII promoter, the human cyclin D1 cDNA, and the SV40 large T antigen small intron and polyadenylation signal. P, probe for Southern blotting. R and F, PCR primers B, Southern blot analysis. Genomic DNA from the tail of F1 mice was hybridized with a probe located at the 3'end of the UPII promoter (P in A). The probe detected the endogenous UPII gene fragment (1.4 kb) and a predicted transgenic fragment of 1.1 kb. wt, wild-type. C, RT-PCR. Gel lines 1 to 4 (A, B, C, D, transgenic urotheliums), gel line 5 (nontransgenic urothelium), gel line 6 (positive controls; UPII-cyclinD1 construct plasmid in top and UPII cDNA plasmid in bottom), and gel line 7 (no RNA). Arrow, PCR product that corresponds to the spliced UPII-cyclin D1 transgenic construct mRNA. Top bands are generated by the control plasmid (line 6) and unspliced and/or contaminating genomic transgenic UPII-cyclin D1 DNA (lines 1 to 4). D, Northern blot analysis of total RNA from isolated mouse urothelia. Top, transgenic cyclin D1 mRNA expression. Middle, for control of RNA quality the same blot was hybridized with a uroplakin II cDNA probe. Bottom, ethidum bromide staining of 28S rRNA. E, Western blot analysis of the expression of cyclin D1 in the urothelium of different transgenic lines. Increased cyclin D1 protein expression could be observed in the transgenic urothelium. Erk2 protein expression was used as a loading control. A, B, C, and D, different transgenic lines. F, cyclin D1 protein overexpression in transgenic lines B and D. Columns, mean fold increase in cyclin D1 expression in transgenic urothelium relative to cyclin D1 protein expression in normal urothelium (7.5 ± 1.8- and 8.1 ± 1.5-fold increase in transgenic lines B and D, respectively; n = 4); bars, SE.
|
|
Although cyclin D1 was suspected to be a growth-promoting oncogene in urothelial tumorigenesis, continued expression (up to 48 months) of this gene alone in transgenic mice did not produce any morphologic abnormalities in the urothelium (Fig. 2). At the molecular level, however, urothelia of the transgenic mice, but not nontransgenic controls, overexpressed the PCNA, a hyperproliferative marker (14). This suggests that whereas the urothelial cells had acquired the proliferative potential as a result of cyclin D1 overexpression, such an effect was only marginal and was insufficient to promote urothelial hyperplasia. Alternatively, compensatory mechanism(s) may be present in curtailing the growth-promoting effect of cyclin D1. Indeed, p21 and p27, two important cell cycle inhibitors preventing the G1-S transition (15), were overexpressed in transgenic mice (Fig. 3A).

View larger version (140K):
[in this window]
[in a new window]
|
Figure 2. Phenotypic alterations of transgenic mice expressing various transgenes. A, cross section of the bladder of a 24-month-old nontransgenic mouse showing normal histology. B, urothelium of a 24-month-old cyclin D1 transgenic mouse (line B) also showing normal histology. C, urothelial hyperplasia in a 6-month-old H-ras transgenic mouse. D, low-grade superficial papillary bladder tumor in a 16-month-old H-ras mouse. E, CIS in a 5-month-old SV40 T antigen mouse. F, high-grade bladder carcinoma in a 15-month-old SV40 T antigen transgenic mouse. Magnifications x100 (A and B); x200 (C, D, E, and F).
|
|

View larger version (32K):
[in this window]
[in a new window]
|
Figure 3. Western blot analysis of total urothelial proteins from wild-type mice (wt) and cyclin D1 transgenic lines. A, protein levels of early G1 cell cycle proteins: cyclin D1, p21, p27, PCNA, and CDK4 from urothelia of transgenic lines B and D (blot lines 1 and 2 and 3 and 4, respectively; 45 µg of protein). Blot lines 1 and 3, protein from 15-month-old animals; lines 2 and 4, protein from 9-month-old animals; wild-type mice (blot lines 5 to 8; protein in lines 5 to 8 was from mice at 9, 6, 15, and 2 months old, respectively). Line 9 was loaded with 20 µg of total lysate from the cell line NIH-3T3 as a control for expression levels. B, levels of late G1 and S phase cell cycle proteins CDK2, CDK1, cyclin A, and cyclin E. Line 5, 20 µg of NIH-3T3 lysate. C, protein levels and phosphorylation status of the Rb protein family, Rb, p107, and p130 (45 µg). Lines 8 and 9, 20-µg lysates of NIH-3T3 cells untransfected or transfected (line 8) with the H-ras oncogene as control for the phosphorylation of Rb proteins.
|
|
Absence of Rb Family Proteins in H-ras Induced Urothelial Hyperplasia and Superficial Papillary Tumors. The urothelium is among the slowest cycling epithelia, with a labeling index of 0.02% to 0.05% and a turnover rate of about 6 months (9, 10, 16). Consistent with this notion, Rb family proteins, including Rb, p107, and p130, were all in a hypophosphorylated state, thus preventing the cell from progressing through the cell cycle. Of these, p107 remained at a low level (Fig. 3C). In addition, cyclin-dependent kinases of early G1 phase, such as CDK4 and CDK2, were readily detectable, whereas cell cycle proteins of later G1 and S phase, such as CDK1, cyclin E, and cyclin A, were absent (Fig. 3A and B). These results indicate that normal urothelial cells are nonproliferating.
In contrast to the normal urothelium in which Rb family proteins were readily detectable, these proteins were largely undetectable in the urothelia of H-ras transgenic mice (Fig. 4C). Only a residual amount of hypophosphorylated p107 could be detected in two urothelial lesions (Fig. 4C; Table 1). The lack of protein detection was not due to inefficient nuclear protein extraction because histone deacetylase 3, another nuclear protein, was readily detected (Fig. 4C). Other significant alterations in cell cycle regulators included the overexpression of p16 and p53, two important tumor suppressor proteins, and overexpression of MDM2, CDK4, and CDK2 (Fig. 4A and B). In general, although there was an increased expression of growth-promoting cell cycle regulators, this increase was accompanied by an overexpression of cell cycle inhibitors, indicative of a low proliferative status of the urothelia in H-ras transgenic mice.

View larger version (39K):
[in this window]
[in a new window]
|
Figure 4. Western blot analysis from SV40 T antigen and H-ras transgenic mice with urothelial hyperplasia and tumors. A, levels of early and late cell cycle proteins cyclin D1, cyclin E, cyclin A, PCNA, CDK 4, CDK 2, CDK 1, p27, and p21. Lanes 1 and 2, SV40 T antigen high-grade superficial tumors from 13-month-old SV40 T antigen mice (30 µg). Lane 3, SV40 T antigeninduced CIS from an SV40 T mouse of 11.5 months (30 µg). Lane 4, wild-type mice (30 µg). Lane 5, H-ras induced hyperplastic urothelia; lanes 6 and 7, H-ras induced papillary tumors (30 µg). Lanes 8 and 9, 15 µg of NIH-3T3 and NIH-3T3 H-ras lysate. B, tumor suppressor proteins p53 and p16 (30 µg). Lanes 1 to 7 as in A. Lane 8, NIH-3T3 lysate (15 µg). C, protein levels and phosphorylation status of the Rb protein family, Rb, p107, and p130. Lanes 1 to 7 as in A (30 µg). Lanes 8 and 9, lysates of NIH-3T3 cells untransfected or transfected (line 8) with the H-ras oncogene as control for phosphorylation (15 µg).
|
|
Marked Increase of Cyclins and CDKs in SV40 TInduced Bladder Carcinoma In situ Carcinoma in situ of the bladder induced by SV40 large T antigen had a dramatic increase in post-G1 cell cycle regulators including cyclin A and E and CDKs 1 and 2, whereas the G1 phase protein cyclin D1 was down-regulated (Fig. 4A; Table 1). Cell cycle inhibitors p21, p27, and p16 were up-regulated (Fig. 3A and B; Table 1). SV40 large T antigen binds and inactivates p53 and the Rb family of proteins (17, 18). Accumulation of p53 without induction of MDM2 (Fig. 4B) is consistent with p53 being inactivated by the SV40 T antigen. In addition, p53 was phosphorylated at Ser15 (Fig. 4B), indicative of DNA damage (19, 20), and perhaps reflecting the fact that SV40 Tinduced tumors are genomically unstable (21). The expression level and phosphorylation status of the Rb family proteins in SV40 Tinduced tumors were consistent with what occurs in a highly proliferating tissue. Moreover, these molecular changes were reminiscent of the changes that the SV40 oncogene produces in other tissues (22). The only exception was the significant increase of hyperphosphorylated p107 in SV40 Tinduced bladder tumors (Fig. 4C).
 |
Discussion
|
|---|
Cyclin D1 Overexpression in Urothelium Up-regulates CIP/KIP Proteins p21 and p27. As a central target of mitogenic signals, cyclin D1 is frequently overexpressed in a variety of human cancers, particularly during the early stages of tumorigenesis (23). Bladder cancer is no exception as up to 20% of the cases have increased expression of cyclin D1 (3, 24). Overexpressing cyclin D1 in various tissues of transgenic models, however, have yielded a mixed outcome. For instance, overexpression of cyclin D1 in mammary epithelium resulted in mammary adenocarcinoma (25). The overexpression of cyclin D1 in both hepatocytes and enterocytes, under the control of the rat liver fatty acidbinding protein promoter, produced hepatocellular carcinomas but did not produce any detectable abnormality in the intestinal epithelium (26). Driven by the keratin 5 promoter, cyclin D1 induced epidermal hyperproliferation and thymic hyperplasia (27, 28). When expressed under the control of the EBV promoter, cyclin D1 caused dysplasia in stratified squamous epithelia of the tongue, esophagus, and forestomach (29, 30). When targeted to B lymphocytes, despite abundant transgene expression, lymphocytes were normal in cell cycle activity, size, and mitogenic responsiveness (31, 32). On the other hand, mice lacking the cyclin D1 gene have specific alterations in mammary epithelial proliferation (33, 34), most likely because cyclin D1 functions as an important mitogen and as a coactivator for the estrogen receptor (35). It is also noteworthy that in hepatocytes, cyclin D1 expression is sufficient to promote hepatocellular cell cycle progression in the absence of mitogens (36, 37). With the exception of mammary gland and hepatocytes, overexpression of cyclin D1 in other tissues, including the urothelium (Fig. 3), failed to produce frank epithelial tumors. These results indicate that the hyperproliferative responses to cyclin D1 overexpression are cell type specific.
The lack of urothelial tumor formation in the face of cyclin D1 overexpression could be due to a compensatory induction of the cell cycle inhibitors p21 and p27. It seems that the overexpression of PCNA alone, an auxiliary factor for DNA polymerases
and
during DNA replication and repair (3840), is inadequate to drive urothelial cells into the S phase. Our data indicate that there was a lack of hyperphosphorylated Rb and cyclin E expression suggesting that the CDK4/cyclin D1 complex is inactive. This situation is analogous to that of hepatocytes in which transient expression of cyclin D1 promoted hepatocyte proliferation only during the first few days and the proliferative effect disappeared afterward. The concomitant induction of p21 and p27 proteins suggests that endogenous antiproliferative mechanisms might have come into play, which effectively curtailed cells from undergoing uncontrolled proliferation (37).
Cell Cycle Status of Normal Urothelial Cells. Commensurate with its physiologic requirement as a permeability barrier, normal urothelium has an exceedingly low renewal rate, with a tritium-thymidine labeling index of only 0.02% to 0.05% and a turnover rate of about 200 days (16). This means that under normal conditions, most urothelial cells are not cycling or are quiescent. It is well known that the phosphorylation status of the pRb family proteins is key to regulating cell cycle progression in normal cells as well as in tumors. In the G0 phase of normal resting cells, pRb and p107, when detectable, are found in the hypophosphorylated state, whereas p130 exists in two differently phosphorylated forms (i.e., p130 forms 1 and 2; refs. 41, 42). Our results on both the level of expression and phosphorylation status of the Rb family proteins (Fig. 3C) establish in molecular terms that normal urothelium is in a G0 resting state. The expression of early G1 phase cyclin-dependent kinases CDK4 and CDK2 and the lack of expression of late G1 and S phase regulators such as CDK1, cyclin E, and cyclin A (Fig. 3A and B) confirm the quiescent nature of the urothelium and also explain at the molecular level the readiness of the urothelium to undergo renewal when provided with sufficient growth signals as would occur during wound healing (43).
Differential Expression of Cell Cycle Regulators in Tumors Induced by H-ras and SV40 T Antigen. The recently generated transgenic mouse models showed that expression of an activated H-ras gene in the mouse urothelium caused hyperplasia that evolves, in some cases, to low-grade superficial papillary urothelial tumors (6). In contrast, all mouse lines with low-level expression of SV40 T antigen developed bladder CIS at early ages (1-5 months), most of which evolved into high-grade superficial papillary bladder tumors before a small fraction advanced to invasion/metastasis (21). When analyzed at the molecular level, the main characteristic of the SV40 Tinduced tumors is a dramatic increase of most cell cyclerelated proteins. With exception of cyclin D1, all CDKs and cyclins are strongly expressed. The strong induction of late G1 phase CDKs and cyclins suggest that the progression through the restriction point of the cell cycle is mainly driven by CDK2 and CDK1 kinases. The lack of MDM2 expression indicates that p53 is not functional in its transcription activating function, mostly likely because SV40 T antigen binds and inactivates p53 (17). The phosphorylation of p53 at serine15 is indicative of genome instability (19, 20), consistent with the frequent chromosomal aberrations in these tumors (21).
The changes we observed in the Rb family proteins are similar to what has been described in other cell types expressing the SV40 T (17, 18, 44). The only exception is the hyperphosphorylation of p107, which may reflect a tissue-specific event or may be due to the low expression level of SV40 T, which may not completely inhibit the p107 function.
This enhanced expression of proliferation-promoting proteins in SV40 Tinduced tumors in the transgenic mice is consistent with what has been found in a subset of human bladder tumors. A cluster of 21 genes, including cyclin A, CDK1, and PCNA, were found to be up-regulated in high-grade human bladder tumors (grade 3 of Ta tumors) with high recurrence rate, CIS and T2+ tumors. This gene cluster has been shown to play key roles in cell-cycle transition and mitosis, and may therefore be responsible for tumor progression (11).
By contrast, in the H-ras-induced hyperplasia and superficial papillary tumors, late G1 phase proteins were absent, suggesting that proliferation is low and is confined to a small number of cells, similar to how it occurs in the normal urothelium. The tumor suppressor p16 was induced as early as in urothelial hyperplasia (Fig. 4B; Table 1). Also evident in tumors is the increased expression of p53 and its downstream target MDM2. The loss of expression of all three Rb family members is particularly intriguing. The loss of Rb family proteins has been reported in bladder cancer cell lines in conjunction with an increase in p16 (3, 45, 46, 47). It has been postulated that the induction of p16 down-regulates the Rb gene expression (48, 49). Other authors have observed Rb loss at the protein level (with Rb mRNA present) in cell lines derived from invasive bladder cancers in which p53 is mutated (50, 51). In these studies, RT4, the only cell line derived from a papillary tumor, showed loss of Rb expression in the absence of p53 mutation, a situation similar to what we have found in our H-ras-induced superficial papillary tumors (Fig. 4C). The difference is that the p16 gene is deleted in the RT4 cell line. The elevated expression of p16 protein in our mouse papillary tumors probably reflects the fact that our analysis is done on in vivo tumors, whereas the RT4 cell line had to overcome the senescence block to proliferate (3). In fact, only invasive, nonpapillary, human tumors can be cultured in vitro without having to go through a senescence crisis (3). Our observation of the loss of p107 and p130 expression in superficial papillary tumors in mice that do not progress to invasive bladder cancer suggests a senescence-like state in these tumors similar to that observed in triple knockout fibroblasts for Rb, p107, and p130 genes. In those cells, expression of an activated ras oncogene induces senescence (52). These data, together with our early results, suggest that our mouse papillary tumors are similar to human superficial papillary transitional cell carcinomas, which have a low propensity for progression due to the lack of genomic instability and the inability to bypass cellular senescence.
Unlocking the mechanisms responsible for urothelial growth and differentiation is critical for understanding both urothelial physiology and diseases. The strong similarities between mouse and human tumors, not only in phenotypes but also in cell cycle regulators, indicate the potential for these mouse models to be used in studying bladder cancer pathogenesis and in evaluating emerging therapies.
 |
Acknowledgments
|
|---|
Grant support: NIH grant P01 DK52206 (T-T. Sun, X-R. Wu, and A. Pellicer), grant FIS 02/3033 to A. Garcia-España, and a Veterans Affairs Merit Review Award (X-R. Wu).
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 6/15/04.
Revised 10/ 4/04.
Accepted 11/30/04.
 |
References
|
|---|
- American Cancer Society. Cancer facts and figures. Atlanta (GA): American Cancer Society;2003.
- Knowles MA. What we could do now: molecular pathology of bladder cancer. Mol Pathol 2001;54:21521.[Abstract/Free Full Text]
- Reznikoff CA, Sarkar S, Julicher KP, et al. Genetic alterations and biological pathways in human bladder cancer pathogenesis. Urol Oncol 2000;5:191203.[CrossRef][Medline]
- Cohen SM. Comparative pathology of proliferative lesions of the urinary bladder. Toxicol Pathol 2002;30:66371.[CrossRef][Medline]
- Lin JH, Zhao H, Sun TT. A tissue-specific promoter that can drive a foreign gene to express in the suprabasal urothelial cells of transgenic mice. Proc Natl Acad Sci U S A 1995;92:67983.[Abstract/Free Full Text]
- Zhang ZT, Pak J, Huang HY, et al. Role of Ha-ras activation in superficial papillary pathway of urothelial tumor formation. Oncogene 2001;20:197380.[CrossRef][Medline]
- Zhang ZT, Pak J, Shapiro E, Sun TT, Wu XR. Urothelium-specific expression of an oncogene in transgenic mice induced the formation of carcinoma in situ and invasive transitional cell carcinoma. Cancer Res 1999;59:351217.[Abstract/Free Full Text]
- Grippo PJ, Sandgreen EP. Highly invasive transitional cell carcinoma of the bladder in a simian virus 40 T-antigen transgenic mouse model. Am J Pathol 1975;18:3549.
- Farsund T. Cell kinetics of mouse urinary bladder epithelium. I. Circadian and age variations in cell proliferation and nuclear DNA content. Virchows Arch B Cell Pathol 1975;18:3549.
- Martin BF. Cell replacement and differentiation in transitional epithelium: a histological and autoradiographic study of the guinea-pig bladder and ureter. J Anat 1972;112:43355.[Medline]
- Dyrskjot L, Thykjaer T, Kruhoffe M, et al. Identifying distinct classes of bladder carcinoma using microarrays. Nat Genet 2003;33:906.[CrossRef][Medline]
- Baldin V, Lukas J, Marcote MJ, Pagano M, Draetta G. Cyclin D1 is a nuclear protein required for cell cycle progression in G1. Genes Dev 1993;7:81221.[Abstract/Free Full Text]
- Gao J, Huang HY, Pak J, et al. p53 deficiency provokes urothelial proliferation and synergizes with activated Ha-ras in promoting urothelial tumorigenesis. Oncogene 2004;23:68796.[CrossRef][Medline]
- Maga G, Hubscher U. Proliferating cell nuclear antigen (PCNA): a dancer with many partners. J Cell Sci 2003;116:305160.[Abstract/Free Full Text]
- Sherr CJ. The Pezcoller lecture: cancer cell cycles revisited. Cancer Res 2000;60:368995.[Abstract/Free Full Text]
- Walker BE. Renewal of cell populations in the female mouse. Am J Anat 1960;107:95105.[CrossRef][Medline]
- Ali SH, DeCaprio JA. Cellular transformation by SV40 large T antigen: interaction with host proteins. Semin Cancer Biol 2001;11:1523.[CrossRef][Medline]
- Chen W, Hahn WC. SV40 early region oncoproteins and human cell transformation. Histol Histopathol 2003;18:54150.[Medline]
- Chao C, Saito S, Anderson CW, Appella E, Xu Y. Phosphorylation of murine p53 at ser-18 regulates the p53 responses to DNA damage. Proc Natl Acad Sci U S A 2000;97:1193641.[Abstract/Free Full Text]
- Giaccia AJ, Kastan MB. The complexity of p53 modulation: emerging patterns from divergent signals. Genes Dev 1998;12:297383.[Free Full Text]
- Cheng J, Huang H, Pak J, et al. Allelic loss of p53 gene is associated with genesis and maintenance, but not invasion, of mouse carcinoma in situ of the bladder. Cancer Res 2003;63:17985.[Abstract/Free Full Text]
- Lin JY, DeCaprio JA. SV40 large T antigen promotes dephosphorylation of p130. J Biol Chem 2003;278:464827.[Abstract/Free Full Text]
- Weinstein IB. Disorders in cell circuitry during multistage carcinogenesis: the role of homeostasis. Carcinogenesis 2000;21:85764.[Abstract/Free Full Text]
- Rabbani F, Cordon-Cardo C. Mutation of cell cycle regulators and their impact on superficial bladder cancer. Urol Clin North Am 2000;27:83102.[CrossRef][Medline]
- Wang TC, Cardiff RD, Zukerberg L, Lees E, Arnold A, Schmidt EV. Mammary hyperplasia and carcinoma in MMTV-cyclin D1 transgenic mice. Nature 1994;369:66971.[CrossRef][Medline]
- Deane NG, Parker MA, Aramandla R, et al. Hepatocellular carcinoma results from chronic cyclin D1 overexpression in transgenic mice. Cancer Res 2001;61:538995.[Abstract/Free Full Text]
- Robles AI, Larcher F, Whalin RB, et al. Expression of cyclin D1 in epithelial tissues of transgenic mice results in epidermal hyperproliferation and severe thymic hyperplasia. Proc Natl Acad Sci U S A 1996;93:76348.[Abstract/Free Full Text]
- Rodriguez-Puebla ML, LaCava M, Conti CJ. Cyclin D1 overexpression in mouse epidermis increases cyclin-dependent kinase activity and cell proliferation in vivo but does not affect skin tumor development. Cell Growth Differ 1999;10:46772.[Abstract/Free Full Text]
- Nakagawa H, Wang TC, Zukerberg L, et al. The targeting of the cyclin D1 oncogene by an Epstein-Barr virus promoter in transgenic mice causes dysplasia in the tongue, esophagus and forestomach. Oncogene 1997;14:118590.[CrossRef][Medline]
- Mueller A, Odze R, Jenkins TD, et al. A transgenic mouse model with cyclin D1 overexpression results in cell cycle, epidermal growth factor receptor, and p53 abnormalities. Cancer Res 1997;57:55429.[Abstract/Free Full Text]
- Bodrug SE, Warner BJ, Bath ML, Lindeman GJ, Harris AW, Adams JM. Cyclin D1 transgene impedes lymphocyte maturation and collaborates in lymphomagenesis with the myc gene. EMBO J 1994;13:212430.[Medline]
- Lovec H, Grzeschiczek A, Kowalski MB, Moroy T. Cyclin D1/bcl-1 cooperates with myc genes in the generation of B-cell lymphoma in transgenic mice. EMBO J 1994;13:348795.[Medline]
- Sicinski P, Donaher JL, Parker SB, et al. Cyclin D1 provides a link between development and oncogenesis in the retina and breast. Cell 1995;82:62130.[CrossRef][Medline]
- Yu Q, Geng Y, Sicinski P. Specific protection against breast cancers by cyclin D1 ablation. Nature 2001;411:101721.[CrossRef][Medline]
- Roberts JM. Evolving ideas about cyclins. Cell 1999;98:12932.[CrossRef][Medline]
- Albrecht JH, Hansen LK. Cyclin D1 promotes mitogen-independent cell cycle progression in hepatocytes. Cell Growth Differ 1999;10:397404.[Abstract/Free Full Text]
- Nelsen CJ, Rickheim DG, Timchenko NA, Stanley MW, Albrecht JH. Transient expression of cyclin D1 is sufficient to promote hepatocyte replication and liver growth in vivo. Cancer Res 2001;61:85648.[Abstract/Free Full Text]
- Zhang H, Xiong Y, Beach D. Proliferating cell nuclear antigen and p21 are components of multiple cell cycle kinase complexes. Mol Biol Cell 1993;4:897906.[Abstract]
- Pagano M, Theodoras AM, Tam SW, Draetta GF. Cyclin D1-mediated inhibition of repair and replicative DNA synthesis in human fibroblasts. Genes Dev 1994;8:162739.[Abstract/Free Full Text]
- Waga S, Hannon GJ, Beach D, Stillman B. The p21 inhibitor of cyclin-dependent kinases controls DNA replication by interaction with PCNA. Nature 1994;369:5748.[CrossRef][Medline]
- Classon M, Harlow E. The retinoblastoma tumour suppressor in development and cancer. Nat Rev Cancer 2002;2:9107.[CrossRef][Medline]
- Mayol X, Garriga J, Grana X. Cell cycle-dependent phosphorylation of the retinoblastoma-related protein p130. Oncogene 1995;11:8018.[Medline]
- Baskin LS, Hayward S, Sutherland RA, et al. Cellular signaling in the bladder. Front Biosci 1997;2:d5925.[Medline]
- Knudsen ES, Wang JY. Hyperphosphorylated p107 and p130 bind to T-antigen: identification of a critical regulatory sequence present in RB but not in p107/p130. Oncogene 1998;16:165563.[CrossRef][Medline]
- Yeager T, Stadler W, Belair C, Puthenveettil J, Olopade O, Reznikoff C. Increased p16 levels correlate with pRb alterations in human urothelial cells. Cancer Res 1995;55:4937.[Abstract/Free Full Text]
- Sarkar S, Julicher, KP, Burger MS, et al. Different combinations of genetic/epigenetic alterations inactivate the p53 and pRb pathways in invasive human bladder cancers. Cancer Res 2000;60:386271.[Abstract/Free Full Text]
- Yeager TR, DeVries S, Jarrard DF, et al. Overcoming cellular senescence in human cancer pathogenesis. Genes Dev 1998;12:16374.[Abstract/Free Full Text]
- Fang X, Jin X, Xu HJ, et al. Expression of p16 induces transcriptional downregulation of the RB gene. Oncogene 1998;16:18.[CrossRef][Medline]
- Benedict WF, Lerner SP, Zhou J, Shen X, Tokunaga H, Czerniak B. Level of retinoblastoma protein expression correlates with p16 (MTS-1/INK4A/CDKN2) status in bladder cancer. Oncogene 1999;18:1197203.[CrossRef][Medline]
- Markl ID, Jones PA. Presence and location of TP53 mutation determines pattern of CDKN2A/ARF pathway inactivation in bladder cancer. Cancer Res 1998;58:534853.[Abstract/Free Full Text]
- Sanchez-Carbayo M, Socci ND, Charytonowicz E, et al. Molecular profiling of bladder cancer using cDNA microarrays: defining histogenesis and biological phenotypes. Cancer Res 2002;62:697380.[Abstract/Free Full Text]
- Van der Weyden L, Jonkers J, Bradley A. Stuck at first base. Nature 2002;419:1278.[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
T.-T. Sun
Altered phenotype of cultured urothelial and other stratified epithelial cells: implications for wound healing
Am J Physiol Renal Physiol,
July 1, 2006;
291(1):
F9 - F21.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R.A. Crallan, N.T. Georgopoulos, and J. Southgate
Experimental models of human bladder carcinogenesis
Carcinogenesis,
March 1, 2006;
27(3):
374 - 381.
[Abstract]
[Full Text]
[PDF]
|
 |
|