Cancer Research SABCS  Sign up for Cancer Research eTOC's
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Herrick, J.
Right arrow Articles by Bensimon, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Herrick, J.
Right arrow Articles by Bensimon, A.
[Cancer Research 65, 1174-1179, February 15, 2005]
© 2005 American Association for Cancer Research


Molecular Biology, Pathobiology and Genetics

Genomic Organization of Amplified MYC Genes Suggests Distinct Mechanisms of Amplification in Tumorigenesis

John Herrick1, Chiara Conti1, Sebastien Teissier2, Francoise Thierry2, Jérôme Couturier4, Xavier Sastre-Garau5, Michel Favre3, Gérard Orth3 and Aaron Bensimon1

1 Unité Stabilité des Génomes, Département de Structure et Dynamique des Génomes, 2 Unite d'Expression Génétiques et Maladies, Département de Biologie du Développement, and 3 Unité des Papillomavirus, Département de Virologie, Institut Pasteur; and Service de 4 Génétique Oncologique and 5 Pathologie, Section Médicale, Institut Curie, Paris, France

Requests for reprints: Aaron Bensimon and Chiara Conti, Unité Stabilité Jes Génomes, Structure et Dynamique des Génomes, Pasteur Institute, 25, rue Dr. Roux, Paris cedex, France 75724. Phone: 33-140613240; Fax: 33-145688790; E-mail: abensim{at}pasteur.fr and cconti{at}pasteur.fr.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Integration of the human papillomavirus (HPV) genome into the host genome is associated with the disruption of the HPV E2 gene and with amplification and rearrangement of the viral and flanking cellular sequences. Molecular characterization of the genomic structures of coamplified HPV sequences and oncogenes provides essential information concerning the mechanisms of amplification and their roles in carcinogenesis. Using fluorescent hybridization on stretched DNA molecules in two cervical cancer–derived cell lines, we have elucidated the genomic structures of amplified regions containing HPV/myc genes over several hundreds of kilobases. Direct visualization of hybridization signals on individual DNA molecules suggests that overreplication and breakage-fusion-bridge–type mechanisms are involved in the genomic instability associated with HPV cervical cancers. Further analysis from two other genital cancer–derived cell lines reveals a recurrent motif of amplification, probably generated by a common mechanism involving overreplication upon viral integration. Interestingly, different amplification patterns seem to be correlated with the disease outcome, thus providing new insights into HPV-related cancer development and tumor progression.

Key Words: Genomic instability • amplification profile • HPV/myc amplicon • Single molecule approach


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Human papillomavirus (HPV) infections are commonly associated with genital carcinomas (1). High-risk strains of the virus are generally considered to be the etiologic agents underlying these cancers (2), and it is estimated that >90% of invasive cancers contain episomal and/or integrated forms of HPV DNA (3).

Although HPV integration may not be an essential feature of carcinogenesis, integration is accompanied by inactivation of the HPV E2 gene (4), which results in the constitutive expression of the viral E6 and E7 oncoproteins (5, 6). E6 stimulates the degradation of the tumor suppressor p53, which interferes with the G1-S and G2-M checkpoints and reduces apoptotic activity (7). E7 protein binds to hypophosphorylated pRB and releases E2F-type transcription factors bound to pRB (8, 9). This induces the unscheduled entry into S phase of the cell cycle and promotes the genomic instability that leads to the development of anogenital cancers (10, 11).

The insertion of HPV sequences into the host genome is known to be associated with genomic instability, including amplification, and carcinogenesis (11–13). Knowledge of the genomic structure of an amplified region is essential for understanding the nature of the mechanisms that generated the amplification. However, the insertion sites of HPV sequences and their organization with respect to coamplified oncogenes have yet to be characterized at the level of the complete amplicon, and the role of the virus in the local instability remains unknown. To date, no preferential site or integration motif has been identified (14). Nevertheless, integration of HPV DNA sequences into chromosomal regions containing MYC genes has been repeatedly observed in cases of invasive genital carcinomas and in cervical cancer–derived cell lines (15–18).

MYC amplifications associated with HPV integration therefore provide an attractive model system in which to investigate the relationship between the genomic structure of an amplified region and the mechanisms underlying its amplification. We did fluorescent hybridization experiments on individual molecules of DNA containing amplified MYC genes. The DNA was extracted first from two cancer-derived cell lines, IC1 and IC4 (17, 19), and stretched by molecular combing (20). The results show very different organizations of the amplified regions, which suggest distinct mechanisms of amplification in these two cancers. IC1 contains a regular pattern of HPV18 DNA inserted immediately adjacent to c-myc. HPV18 and c-myc are coamplified in a highly periodic pattern of direct repeats, which may have been generated by either overreplication or replication fork arrest followed by recombination. In contrast, the pattern of amplification in the IC4 tumor is strikingly different. The region containing coamplified N-myc and HPV sequences is extensively rearranged in a complex pattern of inverted and tandem repeats consistent with the breakage-fusion-bridge–type model of gene amplification.

We further analyzed two additional genital cancers, IC2 (17, 19) and IC5. In IC2, no clear pattern of integration could be established. Conversely, IC5 displays the same integration profile as IC1 corresponding to a linear array of viral genomes. This recurrent motif in two different regions of the genome suggests a common mechanism of amplification based on homologous recombination. The motif is independent of chromosomal context and therefore likely related to the presence of integrated viral DNA.

The measurements made on IC1 and IC5 DNA also revealed that a complete HPV genome may be present, although it does not code for a full E2 transcript. IC4 and IC2, on the other hand, contain the expected truncated viral genome. The structures of the amplified regions were found to correlate well with the distinct outcome of the tumors from which the cell lines were derived, with IC1 and IC5 being less aggressive than IC2 and IC4, suggesting different mechanisms in carcinogenesis.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Cell Lines. IC1 (17) and IC5 tumors were carcinomas of the cervix associated with HPV18 and experienced favorable outcome. IC4 corresponded to a poorly differentiated cervical carcinoma associated with HPV45 and presented a rapid and uncontrollable tumor dissemination (17, 19). IC2 was a penile squamous cell carcinoma associated with HPV16, which showed several locoregional relapses and a fatal outcome (17, 19). Cells were grown, harvested (passages 20 to 24), and embedded in agarose plugs for DNA extraction.

Preparation of Genomic DNA and Molecular Combing. Genomic DNA was extracted and combed as previously described (21).

Probes. Cosmids were prepared by alkaline lysis from an overnight culture; 0.5 µg of each cosmid was labeled by Random Priming (Invitrogen Life Technologies, Cergy Pontoise, France) with either biotin-14-dUTP or digoxygenin-11-dUTP (Boehringer Ingelheim, Ingelheim, Germany). Labeled probes (0.5 µg) specific to either the N-myc or c-myc gene were pooled, respectively, with HPV45 and HPV18 probes or HPV16. The c-myc probe spans 12 kb (22), corresponding to the gene (6 kb) and 5' regulatory sequences. A plasmid containing the cloned N-myc gene was used (6.5 kb). The probes to detect the virus contain full-length HPV18 and HPV45 (~7.8 kb). COT-1 DNA (1.5 µg) was added to the mixture, precipitated, dried, and resuspended in 20 µL hybridization buffer.

Hybridization. Coverslips stored at –20°C were dried and denatured for 20 minutes at room temperature in 1 mol/L NaOH. Probes were denatured at 100°C for 5 minutes, incubated on ice for 5 minutes, and hybridized to the combed DNA in a humid chamber overnight at 37°C.

Detection by Fluorescent Antibodies. The probes were detected by fluorescent antibodies using FITC for digoxigenin-labeled probes and Texas Red for biotin-labeled probes (20).

FISH Analysis. Successive slides were scanned to accumulate a statistically reliable number of signals (Table 1). Screening was done using an epifluorescence microscope (40x objective) connected to a charge-coupled device camera. Images were acquired and measurements were done using software developed in the laboratory.


View this table:
[in this window]
[in a new window]

 
Table 1. Statistics from measurements made on fluorescent signals corresponding to HPV and MYC sequences in IC1, IC4, and IC5

 


View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. A, coamplification of HPV18 and c-myc sequences in the IC1 cell line. Red, HPV18. Green, c-myc. HPV18 and c-myc are amplified as a single unit that includes a gap of undetected chromosomal sequences. Bar, 10 kb. B, direct visualization of the genomic structure of the HPV45/N-myc amplicon from the IC4 cell line. Red, HPV45. Green, N-myc. Bar, 10 kb. C, histograms of MYC, HPV sequences, and gaps. Note that the peaks in IC4 are regularly spaced with the medium and large gaps being approximately two and four times larger, respectively, than the small gap (measurements are given in micrometers; 1 µm = 2 kb).

 
RNA Isolation. Total RNA was extracted with Trizol (Invitrogen Life Technologies) according to the manufacturer's recommendations. RNA quality was assessed with 2100 BioAnalyzer (Agilent, Palo Alto, CA).

Quantitative Real-time Reverse Transcription–PCR Analysis. 5 µg total RNA were reverse transcribed into cDNA by Multiscribe reverse transcriptase, using a reverse transcription kit (Applied Biosystems, Foster City, CA) and SuperScript II (Invitrogen Life Technologies) as recommended by the manufacturer. Of the resulting synthesized single-stranded cDNA, 1/500was used for each PCR reaction in the presence of 3 µmol/L specific primers and SYBR Green PCR Master Mix (Applied Biosystems). Quantitative PCR was done on a GeneAmp 5700 Sequence Detection System (Applied Biosystems) or ABI Prism 7000, with cycling conditions of 2 minutes at 50°C, 10 minutes at 95°C and 40x (15 seconds at 95°C, 1 minute at 60°C). After the last cycle, the temperature was progressively raised to provide dissociation curves allowing us to assess the purity of the amplified product. Each PCR 96-well plate contained serial dilutions of glyceraldehyde 3-phosphate dehydrogenase and 18S ribosomal cDNA, which served to calibrate cDNA concentration with the threshold cycle (Ct). Specific primers used were 5' GGCCTTGCACAAAGTGCATAC and 3' TCGCATGTGTCTTGCAGTGTC at position 3069 (5' end of E2) and 5' TGCGAAAACATAGCGACCAC and 3' TCATTGCCTGCACCTGTCC at position 3733 (3' end of E2) of the HPV18 genome. E6 primers at position 113 of the HPV genome were 5' CTTTGAGGATCCAACACGGC and 3' TCAGTTCCGTGCACAGATCAG and E7 primers at position 638 were 5' CCCCAAAATGAAATTCCGGT and 3' GTCGCTTAATTGCTCGTGACATA. Cdc20 primers were 5' CCTGAACGGTTTTGATGTAGAGG and 3' TTTCCACTGAGCCGAAGGAT.


    Results and Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
HPV18/c-myc Sequences in IC1 Form an Amplicon with a Periodic Pattern of Amplification. The primary tumor IC1 was previously characterized and two to five copies of HPV18 genomes were estimated to integrate close to c-myc with 10- to 15-fold amplification of the nonrearranged oncogene (17). To determine the viral pattern of integration at the c-myc locus, we analyzed the region by FISH on individual DNA molecules (23). Probes for HPV18 and c-myc were hybridized to total genomic DNA extracted from IC1 cells and stretched by molecular combing. Linear fluorescent signals obtained after immunostaining detection were collected and revealed that the IC1 cell line displays a coamplification of the c-myc gene with HPV18 (Fig. 1A). Measurements provided a number of details concerning the local and overall structure of the amplification (Fig. 1A and C; Table 1). The lengths of the HPV18 signals were highly variable (8.8 ± 5.6 kb). Both longer and truncated HPV sequences were observed, with some signals being as large as 20 kb in length and as small as 1 kb or even less given the 1 kb resolution of these experiments. The longer HPV signals are consistent with the integration of the HPV18 genome in the form of concatamers and suggest that a full-length viral genome may be integrated. In comparison with the expected length of 12 kb (see Materials and Methods), the average measured length of c-myc signals (15.4 ± 8.8 kb) indicates that each cassette contains approximately one complete c-myc copy. Finally, the length of the gap seemed to be highly conserved (11.8 ± 3.6 kb), suggesting a specific or preferential breakpoint due to some unknown topological or genetic constraint involved in the generation of the amplicon. The HPV18/c-myc cassette (34 ±7.2 kb) is amplified in a highly regular, periodic pattern in this cell line, indicating that integration of viral sequences is very specific to the c-myc locus. The regular pattern observed in IC1 revealed that the amplicon contains chromosomal, HPV18, and c-myc sequences amplified in tandem direct repeats. The comparison of amplicons from different molecules reveals a difference in the length of the cassettes. However, the length of each cassette is highly reproducible within each molecule due to the constant stretching factor of the combed DNA (23). Because there is no specific integration site for HPV, we conclude that viral DNA integrated into the c-myc region before amplification. Consequently, differences between amplicons are probably due to changes occurring in the cell during clonal selection and tumor development.

Although it is difficult to assess the actual size of the amplicon, it was found here that the amplification frequency of the cassette was at least 10-fold, corresponding to a minimal size for the amplification of ~360 kb. Because the c-myc gene is overexpressed only 3- to 5-fold, gene copy number does not correlate with the level of gene expression (17).

The direct repeats observed in this amplicon could be due to overreplication or replication fork arrest, both of which form substrates known to stimulate recombination (refs. 24–28; Fig. 2A). Overreplication induces chromosomal breaks at replication forks followed either by the formation of extrachromosomal circles that are then amplified or by repeated rounds of unequal sister chromatid exchange (29, 30). A contingency of an overreplication type mechanism is the presence of active origins of replication that are presumably organized in clusters in the amplified region (31). Active, closely spaced origins are essential conditions for the stable duplication of a region, and therefore deregulation of replication origin firing may drive the amplification process (32, 33). We recently confirmed the presence of stalled replication forks and perturbed replication origin activation at both genomic and viral sequences within the amplicon.6 These observations support the hypothesis that the IC1 amplicon was produced by recombination upon inefficient replication.



View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. A, model of the DNA overreplication mechanism. The scheme is represented with secondary rearrangements due to unequal sister chromatid exchange. B, model of the breakage-fusion-bridge mechanism.

 
Several observations suggest that a variety of topological features of the genome may serve as preferential targets for viral integration, but some contradictory results were found (16, 34–40). Recently, recurrent integration of HPV18 in proximity to c-myc has been observed (18), and our data show an unambiguous and specific insertion of HPV18 sequences immediately adjacent to the c-myc gene in IC1. Upstream of c-myc there is a known matrix attachment region that coincides with the c-myc promoter, as well as a well-characterized origin of replication (41) and two known fragile sites, FRA8C and FRA8D (18). The exact role that fragile sites play in viral integration remains unclear (40). There have been several reports suggesting a close relationship between oncogene amplification, fragile sites, delayed DNA replication, and functional elements believed to be associated with DNA replication origins (42, 43). FRA8C and FRA8D could favor chromosomal breaks leading to a break-fusion-bridge mechanism and consequent amplification of the region as inverted repeats. Nevertheless, this type of mechanism seems unlikely for the IC1 amplicon, which is organized in tandem repeats. Moreover, the size of the cassette, ~36 kb, would require the breakage site to be very specific and localized in proximity to the c-myc gene. The distal end of FRA8C is about 400 kb 5' to c-myc, whereas the proximal end of FRA8D is thought to be 1 Mb 3' of the oncogene (18), suggesting that they are not involved in the amplification process in this cell line. However, we cannot exclude the possibility that the fragile sites provided the initial break that allowed viral integration and the subsequent amplification of the region.

Nonrandom Clustering of Amplified HPV45/N-myc Units in the IC4 Cancer-Derived Cell Line. Previous analysis of IC4 DNA indicated that HPV45 sequences were integrated at chromosome band 2p24 into the N-myc gene disrupting exon 3 (19). The gene itself was found to be amplified 10-fold and overexpressed with no evidence of sequence rearrangement. The N-myc oncogene is not expressed either in the normal cervix or in the cancer cell lines IC1 and IC2, which both display HPV integration outside the N-myc locus (17). Therefore, N-myc overexpression is likely due to the molecular alteration of the N-myc locus triggered by the viral integration (17).

The genomic organization of N-myc and HPV45 sequences in this cell line remains uncharacterized to date. We therefore analyzed individual molecules of IC4 genomic DNA with the same approach used for IC1. Hybridization of probes specific to N-myc and HPV45 sequences on combed DNA yields a linear array of alternating green and red signals separated by a gap (Fig. 1B). In agreement with previous studies, direct visualization of the linear fluorescent signals shows that HPV45 and N-myc sequences are coamplified as a discrete cassette and that HPV45 sequences are integrated immediately adjacent to the N-myc gene. Quantitative analysis of the amplified region indicates that it corresponds to a large amplification of at least 1 Mb in size. Measurements done on the N-myc signals revealed that they span 8.0 ± 4 kb and agree with the size of the nonrearranged normal allele. HPV45 signals, on the other hand, are significantly more variable in length and span 3.4 ± 2.2 kb (Table 1), indicating deletions in the viral genome. Signals longer than the expected N-myc segment and displaying HPV insertion on both sides of the gene probably represent two adjacent and inverted cassettes (Fig. 1B and C). Some N-myc signals do not coincide with HPV signals. The absence of viral sequences may be due to the resolution of the technique or to real deletions in the viral genome. In addition, the possibility that the oncogene is amplified independently of the virus cannot be excluded.

The analyses also show that the structure of the amplification is highly complex, with both direct and inverted repeats (Fig. 1B). The dominant pattern of amplification corresponded to a head-to-tail organization (72%). A significant number of N-myc/HPV45 sequences, however, were organized as inverted repeats in a head-to-head and tail-to-tail orientation (28%; Fig. 3). This complex pattern of amplification indicates that secondary amplifications have occurred following the initial imbalance.



View larger version (13K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. A, histograms of the inverted (head to head or tail to tail, gray) and tandem (head to tail, black) orientations in the IC4 amplification. The histograms reveal the relative frequencies of the different orientations governing the HPV45/N-myc amplified sequences. The major fraction of amplified sequences corresponds to the tandem orientation (72%). Seventeen percent of analyzed sequences were composed head-to-head orientation, and 11% were composed of a tail-to-tail orientation. B, representation of the structures calculated for each peak.

 
Although the overall structure of the amplified region has an irregular organization, the measurements revealed a distinct nonrandom pattern of amplification. Amplified HPV45/N-myc sequences are separated by large yet variable distances, indicating that amplification involves extensive regions of the genome. The distances between amplified units fall into three separate classes having an average size of 14, 30, and 70 kb, respectively (Table 1). The trimodal distribution of the gap sizes confirms the clustering of the amplified copies and suggests that the locations of the chromosomal breakpoints are genetically or topologically constrained, yielding three major nonrandomly generated units of amplification.

The highly complex organization of this amplification indicates the occurrence of multiple types of rearrangements and secondary instabilities. The presence of inverted repeats suggests a break-fusion-bridge–type mechanism, as previously described by Hellmann et al. (44) and Ciullo et al. (45) at the MET and PIP loci. When an unduplicated chromosomal region forms on the mitotic spindle, the resulting DNA bridge breaks when chromatids move toward the opposite poles. The DNA is then repaired by sister chromatid fusion (Fig. 2B), leading to repeated rounds of break-fusion-bridge–type mechanism with each cell-division cycle.

Inefficient replication of DNA resulting in unduplicated regions of the genome at mitosis may be due to abnormal replication initiation or perturbed fork progression (32). Therefore, a break-fusion-bridge–type mechanism of amplification may involve impaired DNA replication. The complex pattern of the IC4 amplification suggests that origins of replication in the amplified N-myc region may have either been partially or totally inactivated. Preliminary data show lower than expected replication fork densities within the region in support of a role played by impaired DNA replication in the break-fusion-bridge–type mechanism of amplification.

Recurrent Motifs Suggest a Common Mechanism of Amplification whereas Different Motifs Correlate with the Invasiveness of the Cancer. We next analyzed the genital cancers IC5 and IC2 to corroborate the observations concerning IC1 and IC4 and to search for recurrent motifs of amplification that may have been generated by a common mechanism (19).

In IC5, FISH on metaphase spreads showed integration of HPV18 sequences at 7q31 (data not shown), which contains the proto-oncogene MET. The oncogene is not amplified nor rearranged, but is overexpressed 5-fold (data not shown). The exact position of the virus with respect to MET as well as the organization of the region were previously unknown. We hybridized two probes specific to HPV18 and MET sequences to linearized genomic DNA extracted from IC5. No colocalization of the viral and MET probes was found, indicating that the viral sequences are not integrated in the vicinity of the oncogene. Moreover, according to the average length of the DNA molecules combed on the surface (500-900 kb), the distance between the virus and MET is several hundreds of kilobases.

In IC5, the integration profile of the virus was found to be a linear array of viral sequences, and each repeated unit (viral and genomic sequences) spans about 36 kb (Fig. 4). This organization is very similar to the structure observed in IC1 and suggests a common mechanism of expansion for the two amplicons. In IC5, the HPV copies are regularly spaced and separated by 22 kb of intervening chromosomal DNA. Therefore, the breakpoint is close to the viral sequences, as was observed in IC1. Because the integration site is different in the two tumors, specific genomic sequences are unlikely to be involved in the rearrangement of the region. However, the fragile site FRA7G, which spans several hundreds of kilobases and maps within the MET locus, could provide the initial break that allows viral integration and the initiation of the amplification process.



View larger version (14K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. A, HPV18 integration motif in the IC5 cancer. As in IC1, the cassette (HPV18 + gap) is ~36 kb and displays a regular periodic pattern. Middle, a molecule making a loop on the left. B, histograms of measurements made on the fluorescent signals (1 µm = 2 Kb).

 
In the genital cancer IC2, HPV16 sequences were reported to be located at 8q24, which contains c-myc. The oncogene is rearranged, amplified 5- to 10-fold, and overexpressed. However, no clear association between the virus and c-myc was found at the molecular level (19). The analysis on combed genomic DNA extracted from IC2 indicated a very complex organization of the viral and c-myc sequences in agreement with published data. No recurrent viral integration profile was apparent. Because the sensitivity of the approach is ~1 kb, the viral genome is probably strongly deleted, consistent with the pattern observed in IC4 (data not shown).

Measurements of viral sequences in IC1 and IC5 show that a complete HPV genome may be stably integrated in at least some cassettes of the amplified region, suggesting that genes in addition to E6 and E7 may be transcribed. The transcription of E6 and E7 was quantified in IC1, in C4-1, and in HeLa cells, which are two other cervical carcinoma cell lines also associated with HPV18. Real-time PCR analysis indicated that the levels of E6 and E7 transcripts in IC1 are comparable to those observed in C4-1 and 3-fold lower than in HeLa (Fig. 5). These different levels can be explained by gene dosage because C4-1 cells exhibit only one copy of the integrated HPV genome versus 50 copies in HeLa cells, whereas both cell lines contain highly deleted HPV18 genomes (46). We further analyzed the E2 transcript in IC1 and found high levels of a transcript corresponding only to the 5' of the E2 gene (Fig. 5). This indicates a disruption of the E2 gene, which is confirmed by the absence of the genomic amplification of the full-length E2 open reading frame (data not shown). Therefore, IC4 and IC2 contain truncated viral genomes, whereas IC1 and IC5 can contain complete genomes.



View larger version (12K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Real-time PCR analysis of viral E6, E7, and E2 genes in three cervical carcinoma cell lines, IC1, C4-1, and HeLa. Quantitative PCR amplification of the viral genes was compared with the endogenous expression of the cdc20 cellular gene with pairs of oligonucleotides of comparable efficiencies. Transcription of the E2 gene could be detected only in IC1 with a pair of oligonucleotides designed to amplify a short sequence in the 5' end of the gene, whereas a pair of oligonucleotides in the 3' end of the gene did not give amplification above background. Transcription of the viral oncogenes usually is 5- to 10-fold higher than many other cellular genes, contrary to E2 expression, which is at similar levels.

 
In conclusion, this work shows recurrent motifs of amplification of viral sequences that suggest a common mechanism of amplification based on homologous recombination possibly as a result of overreplication. Moreover, the data suggest a possible correlation between the integration profile and the invasiveness of the cancers: regular arrays of full-length HPV were observed in IC1 and IC5, which are much less aggressive than IC4 and IC2. Additional samples need to be analyzed to establish this correlation, which may indicate a novel mode of infection and tumor development associated with a less severe pathology. Together these data indicate that distinct mechanisms may be involved in the amplification of MYC and HPV sequences and that different patterns of amplification correlate with the pathologies observed in these genital cancers.


    Acknowledgments
 
Grant support: Association pour la Recherche contre le Cancer (C. Conti).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    Footnotes
 
Note: J. Herrick and C. Conti contributed equally to this work.

6 C. Conti, J. Herrick, A. Bensimon, unpublished observation. Back

Received 8/ 4/04. Revised 10/20/04. Accepted 12/ 5/04.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

  1. zur Hausen H. Papillomaviruses and cancer: from basic studies to clinical application. Nat Rev Cancer 2002;2:342–50.[CrossRef][Medline]
  2. Mayor S. Human papilloma-virus classified as carcinogenic. BMJ 1996;313:70.[Free Full Text]
  3. Bosch FX, Manos MM, Munoz N, et al. Prevalence of human papillomavirus in cervical cancer: a worldwide perspective. International Biological Study on Cervical Cancer (IBSCC) Study Group. J Natl Cancer Inst 1995;87:796–802.[Abstract/Free Full Text]
  4. Thierry F, Yaniv M. The BPV1-E2 trans-acting protein can be either an activator or a repressor of the HPV18 regulatory region. EMBO J 1987;6:3391–7.[Medline]
  5. Scheffner M, Romanczuk H, Munger K, et al. Functions of human papillomavirus proteins. Curr Top Microbiol Immunol 1994;186:83–99.[Medline]
  6. Farthing AJ. Vousden KH. Functions of human papillomavirus E6 and E7 oncoproteins. Trends Microbiol 1994;2:170–4.[CrossRef][Medline]
  7. Mantovani F, Banks L. The human papillomavirus E6 protein and its contribution to malignant progression. Oncogene 2001;20:7874–87.[CrossRef][Medline]
  8. Munger K, Basile JR, Duensing S, et al. Biological activities and molecular targets of the human papillomavirus E7 oncoprotein. Oncogene 2001;20:7888–98.[CrossRef][Medline]
  9. Boyer SN, Wazer DE, Band V. E7 protein of human papilloma virus-16 induces degradation of retinoblastoma protein through the ubiquitin-proteasome pathway. Cancer Res 1996;56:4620–4.[Abstract/Free Full Text]
  10. Duensing S, Munger K. The human papillomavirus type 16 E6 and E7 oncoproteins independently induce numerical and structural chromosome instability. Cancer Res 2002;62:7075–82.[Abstract/Free Full Text]
  11. Duensing S. Munger K. Mechanisms of genomic instability in human cancer: insights from studies with human papillomavirus oncoproteins. Int J Cancer 2004;109:157–62.[CrossRef][Medline]
  12. Solinas-Toldo S, Durst M, Lichter P. Specific chromosomal imbalances in human papillomavirus-transfected cells during progression toward immortality. Proc Natl Acad Sci U S A 1997;94:3854–9.[Abstract/Free Full Text]
  13. Pett MR, Williams O, Alazawi F, et al. Acquisition of high-level chromosomal instability is associated with integration of human papillomavirus type 16 in cervical keratinocytes. Cancer Res 2004;64:1359–68.[Abstract/Free Full Text]
  14. Wentzensen N, Ridder R, Klaes R, et al. Characterization of viral-cellular fusion transcripts in a large series of HPV16 and 18 positive anogenital lesions. Oncogene 2002;21:419–26.[CrossRef][Medline]
  15. Durst M, Croce CM, Gissmann L, Schwarz E, Huebner K. Papillomavirus sequences integrate near cellular oncogenes in some cervical carcinomas. Proc Natl Acad Sci U S A 1987;84:1070–4.[Abstract/Free Full Text]
  16. Cannizzaro LA, Durst M, Mendez MJ, Hecht BK, Hecht F. Regional chromosome localization of human papillomavirus integration sites near fragile sites, oncogenes, and cancer chromosome breakpoints. Cancer Genet Cytogenet 1988;33:93–8.[CrossRef][Medline]
  17. Couturier J, Sastre-Garau X, Schneider-Maunoury S, Labib A, Orth G. Integration of papillomavirus DNA near myc genes in genital carcinomas and its consequences for proto-oncogene expression. J Virol 1991;65:4534–8.[Abstract/Free Full Text]
  18. Ferber M, Thorland E, Brink A, et al. Preferential integration of human papillomavirus type 18 near the c-myc locus in cervical carcinoma. Oncogene 2003;22:7233–42.[CrossRef][Medline]
  19. Sastre-Garau X, Favre M, Couturier J, Orth G. Distinct patterns of alteration of myc genes associated with integration of human papillomavirus type 16 or type 45 DNA in two genital tumours. J Gen Virol 2000;81:1983–93.[Abstract/Free Full Text]
  20. Michalet X, Ekong R, Fougerousse F, et al. Dynamic molecular combing: stretching the whole human genome for high-resolution studies. Science 1997;277:1518–23.[Abstract/Free Full Text]
  21. Conti C, Caburet S, Bensimon A. Molecular combing. Current protocols in cytometry. 2000. p. 8.
  22. Onclercq R, Lavenu A, Cremici C. Pleiotropic derepression of developmentally regulated cellular and viral genes by c-myc proto-oncogene products in undifferentiated embryonal carcinoma cells. Nucleic Acids Res 1989;17:735–53.[Abstract/Free Full Text]
  23. Bensimon A, Simon A, Chiffaudel A, Croquette V, Heslot F, Bensimon D. Alignment and sensitive detection of DNA by a moving interface. Science 1994;265:2096–8.[Abstract/Free Full Text]
  24. Szostak JW, Orr-Weaver TL, Rothstein RJ, Stahl FW. The double-strand-break repair model for recombination. Cell 1983;33:25–35.[CrossRef][Medline]
  25. Bollag RJ, Liskay RM. Direct-repeat analysis of chromatid interactions during intrachromosomal recombination in mouse cells. Mol Cell Biol 1991;11:4839–45.[Abstract/Free Full Text]
  26. Kadyk LC, Hartwell LH. Sister chromatids are preferred over homologs as substrates for recombinational repair in Saccharomyces cerevisiae. Genetics 1992;132:387–402.[Abstract]
  27. Johnson RD, Jasin M. Sister chromatid gene conversion is a prominent double-strand break repair pathway in mammalian cells. EMBO J 2000;19:3398–407.[CrossRef][Medline]
  28. Johnson RD, Jasin M. Double-strand-break-induced homologous recombination in mammalian cells. Biochem Soc Trans 2001;29:196–201.[CrossRef][Medline]
  29. Meschini R, Bastianelli R, Palitti F. The diplochromosome of endoreduplicated cells: a new approach to highlight the mechanism of sister chromatid exchange. Chromosoma 1996;105:50–4.[Medline]
  30. Schimke RT. Gene amplification in cultured cells. J Biol Chem 1988;263:5989–92.[Free Full Text]
  31. Jackson DA. Pombo A. Replicon clusters are stable units of chromosome structure: evidence that nuclear organization contributes to the efficient activation and propagation of S phase in human cells. J Cell Biol 1998;140:1285–95.[Abstract/Free Full Text]
  32. Pasero P, Schwob E. Think global, act local—how to regulate S phase from individual replication origins. Curr Opin Genet Dev 2000;10:178–86.[CrossRef][Medline]
  33. van Brabant AJ, Buchanan CD, Charboneau E, Fangman WL, Brewer BJ. An origin-deficient yeast artificial chromosome triggers a cell cycle checkpoint. Mol Cell 2001;7:705–13.[CrossRef][Medline]
  34. Gallego MI, Zimonjic DB, Popescu NC, DiPaolo JA, Lazo PA. Integration site of human papillomavirus type-18 DNA in chromosome band 8q22.1 of C4-I cervical carcinoma: DNase I hypersensitivity and methylation of cellular flanking sequences. Genes Chromosomes Cancer 1994;9:28–32.[Medline]
  35. Thorland EC, Myers SL, Persing DH, et al. Human papillomavirus type 16 integrations in cervical tumors frequently occur in common fragile sites. Cancer Res 2000;60:5916–21.[Abstract/Free Full Text]
  36. Shera KA, Shera CA, McDougall JK. Small tumor virus genomes are integrated near nuclear matrix attachment regions in transformed cells. J Virol 2001;75:12339–46.[Abstract/Free Full Text]
  37. Bauer-Hofmann R, Borghouts C, Auvinen E, et al. Genomic cloning and characterization of the nonoccupied allele corresponding to the integration site of human papillomavirus type 16 DNA in the cervical cancer cell line SiHa. Virology 1996;217:33–41.[CrossRef][Medline]
  38. Brink AA, Wiegan JC, Szuhai K, et al. Simultaneous mapping of human papillomavirus integration sites and molecular karyotyping in short-term cultures of cervical carcinomas by using 49-color combined binary ratio labeling fluorescence in situ hybridization. Cancer Genet Cytogenet 2002;134:145–50.[CrossRef][Medline]
  39. Choo KB, Chen CM, Han CP, Cheng WT, Au LC. Molecular analysis of cellular loci disrupted by papillomavirus 16 integration in cervical cancer: frequent viral integration in topologically destabilized and transcriptionally active chromosomal regions. J Med Virol 1996;49:15–22.[CrossRef][Medline]
  40. Hori T, Seki N, Ohira M, et al. A distamycin A-inducible fragile site, FRA8E, located in the region of the hereditary multiple exostoses gene, is not involved in HPV16 DNA integration and amplification. Cancer Genet Cytogenet 1998:101:24–34.[CrossRef][Medline]
  41. Liang Tao ZD, Leffak M, Zannis-Hadjopoulos M, Price G. Major DNA replication initiation sites in the c-myc locus in human cells. J Cell Biochem 2000;78:442–57.[CrossRef][Medline]
  42. Le Beau MM, Rassool FV, Neilly ME, et al. Replication of a common fragile site, FRA3B, occurs late in S phase and is delayed further upon induction: implications for the mechanism of fragile site induction. Hum Mol Genet 1998;7:755–61.[Abstract/Free Full Text]
  43. Hellman A, Rahat A, Scherer SW, et al. Replication delay along FRA7H, a common fragile site on human chromosome 7, leads to chromosomal instability. Mol Cell Biol 2000;20:4420–7.[Abstract/Free Full Text]
  44. Hellman A, Zlotorynski E, Scherer SW, et al. A role for common fragile site induction in amplification of human oncogenes. Cancer Cell 2002;1:89–97.[CrossRef][Medline]
  45. Ciullo M, Debily MA, Rozier L, et al. Initiation of the breakage-fusion-bridge mechanism through common fragile site activation in human breast cancer cells: the model of PIP gene duplication from a break at FRA7I. Hum Mol Genet 2002;11:2887–94.[Abstract/Free Full Text]
  46. Schwarz E, Freese UK, Gissmann L, et al. Structure and transcription of human papillomavirus sequences in cervical carcinoma cells. Nature 1985;314:111–4.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Molecular Cancer TherapeuticsHome page
C. Morales, M. J. Garcia, M. Ribas, R. Miro, M. Munoz, C. Caldas, and M. A. Peinado
Dihydrofolate reductase amplification and sensitization to methotrexate of methotrexate-resistant colon cancer cells
Mol. Cancer Ther., February 1, 2009; 8(2): 424 - 432.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. L. Dall, C. G. Scarpini, I. Roberts, D. M. Winder, M. A. Stanley, B. Muralidhar, M. T. Herdman, M. R. Pett, and N. Coleman
Characterization of Naturally Occurring HPV16 Integration Sites Isolated from Cervical Keratinocytes under Noncompetitive Conditions
Cancer Res., October 15, 2008; 68(20): 8249 - 8259.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
G. R. Bignell, T. Santarius, J. C.M. Pole, A. P. Butler, J. Perry, E. Pleasance, C. Greenman, A. Menzies, S. Taylor, S. Edkins, et al.
Architectures of somatic genomic rearrangement in human cancer amplicons at sequence-level resolution
Genome Res., September 1, 2007; 17(9): 1296 - 1303.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
P. Rebuzzini, P. Martinelli, M. Blasco, E. Giulotto, and C. Mondello
Inhibition of gene amplification in telomerase deficient immortalized mouse embryonic fibroblasts
Carcinogenesis, March 1, 2007; 28(3): 553 - 559.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Herrick, J.
Right arrow Articles by Bensimon, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Herrick, J.
Right arrow Articles by Bensimon, A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online