Cancer Research Annual Meeting 2010  EMT and Cancer Progression and Treatment
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Park, W.-R.
Right arrow Articles by Nakamura, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Park, W.-R.
Right arrow Articles by Nakamura, Y.
[Cancer Research 65, 1197-1206, February 15, 2005]
© 2005 American Association for Cancer Research


Molecular Biology, Pathobiology and Genetics

p53CSV, a Novel p53-Inducible Gene Involved in the p53-Dependent Cell-Survival Pathway

Woong-Ryeon Park and Yusuke Nakamura

Human Genome Center, Institute of Medical Science, University of Tokyo, Tokyo, Japan

Requests for reprints: Yusuke Nakamura, Laboratory of Molecular Medicine, Human Genome Center, Institute of Medical Science, University of Tokyo, 4-6-1, Shirokanedai, Minato-ku, Tokyo 108-8639, Japan. Phone: 81-3-5449-5373; Fax: 81-3-5449-5433; E-mail: yusuke{at}ims.u-tokyo.ac.jp.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Although a number of p53 target genes have been identified, the mechanisms of p53-dependent activities that determine cellular survival or death are still not fully understood. Here we report isolation of a novel p53 target gene, designated p53-inducible cell-survival factor (p53CSV). p53CSV contains a p53-binding site within its second exon and the reduction of expression by small interfering RNA enhanced apoptosis, whereas overexpression protected cells from apoptosis caused by DNA damage. p53CSV is induced significantly when cells have a low level of genotoxic stresses, but not when DNA damage is severe. p53CSV can modulate apoptotic pathways through interaction with Hsp70 that probably inhibits activity of apoptosis protease activating factor-1. Our results imply that under specific conditions of stress, p53 regulates transcription of p53CSV and that p53CSV is one of the important players in the p53-mediated cell survival.

Key Words: p53CSVp53 target gene • cell-survival gene


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The p53 tumor suppressor gene is more frequently mutated in human cancers than any other cancer-associated genes yet identified; p53 mutations are found in more than half of all cancers examined (1). The wild-type active form of its product exerts its tumor-suppressing functions either by regulating cell-cycle arrest and DNA repair or by inducing apoptosis (2), depending on the specific transcriptional targets that are activated. Although the selection of transcriptional targets seems to depend on the level of cellular stress and to differ by cell type (3), p53 protein binds to DNA in a sequence-specific manner to activate transcription of genes encoding, for example, p21WAF1, p53R2, MDM2, p53DINP1, p53AIP1, Bax, and GADD45 (4–6). Modification of the p53 molecule is considered to be important in the process of selecting transcriptional targets, but the mechanism for protein modification is still not well understood. Phosphorylation of p53 at Ser15 and Ser20 has been shown to be involved in activating p53 (7). Although the roles of these modifications are not fully characterized, ATM and CHK2 protein are candidates for kinases responsible for phosphorylation of the Ser15 or Ser20 residues of p53, respectively (8, 9). After having a low level of DNA damage, p53 is phosphorylated at residues of Ser15 and Ser20, and promotes binding of p53 to promoters of genes involved in the G1 arrest and DNA repair. However, if DNA damage is severe, Ser46 of p53 is phosphorylated and the modified p53 leads to induction of apoptosis-related genes, such as p53AIP1 (10). Although dozens of p53 target genes involved in p53-dependent tumor suppression (i.e., growth arrest, DNA repair, and apoptosis) have been reported to date, the genetic mechanisms responsible for p53-dependent cell survival after exposure to various genotoxic stresses remains to be elucidated.

Heat shock proteins (HSP) have been highly conserved during evolution. Members of this molecular family are localized in various intracellular organelles, in which they are present as both constitutive and inducible forms (11). Hsp70 can block apoptosis by binding apoptosis protease activating factor-1 (Apaf-1), thereby preventing constitution of the apoptosome complex of Apaf-1, cytochrome c, and caspase-9 (12, 13). Hsp70-Apaf-1 interaction is mediated through a caspase-recruitment domain (11). Recent studies have shown that Hsp70 also modulates the engagement and/or progression of apoptosis induced by a variety of stimuli (14). In addition to its interaction with Apaf-1, Hsp70 exerts a protective effect against apoptosis by targeting one or more steps downstream of caspase-3 (15). Ravagnan et al. (16) have shown that overexpression of Hsp70 protect Apaf-1–/– cells against death induced by serum withdrawal, indicating that Apaf-1 is not the only target of the antiapoptotic action of Hsp70, and against apoptosis mediated by the caspase-independent death effector apoptosis inducing factor, which is a mitochondrial intermembrane flavoprotein (17, 18). Accumulating evidence indicated that Hsp70 acts on multiple levels by suppressing caspase activation or by inhibiting caspase-independent effectors.

Here we report isolation and characterization of a novel p53-inducible gene, p53CSV, which is involved in the p53-dependent cell-survival pathway. We also show the p53-dependent cell-survival mechanism by which p53 can regulate cell-survival activity after genotoxic activity stresses through transcriptional induction of p53CSV. In addition, our data have provided evidence that p53CSV can inhibit apoptosis by interacting with the Hsp70/Apaf-1 complex.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell Lines and Culture Conditions. H1299 (lung carcinoma, p53-null) cells were purchased from the American Type Culture Collection (Manassas, VA). Colon cancer cell lines HCT116 p53 wild-type (p53+/+) and its derivative (p53–/–) were gifts from Dr. B. Vogelstein (Johns Hopkins University, Baltimore, MD). All cells were cultured under conditions recommended by their respective depositors.

Northern Blot Analysis. Total RNAs were extracted from HCT116 p53+/+ and HCT116 p53–/– cells at various time points after treatment with 1 µg/mL of Adriamycin (doxorubicin) or 10 J/m2 of UV radiation. These RNAs were isolated using TRIZOL reagent (Life Technologies, Inc., Gaithersburg, MD) and further purified to polyadenylic acid [poly(A)+] RNA using mRNA purification kits (TAKARA, Otsu, Japan) according to the manufacturers' instructions. A 2-µg aliquot of each poly(A)+ RNA was separated on a 1% agarose gel containing 1x MOPS buffer and 2% formaldehyde and transferred to a nylon membrane. The blots were hybridized with a random-primed 32P-labeled EST (hypothetical protein HSPC132; Unigene accession no. 69499) selected from our microarray as being clearly up-regulated by p53.

Library Screening. To isolate a full-length cDNA of the selected EST, we constructed a cDNA library using poly(A)+ RNA obtained from HCT116 p53+/+ cells treated for 48 hours with Adriamycin and screened 1 x 106 independent colonies of this library using the same cDNA fragment that had served as a probe for Northern blotting.

Induction of Endogenous p53CSV. To examine the expression of p53CSV in response to genotoxic stresses, HCT116 p53+/+ and HCT116 p53–/– cells were seeded 2 x 106 cells per 10-cm dish, treated either with 0, 0.5, 1.0, or 2.0 µg/mL Adriamycin or UV radiation (0-50 J/m2) using a UV cross-linker (Stratagene, La Jolla, CA). After 48 hours, cells were harvested. Total cell lysates were prepared in lysis buffer (1% NP40, 50 mmol/L Tris-HCl (pH 8), 150 mmol/L NaCl, 1% Triton X-100, 1 mmol/L EDTA and complete protease inhibitor mixture (Roche, Basel, Switzerland). The same amounts of total protein in each lane was immunoprecipitated with anti-p53CSV immune globulin that we had prepared by giving rabbits injections of a deduced p53CSV peptide CVQKAIKEKEIPIEGLEF (amino acids 47-64) and purifying the antibody on antigen-affinity columns. The resulting immune complexes were subjected to SDS-PAGE/immunoblotting with anti-p53CSV antibody. The same whole-cell lysates were subjected to SDS-PAGE/immunoblotting with anti-p-Ser46 (polyclonal, Cell Signaling, Beverly, MA), Ser15, 16G8 (monoclonal, Cell Signaling), and anti-p53 antibody (DO-1, Santa Cruz Biochechnology, Santa Cruz, CA). The level of ß-actin serving as a quantity control was detected with monoclonal anti-ß-actin antibody (Sigma, St. Louis, MO).

Chromatin Immunoprecipitation Assay. Chromatin immunoprecipitation (ChIP) assays were done using the acetyl-histone H3 ChIP assay kit (Upstate Biotechnology, Lake Placid, NY) according to the manufacturer's instructions. In brief, HCT116 p53+/+ and HCT116 p53–/– cells (2 x 106 cells) were seeded onto 10-cm dishes 1 day before treatment with 1 µg/mL Adriamycin; 24 hours later, protein and genomic DNA were cross-linked by adding 1% formalin to the medium, and the cultures were incubated for 15 minutes at 37°C. Cells were lysed in 200 µL of SDS lysis buffer with a protease inhibitor mixture, then sonicated to generate DNA fragments 200- to 800-bp long. The sonicated supernatants were diluted, precleared with salmon sperm DNA/protein A-agarose, and immunoprecipitated using monoclonal anti-p53 antibody (DO-7, Sigma) or monoclonal anti-FLAG antibody (M2, Sigma) as a control antibody, at 4°C for 16 hours. The immune complexes were precipitated, washed, and eluted. DNA-protein complexes were reversely cross-linked at 65°C for 5 hours. DNA was recovered by phenol-chloroform extraction and ethanol precipitation and resuspended in 50 µL of TE buffer. One microliter of each sample was used as a template for PCR-amplication (32 cycles) using primers flanking a 520-bp DNA fragment containing a suspected p53-binding site: forward (p53BSF), 5'-AGGATGTGACTGTGCTCTT-3'; reverse (p53BSR), 5'-AGGGGCCCGAAGGCCCAGCC-3'. The p21WAF1 promoter with its p53-binding site was amplified as a positive control.

Luciferase Assay. The 520-bp fragment including the putative wild-type p53BS, CTTCATGTCCGTGCATGCCT, was amplified using the same primers as in the ChIP assay and cloned into pGL3-promoter vectors (Promega, Madison, WI). Wild-type p53BS oligonucleotides corresponding to single copies of the p53CSV p53-binding sequence were annealed and ligated into SacI- and XhoI-digested pGL3-promoter vector. To construct p53BS (mt1 and mt2) vectors, a point mutation ("T") was inserted into the site of the 7th nucleotide ("G") or 14th nucleotide ("C") of p53BS, respectively, using QuickChange site-directed mutagenesis kits (Stratagene). H1299 (p53-null) cells grown in six-well culture plates were cotransfected with one of the reporter constructs (1 µg each), 100 ng of pRL-cytomegalovirus internal control vector, and 200 ng of wild-type p53 or mutant p53, using FuGene 6 Transfection Reagent (Roche). Quantification of luciferase activities and calculations of relative ratios were carried out manually with a luminometer.

Construction of psiU6BX3.0. Because the U6siRNA gene is transcribed by RNA polymerase III, producing short transcripts with uridines at the 3' end, we amplified the genomic fragment containing the promoter region of U6siRNA using primers 5'-GGGGATCAGCGTTTGAGTAA-3' and 5'-TAGGCCCCACCTCCTTCTAT-3', with human placental DNA as a template. The product was purified and cloned into pCR2.1 plasmid vector using a TA cloning kit according to the supplier's protocol (Invitrogen, San Diego, CA). The BamHI, XhoI fragment containing U6siRNA was purified and cloned into pcDNA3.1+ between nucleotides 56 and 1,257; this fragment was amplified by PCR using primers 5'-TGCGGATCCAGAGCAGATTGTACTGAGAGT-3' and 5'-CTCTATCTCGAGTGAGGCGGAAAGAACCA-3' and subsequently digested with BamHI and XhoI. The ligated DNA was used as the template for PCR with primers 5'-TTTAAGCTTGAAGACTATTTTTACATCAGGTTGTTTTTCT-3' and 5'-TTTAAGCTTGAAGACACGGTGTTTCGTCCTTTCCACA-3'. After the product was digested with HindIII it self-ligated to produce psiU6BX3.0 vector plasmid. Two small interfering RNA (siRNA) expression vectors against p53CSV (psiU6BX-p53CSV, p53CSV-siRNA-U1, and p53CSV-siRNA-U4) were prepared by ligating the following annealed oligos into the BbsI site in the psiU6BX vector: for p53CSV-siRNA-U1: forward, 5'-CACCATTTCTCAAGGGGGACAGCTTCAAGAGAGCTGTCCCCCTTGAGAAAT-3', and reverse, 5'-AAAAATTTCTCAAGGGGGACAGCTCTCTTGAAGCTGTCCCCCTTGAGAAAT-3'; for p53CSV-siRNA-U4: forward, 5'-CACCAGGAGAAAGAGATTCCTATTTCAAGAGAATAGGAATCTCTTTCTCCT-3', and reverse, 5'-AAAAAGGAGAAAGAGATTCCTATTCTCTTGAAATAGGAATCTCTTTCTCCT-3'. A control plasmid, psiU6BX-EGFP, was prepared by cloning double-stranded oligonucleotides of 5'-CACCGGTTCTGGAGAACAACTACTTCAAGAGAGTAGTTGTTCTCCAGAACC-3' and 5'-AAAAGGTTCTGGAGAACAACTACTCTCTTGAAGTAGTTGTTCTCCAGAACC-3' into the BbsI site in the psiU6BX3.0 vector.

Suppression of p53CSV Expression by siRNAs. HCT116 p53+/+ cells (2x 106) were transfected with p53CSV siRNA expression plasmids using Nucleofector solution (Amaxa, Gaithersburg, MD). According to the Nucleofection protocol. Transformants were harvested by trypsin 24 hours after transfection and replated in six-well culture plates (1 x 104 per well). After 24 hours incubation at 37°C, cells were treated with 0.0, 0.2, or 0.5 µg/mL Adriamycin or 20 J/m2 of UV radiation. The p53CSV siRNA transient cells were tested for p53CSV expression by reverse transcription–PCR (RT-PCR) 24 hours after DNA damage. In contrast to the psiU6BX-EGFP control cells, HCT116 p53+/+ cells transfected with p53CSV-siRNA-U4 display a low level of p53CSV expression when p53 is induced by Adriamycin or UV radiation; HCT116 p53+/+ cells transfected with p53CSV-siRNA-U1 had no effect on the expression of p53CSV.

Construction of p53CSV-Expressing Plasmids and Selection of Stable Transformants. The entire coding sequence of p53CSV, with a hemagglutinin (HA) tag at the carboxyl-terminal end, was cloned into EcoRI- and BamHI-digested pcDNA 3.1 vector (pcDNA3.1/C-HA-p53CSV, Invitrogen). DNA sequences of each construct were confirmed by sequencing. H1299 cells (1 x 106) were plated in six-well culture plates 24 hours before transfection of 1 µg of expression vector (pcDNA3.1 or pcDNA3.1/C-HA-p53CSV) using FuGene 6 Transfection Reagent (Roche). Stable transformants were selected in the presence of G418 (Life Technologies, Inc.). Resistant clones (S13, S14, and S16) were expanded and examined for p53CSV expression by PCR or Western blotting using monoclonal anti-HA antibody (rat, Roche). Stable cells (2 x 105) were plated in six-well culture plates 24 hours before treatment of DNA damage. Stable cells were treated with Adriamycin (1 µg/mL) or UV radiation (30 J/m2) for 24 hours, and detection of apoptosis was judged by the results of fluorescence-activated cell-sorting (FACS) analysis. Activation of caspase-9 was determined with cell extracts from the same DNA damaged-stable cells by Western blotting with monoclonal anti-caspase-9 antibody (mouse, MBL, Nagoya, Japan).

Immunofluorescent Staining. One of the clones that stably expressed p53CSV, S16, was replated on poly-D-lysine-coated multiwell chamber slides (Becton Dickinson, San Jose, CA). These cells were incubated in medium containing 70 mmol/L Mito Tracker Red CMXRos (diluted 1:10,000; Molecular Probes, Eugene, OR) for 30 minutes at 37°C, then fixed with 4% paraformaldehyde in PBS, rendered permeable with 0.1% Triton X-100 in PBS for 3 minutes, and covered with blocking solution (3% bovine serum albumin) for 60 minutes at room temperature. Subsequently, the cells were incubated for 1 hour with monoclonal anti-HA antibody, F-7 (diluted 1:500 in blocking solution; Santa Cruz Biochechnology) at room temperature followed by incubation with FITC-conjugated goat anti-mouse secondary antibody diluted 1:1,000, and viewed with an ECLIPSE E600 microscope (Nikon, Tokyo, Japan).

Detection of Apoptosis. Apoptosis was judged by the results of FACS analysis using propidium iodide or Annexin V-FITC apoptosis detection kits (BioVision, Mountain View, CA). For propidium iodide staining, adherent and detached cells were combined 24 hours after DNA damage and fixed overnight with 75% ethanol in PBS at 4°C. After two rinses with PBS, the cells were incubated for 30 minutes with 1 mL of PBS containing 1 mg of boiled RNase at 37°C and stained in 1 mL of PBS containing 50 µg of propidium iodide and analyzed in a flow cytometer (FACScalibur, Becton Dickinson). For the Annexin V-FITC assay, (1 to 5) x 105 cells were collected 24 hours after DNA damage, rinsed twice with PBS, and resuspended in 500 µL of binding buffer. After 5 µL of Annexin V-FITC were added, the cells were incubated at room temperature for 5 minutes in the dark. Annexin V-FITC binding was analyzed by flow cytometry using an FITC-signaling detector.

Semiquantitative RT-PCR Analysis. Total RNAs were isolated with TRIZOL reagent, and cDNAs were synthesized from 10 µg of each RNA preparation using the SuperScriptll preamplification system (Life Technologies, Inc.). The RT-PCR exponential phase was determined on 15 to 30 cycles to allow semiquantitative comparisons among cDNAs developed from identical reactions. Each PCR regime involved a 2-minute initial denaturation step at 94°C followed by 30 cycles (for p53AIP1; primer sequences were designed to amplify the transcript, i.e., nucleotides 137-550), 19 cycles (for p21WAF1), and 25 cycles (for p53CSV; forward primer TATCTTGCAGGAACTGTGTGCTA, reverse AATTTAGGTTCTTCCTCCACAGC), or 15 cycles (for ß2MG) at 94°C for 30 seconds, 55°C-57°C for 30 seconds, and 72°C for 1 minute. All reactions took place in a Gene Amp PCR system 9600 (Perkin-Elmer, Norwalk, CT). The PCR products were separated by electrophoresis on 2% agarose gels.

Immunoprecipitation and Western Blotting. H1299 cells were transfected with the pcDNA3.1/C-HA-p53CSV construct using Lipofectamine 2000 transfection reagent (Invitrogen). After 24 hours incubation at 37°C, cells were treated with/without Adriamycin (1 µg/mL) or exposed with or without UV radiation (10 J/m2) and harvested 24 hours after DNA damage. Whole-cell extracts were prepared in lysis buffer (1% NP40, 50 mmol/L Tris-HCl (pH 8), 150 mmol/L NaCl, 1% Triton X-100, 1 mmol/L EDTA, and Roche complete protease inhibitor mixture) and immunoprecipitated with monoclonal anti-HA-agarose conjugate (Sigma). The resulting immune complexes were specifically eluted with HA peptides and subjected to SDS-PAGE/immunoblotting using murine monoclonal anti-Hsp70 antibody (mouse, Stressgen, Victoria, British Columbia, Canada), rat monoclonal anti-HA antibody (Roche), rabbit polyclonal anti-Apaf-1 antibody (Upstate), or rat monoclonal anti-Apaf-1 (Chemicon, Temecula, CA). The blots were hybridized with horseradish peroxidase–conjugated secondary antibody (Santa Cruz Biotechnology) and signals were detected using the enhanced chemiluminescence method.

Detection of Caspase-9 Activation. Caspase-9 activation was measured in cell extracts prepared from p53-CSV stably expressing H1299 cells (pcDNA3.1/C-HA-p53CSV) or cells transfected with pcDNA3.1 control vector (Mock). Cells were treated with Adriamycin (1 µg/mL) or UV radiation (30 J/m2) for 24 hours and used for Western blot analysis with monoclonal anti-caspase-9 antibody, 5B4 (MBL). Caspase-9 activation was determined in cells that were treated with Adriamycin by FACS analysis using CaspGLOW fluorescein caspase-9 staining kit (BioVision).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Induction of Endogenous p53CSV by DNA Damage. We have been applying cDNA microarray technology to screen human p53 target genes, using mRNA isolated from p53-mutant U373MG cells that were infected with adenovirus designed to express wild-type p53 (Ad-p53) or the lacZ gene (Ad-LacZ), as described previously (19). From among the 9,216 genes screened, we selected one expressed-sequence tag (hypothetical protein HSPC132; Unigene accession no. 69499) for further analysis because it was significantly up-regulated (data not shown) and designated later the corresponding gene p53CSV based on its biological nature described below.

To confirm the results of the microarray analysis, we analyzed Northern blots using mRNA extracted from HCT116 cells with wild-type p53 (HCT116 p53+/+) and from a derivative HCT116 line lacking p53 (HCT116 p53–/–) after both lines had been treated with 1 µg/mL of Adriamycin or exposure to 10 J/m2 of UV radiation. Poly(A)+ RNAs were prepared from the cells at 0, 6, 12, 24, and 48 hours after either of the genotoxic exposures. Northern blots probed with a 509-bp cDNA fragment of the EST revealed a transcript of about 1.2 kb, which was strongly induced in the HCT116 p53+/+ cells under either form of genotoxic stress although no induction was observed in HCT116 p53–/– cells (Fig. 1A). The results implied that p53CSV was induced in a p53-dependent manner in response to DNA damage.



View larger version (41K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Cloning of p53CSV. A, Northern-blot analysis of p53CSV expression in HCT116 p53+/+ and it HCT116 p53–/– cells at various time points after treatment with Adriamycin (ADR) or after exposure to UV radiation (UV). Levels of p21WAF1 and ß-actin mRNA served as a positive control and as a quantitative control, respectively. B, predicted amino acid sequence of p53CSV. C, p53-dependent induction of endogenous p53CSV protein in HCT116 p53+/+ after exposure to DNA damage for 48 hours. The same amounts of total protein in each lane was immunoprecipitated and subjected to immunoblotting with anti-p53CSV antibody (top). Induction of p53 was detected by monoclonal anti-p53 antibod Santa Cruz Biotechnology) using whole-cell lysates from DNA-damaged cells (middle). ß-actin served as a quantitative control (bottom).

 
To isolate a full-length cDNA of the p53CSV gene we constructed cDNA library using poly(A)+ RNA from the HCT116 p53+/+ cells treated with Adriamycin. We obtained 30 positive clones by screening this library and determined their DNA sequences. The major transcript consisted of 1,174 nucleotides encoding a 76-amino-acid peptide (Fig. 1B). By comparing the cDNA sequence with genomic sequences we determined that the gene spans a 2.4-kb genomic region and consists of two exons.

We generated a polyclonal anti-p53CSV antibody in rabbits to investigate expression of endogenous p53CSV in response to various genotoxins. HCT116 p53+/+ and HCT116 p53–/– cells were treated with either Adriamycin or UV exposure, and cell lysates were isolated 48 hours later. Immunoprecipitation and SDS-PAGE/immunoblotting with anti-p53CSV antibody confirmed that p53CSV was strikingly induced in HCT116 p53+/+ cells by DNA damage, as was p53 protein, but the proteins were not increased in HCT116 p53–/– cells after either type of damage (Fig. 1C).

p53CSV as a Direct Target of p53. To understand the molecular basis for regulation of p53CSV by p53, we searched for possible p53-binding sites (p53BS) within its genomic sequence and found a potential p53BS of 20 nucleotides in exon 2 of the p53CSV gene (Fig. 2A). We examined p53 protein for interaction with this p53BS by ChIP assays, using cell lysates prepared from HCT116 p53+/+ cells or HCT116 p53–/– cells treated with 1 µg/mL of Adriamycin. An anti-p53 antibody precipitated a genomic fragment of p53CSV, which included the potential p53BS in exon 2, as a p53 protein-DNA complex from lysates of HCT116 p53+/+ cells, implying that endogenous p53 had interacted with the candidate p53BS. On the other hand, this DNA segment was not precipitated from HCT116 p53–/– lysates (Fig. 2B).



View larger version (15K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. p53CSV as a direct target of p53. A, a potential p53-binding site in exon 2 (p53BS) and its DNA sequence. The consensus p53-binding sequence is shown below it. R, purine; Y, pyrimidine; W, A or T. B, ChIP assay using HCT116 p53+/+ and HCT116 p53–/– cells treated with 1 µg/mL Adriamycin (ADR). Cells were harvested 24 hours after treatment, lysed, and sonicated and p53 was immunoprecipitated with monoclonal anti-p53 antibody (DO-7). Control precipitations were carried out without antibody (lanes 3 and 8) or with monoclonal anti-FLAG antibody (M2) in Adriamycin-treated cells (lanes 5 and 10), or monoclonal anti-p53 antibody (DO-7) in parental cells (lanes 2 and 7). Input chromatin represents a portion of the sonicated chromatin before immunoprecipitation (lanes 1 and 6). C, luciferase assay. Plasmid constructs containing 520-bp DNA fragment corresponding to exon 2 of the p53CSV gene including p53-binding site [p53BS (wt)] or the same 520-bp fragment containing mutated p53BS (mt1 or mt2) were cloned into a luciferase reporter vector containing SV40 minimal promoter. H1299 cells (p53-null) were cotransfected with the indicated reporter constructs, with pRL-cytomegalovirus as an internal control vector and with plasmids designed to express either wild-type (wt) or mutant (mt) p53 and the p53-binding site [p53BS (wt)], or the same 520-bp fragment containing mutated p53BS (mt1 or mt2). Cells were harvested 24 hours after transfection and lysed. Quantification of luciferase activities and calculations of relative ratios were carried out manually with a luminometer. Columns, mean values of the results of three experiments; bars, ±SD.

 
To confirm interaction, we examined the p53BS for p53-dependent transcriptional activity using a heterologous reporter assay. The reporter vector was constructed by cloning the 520-bp DNA fragment containing the p53BS (wt), or the same 520-bp fragment containing 1-nucleotide substitutions (p53BS mt1 or p53BS mt2), upstream of the minimal SV40 promoter in the pGL3 vector (Luc-p53BS-pro). Transfection of the Luc-p53BS (wt)-pro, Luc-p53BS (mt1 or mt2)-pro, or the Luc-p53BS-pro alone into H1299 cells (lung cancer line, p53-null) revealed no enhancement of luciferase activity. However, we observed a >20-fold increase in relative luciferase activity when we cotransfected the Luc-p53BS (wt)-pro with the plasmid expressing wild-type p53. Plasmids containing Luc-p53BS (mt1 or mt2)-pro did not show any increase in the wild-type p53-dependent transcriptional activity, further supporting the idea that the p53BS in exon 2 of the p53CSV gene is a functional p53-binding sequence (Fig. 2C).

Requirement of p53CSV for p53-Mediated Cell Survival. To investigate the biological function of p53CSV in the p53-dependent cell response, we applied RNA-interference technology to suppress expression of p53CSV. Using psiU6BX3, an expression vector for siRNA, we constructed a p53CSV-siRNA vector and introduced it into HCT116 p53+/+ cells. When p53 was induced in the HCT116 p53+/+ cells by Adriamycin treatment (0.2 or 0.5 µg/mL) or UV radiation (20 J/m2), induction of p53CSV expression was significantly lower in the cells transfected with p53CSV-siRNA-U4 than in cells transfected with a control plasmid (corresponding to the DNA sequence of EGFP) or with p53CSV-siRNA-U1 (a negative control of p53CSV-siRNA construct; Fig. 3A). Furthermore, in contrast to the HCT116 p53+/+-EGFP control cells and HCT116 p53+/+-p53CSV siRNA-U1 cells in which expression of p53CSV was not suppressed, HCT116 p53+/+-p53CSV siRNA-U4 cells were highly susceptible to cell death caused by Adriamycin (Fig. 3B and C) or UV radiation (Fig. 3D).



View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Requirement of p53CSV for p53-mediated cell survival. A, reduction of p53CSV transcription by introduction of p53CSV siRNA into HCT116 p53+/+ cells. HCT116 p53+/+ cells were transfected with siRNA-expressing vectors and treated with Adriamycin (0.0, 0.2, or 0.5 µg/mL, ADR, lanes 1-7) or exposure to UV radiation (20 J/m2, UV, lanes 8-9) 48 hours after the transfection. Semiquantitative RT-PCR experiments to measure expression of p53CSV were done 24 hours after DNA damage. B, apoptosis of H1299 cells with or without p53CSV siRNA after DNA damage by Adriamycin (ADR). C, graphic representation of results shown in B, for apoptosis induced by 0.5 µg/mL of Adriamycin. D, apoptosis of HCT116 p53+/+cells with or without p53CSV siRNA after exposure to UV radiation. Proportions of apoptotic cells are indicated as percentages of the sub-G1 fraction in FACS analysis. Columns, means of three independent experiments; bars, SD. P < 0.03 (C and D) compared with siRNA-U4; Student-Newman-Keuls t test.

 
To examine the molecular mechanism by which p53CSV participates in the cell-survival process, we constructed a plasmid, pcDNA3.1/C-HA-p53CSV, designed to express p53CSV with an HA tag at its carboxyl-terminal end. We transfected this plasmid DNA into H1299 (p53-null) cells, and selected three clones that stably expressed the gene (H1299/p53CSV S13, S14, and S16). The stable transfectants were checked for p53CSV expression by immunocytochemistry (Fig. 4A) and Western blotting with monoclonal anti-HA antibody (Fig. 4B). S13, S14, and S16, all showing high levels of ectopic p53CSV expression, were highly resistant to cell death by Adriamycin treatment (Fig. 4C and D) or UV radiation (Fig. 4E). In contrast, the proportions of apoptotic cells of pcDNA3.1 control cultures (Mock) were markedly reduced in all of the stable clones treated with Adriamycin or UV radiation. These results supported the view that p53CSV functions as a cell-survival mediator in the cellular response to DNA damage.



View larger version (31K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. Apoptosis of DNA-damaged H1299 cells with or without ectopic p53CSV. A and B, ectopic expression of p53CSV in H1299 cells transfected with either pcDNA3.1 or a pcDNA3.1/C-HA-p53CSV construct designed to express HA-tagged p53CSV, and selected for stable clones (S13, S14, and S16). Immunofluorescent staining (A, green, HA-tagged p53CSV) and Western analysis (B) of p53CSV protein expression examined using anti-HA monoclonal antibody. C, apoptosis among cells stably expressing p53CSV after treatment with 1 µg/mL Adriamycin. In contrast to pcDNA3.1-control cells (Mock), proportions of apoptotic cells are markedly reduced in all of the stable cells treated with Adriamycin. Black, control cells without Adriamycin; green, control cells treated with Adriamycin; yellow, stable clones without Adriamycin treatment; red, stable clones treated with Adriamycin. D, graphic representation of the results in C. E, apoptosis of stable clones after UV radiation (UV, 30 J/m2). Proportions of apoptotic cells are indicated as percentages of the Annexin V-FITC-positive cell fraction in FACS analysis. Means ± SD of three independent experiments. P < 0.03 (D and E) compared with Mock (D, ADR; E, UV), Student-Newman-Keuls t test. F, subcellular localization of p53CSV protein in a p53CSV-stable clone, S16, where HA-tagged p53CSV was stained with monoclonal anti-HA antibody (F-7, green) and Mito Tracker Red CMXRos (red).

 
Immunohistochemical analysis of stable transfectants S16 (Fig. 4F), S13, and S14 (data not shown) indicated that p53CSV was strongly stained in the perinuclear region and appeared as a dotted pattern in cytoplasm. When we counterstained the cells using a Mito Tracker (red), the green signal of p53CSV coincided exactly with the red signals of mitochondria.

Correlation of p53CSV Induction with p53-Mediated Cell Survival. We then investigated dose-dependent effects of Adriamycin on the induction of p53CSV and other p53 target genes. Induction of p53CSV mRNA was detected at the high level in cells treated with 1 µg/mL or less; this result was strikingly similar to that for p21WAF1 but not for p53AIP1, whose product is involved in apoptosis (ref. 10; Fig. 5A). At a higher dose (2 µg/mL) of Adriamycin, expression of p53CSV mRNA decreased and the percentage of apoptotic cells increased (Fig. 5B). We subsequently examined whether different modification of p53 by phosphorylation could affect induction of p53CSV. HCT116 p53–/– and HCT116 p53+/+ cells were damaged with Adriamycin at a dose ranging from 0.5 to 2 µg/mL. Western blot analysis indicated that a high dose of Adriamycin could phosphorylate p53-Ser46, whereas phosphorylation at p53-Ser15 was detected even at low doses of Adriamycin. FACS analysis showed that apoptosis could be induced only at a high dose of Adriamycin. As shown in Fig. 5C, levels of p53CSV protein in HCT116 p53+/+ lysates examined by Western blotting were concordant with mRNA levels. Hence, induction of p53CSV seemed to be associated with phosphorylation of p53-Ser15 but not that of p53-Ser46. These data suggested expression of p53CSV is induced when DNA damage is low and reparable and is strictly controlled by p53 protein with the specific modification(s). Similarly, expression of endogenous p53CSV was detected after exposure to 10 to 30 J/m2 of UV radiation (Fig. 5D), but levels of its expression after that at doses higher than 30 J/m2, by which phosphorylation of p53 at Ser46 was induced, were significantly lower or absent. Taken together, these results suggested that expression of p53CSV is correlated with the cell-survival function (cell-cycle arrest and/or repair of damaged DNA) of p53, but is different from the induction pattern of p53AIP1 that plays an important role in mediating p53-dependent apoptosis.



View larger version (32K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Correlation of p53CSV induction with p53-mediated cell survival. A, induction of p53CSV, p53AIP1, and p21WAF1 genes 48 hours after treatment of HCT116 p53+/+ cells with Adriamycin at different dosages. RT-PCR analysis was done as described in Materials and Methods. B, population of apoptotic cells detected using FACS analysis 48 hours after Adriamycin treatment. C and D, expression of p53CSV protein 48 hours after Adriamycin treatment or UV radiation. Cell lysates isolated from DNA-damaged HCT116 p53+/+ or HCT116 p53–/– cells were analyzed by immunoprecipitation and immunoblotting using anti-p53CSV, anti-p-Ser46, and anti-p-Ser15 of p53 antibody. Peak levels of p53CSV occurred at 0.5 to 1.0 µg/mL for Adriamycin (C), and at 10 to 20 J/m2 for UV radiation (D). Bottom, levels of ß-actin show that the same amounts of total protein in each lane were subjected to immunoprecipitation with anti-p53CSV antibody.

 
p53CSV Interaction with Hsp70/Apaf-1. To examine how p53CSV functions in cell survival, we searched for interacting proteins by immunoprecipitation pull-down and peptide mass fingerprint analyses (Shimadzu Biotech Corporation, Nagano, Japan) and identified a heat shock protein with a relative molecular mass of 70,000 (Hsp70). To confirm interaction between these two molecules, a coimmunoprecipitation assay was done to explore whether p53CSV was associated with endogenous Hsp70 in lysates of H1299 (p53-null) cells transfected with HA-p53CSV, a vector designed to express p53CSV containing an HA tag at the carboxyl-terminal end. Immune complexes were recovered by immunoprecipitation using monoclonal anti-HA conjugated agarose and subjected to SDS-PAGE and immunoblotting using monoclonal anti-Hsp70 antibody or monoclonal anti-HA antibody (Fig. 6A). Hsp70 was recovered in association with the anti-HA immune complexes prepared from the HA-p53CSV-expressing H1299 cells but not from the control H1299-mock (pcDNA3.1 vector as a negative control) cells. Similar results were obtained from immunoprecipitation experiments using monoclonal anti-Hsp70 antibody coupled with SDS-PAGE/immunoblotting using monoclonal anti-HA antibody. HA-p53CSV was recovered in association with the anti-Hsp70 immune complexes prepared from the HA-p53CSV-expressing H1299 cells but not from the control H1299-mock cells.



View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. Intracellular association of p53CSV and Hsp70/ Apaf-1. A, coimmunoprecipitation assay using monoclonal anti-HA-conjugated agarose (anti-HA, left) or monoclonal anti-Hsp70 antibody (anti-Hsp70, right) on H1299 cells overexpressing p53CSV or Mock. Bottom, the same amount of total endogenous Hsp70 protein was expressed in either population of H1299 cells. B, coimmunoprecipitation of p53CSV with three other apoptotic or antiapoptotic molecules. Although the same amounts of Apaf-1, Hsp70, and cytochrome c were produced in H1299 cells that overexpressed p53CSV or not (lanes 1-6, left), Apaf-1 and Hsp70 were precipitated with monoclonal anti-HA-conjugated agarose only from H1299 cells overexpressing p53CSV (lanes 4-6, right) 48 hours after DNA damage. C, coimmunoprecipitation of endogenous p53CSV and Hsp70/Apaf-1 after DNA damage. Interaction between endogenous Hsp70 and endogenous p53CSV was examined by immunoprecipitation experiments. HCT116 p53–/– and HCT116 p53+/+ cells were treated with 1 µg/mL Adriamycin or exposed to 10 J/m2 UV radiation for 48 hours to induce p53CSV expression, and cell lysates were prepared for immunoprecipitation using anti-p53CSV antibody before Western blotting with antibody against Hsp70 or Apaf-1 or p53CSV. Coimmunoprecipitation of endogenous p53CSV and Hsp70/ Apaf-1 was clearly observed in DNA-damaged HCT116 p53+/+ cells (lanes 5-6 in each case), but not HCT116 p53–/– cells (lanes 2-3 in each case). D, interaction between p53CSV and Hsp70/Apaf-1 was also confirmed by reverse immunoprecipitation experiments with monoclonal anti-Hsp70 antibody. p53CSV (lanes 5-6, top) and Apaf-1 (lanes 5-6, middle) precipitated with monoclonal anti-Hsp70 antibody (bottom) in cell extracts isolated from DNA-damaged HCT116 p53+/+ cells but not HCT116 p53–/– cells (lanes 2-3 in each case).

 
Two groups (12, 13) have shown that Hsp70 inhibits apoptosis through direct binding to Apaf-1, thereby precluding the eventual recruitment of procaspase-9 to the apoptosome. We investigated whether p53CSV was associated with Apaf-1 and cytochrome c, using a coimmunoprecipitation assay. Apaf-1 was recovered in association with the anti-HA immune complexes prepared from the HA-p53CSV-expressing H1299 cells, whereas cytochrome c was not (Fig. 6B).

To investigate interaction between Hsp70/Apaf-1 complex and the product of endogenous p53CSV induced by DNA damage, we did coimmunoprecipitation experiments using anti-p53CSV antibody in cell lysates extracted from HCT116 p53+/+ or HCT116 p53–/– cells that had been treated with Adriamycin or exposed to UV radiation. As shown in Fig. 6C, Hsp70 and Apaf-1 proteins were clearly co-immunoprecipitated in lysates isolated from HCT116 p53+/+ cells after damage. However, Hsp70 and Apaf-1 was not immunoprecipitated using lysates of HCT116 p53–/– cells. Moreover, both p53CSV and Apaf-1 were precipitated by monoclonal anti-Hsp70 antibody in lysates isolated from damaged HCT116 p53+/+ cells (Fig. 6D). These results indicate that p53CSV can bind Hsp70 and/or Apaf-1. The physical interaction between p53CSV and Hsp70 and/or Apaf-1 has been revealed in overexpression of p53CSV. A functional interaction between endogenous p53CSV and Hsp70 and/or Apaf-1 occurred by DNA damage in HCT116 p53+/+ cells but not HCT116 p53–/– cells.

p53CSV Inhibits Activation of Caspase-9. We then examined whether p53CSV affected caspase-9 activation using Western blot analysis with monoclonal anti-caspase-9 antibody. As shown in Fig. 7A, cleaved (activated) caspase-9 in pcDNA3.1 control cells (Mock) was induced by Adriamycin or UV radiation, whereas induction of cleaved caspase-9 was significantly suppressed in UV-radiated or Adriamycin-treated S13 and S16 stable cells. Moreover, we transfected a HA-tagged p53CSV expression construct, HA-p53CSV, into H1299 cells, and determined whether HA-p53CSV overexpression had an effect on DNA damage–mediated activation of caspase-9. As shown in Fig. 7B, HA-p53CSV overexpression resulted in inhibition of DNA damage–mediated activation of caspase-9, compared with the cells transfected with pcDNA3.1 control vector (Mock). FACS analysis of p53CSV-expressing cells at 24 hours after treatment of Adriamycin clearly indicated inhibition of caspase-9 activation by p53CSV, comparing cells transfected with mock vector (Fig. 7C). These results strongly imply that p53CSV inhibits activation of procaspase-9, which in turn prevents the induction of apoptosis during by DNA damage.



View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 7. Inhibition of DNA-damaged activation of caspase-9 by p53CSV. A, caspase-9 activation was determined with cell extracts from stable cells treated with Adriamycin (1 µg/mL; ADR, lanes 2, 5, and 8) or UV radiation (30 J/m2; UV, lanes 3, 6, and 9) for 24 hours using Western blot analysis with monoclonal anti-caspase-9 antibody. B, H1299 cells were transfected with pcDNA3.1/C-HA-p53CSV or pcDNA3.1 control vector (Mock); 24 hours after transfection, cells were treated with Adriamycin (1 µg/mL; ADR, lanes 1, 4) for 24 hours, and then cell lysates were prepared for Western blotting with antibody against caspase-9. C, caspase-9 activation was determined in p53CSV stably expressing cells that were treated with Adriamycin for 24 hours by means of FACS analysis with FITC label that allows detection of activated caspase-9 directly (BioVision). Proportions of caspase-9-activated cells were indicated as percentages of the shifting fraction to the negative control, ADR (–), in FACS analysis.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The p53 gene product has two major biological functions against DNA damage: to cause cell-cycle arrest and repair damaged DNA for cell survival or to cause apoptosis for cell death. We have shown here that p53CSV, a novel direct transcriptional target for p53, functions as a cell-survival mediator in the cellular response to DNA damage.

Modifications of p53 by phosphorylation or acetylation play important roles in regulating biological activities of p53 (20). Moreover, it has been shown that phosphorylation of p53 at Ser46 induced apoptosis. Our data suggest that modification of p53 leading to expression of p53CSV in the cell-survival pathway after DNA damage is likely to be different from that leading to expression of apoptosis-related genes (Fig. 5C and D). If DNA damage is severe and unreparable, expression of p53CSV is not induced.

Our results using cells stably expressing a high level of p53CSV or siRNA for p53CSV implied that p53CSV is possibly required for cell-survival pathway through activation of p53. Bcl-2 interacts with Bax and blocks Bax-induced apoptosis (21, 22). We therefore immunoprecipitated with monoclonal anti-HA antibody in cell lysates extracted from stable cells of p53CSV (S13, S14, and S16) that had been treated with Adriamycin or exposed to UV radiation, and then did immunoblotting with anti-Bcl-2 antibody, anti-Bax antibody, or anti-Bcl-xL antibody. However, no interaction of p53CSV with any of these three proteins was detectable (data not shown). Thus, the function of p53CSV as a cell-survival mediator in the cellular response to DNA damage is not correlated with the Bcl-2 family.

To further study the function of p53CSV as a cell-survival mediator, we identified Hsp70 protein as interaction protein with p53CSV. Furthermore, our data indicate that the involvement of p53CSV in the antiapoptotic pathway might be explained by interaction of this protein with Apaf-1 through binding to Hsp70. Disruption of the outer mitochondrial membrane by apoptotic stimuli results in the release of cytochrome c, which can bind to cytosolic Apaf-1 (23). Subsequent activation of caspase-9 by association with cytochrome c and Apaf-1 can amplify the caspase cascade and enhance its ability to process its own proenzyme as well as the effector caspase-3 (24, 25). Association of procaspase-9 with Apaf-1 is an essential step in the initial activation of this cascade (26). The ability of Hsp70 to block formation of the Apaf-1/procaspase-9 complex may promote survival and transformation during oncogenesis. In fact, increased expression of Hsp70 is observed in a variety of tumor types and is linked to increased oncogenic potential in vivo (27). Taken together with these reports, our experiments indicate that p53CSV may associate with Hsp70/Apaf-1 and inhibit activation of procaspase-9 and procaspase-3.

A large number of oncogenes, tumor suppressor genes, and signal transduction pathways in angiogenesis/tumorigenesis have been described (28). Among them, recent studies have provided evidences that p53 activate mitogen-activated protein kinase and AKT survival signaling through its targets including DDR1 and Cox-2, although the mechanism of their activation remains to be clarified (29, 30) . Here, our study has revealed an interesting connection between p53CSV, a novel p53 target gene that encodes a cell-survival factor, and apoptotic or antiapoptotic machinery involving Apaf-1 and/or Hsp70.


    Acknowledgments
 
Grant support: Research for the Future Program grant 00L01402 from the Japan Society for the Promotion of Science.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 10/ 6/04. Revised 11/21/04. Accepted 12/ 3/04.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hollstein M, Rice K, Greenblatt MS, et al. Database of p53 gene somatic mutations in human tumors and cell lines. Nucleic Acids Res 1994;22:3551–5.
  2. Hupp TR, Lane DP, Ball KL. Strategies for manipulating the p53 pathway in the treatment of human cancer. Biochem J 2000;352:1–17.
  3. Zhao R, Gish K, Murphy M, et al. Analysis of p53-regulated gene expression patterns using oligonucleotide arrays. Genes Dev 2000;14:981–93.[Abstract/Free Full Text]
  4. el-Deiry WS, Kern SE, Pietenpol JA, Kinzler KW, Vogelstein B. Definition of a consensus binding site for p53. Nat Genet 1992;1:45–9.[CrossRef][Medline]
  5. Levine AJ. p53, the cellular gatekeeper for growth and division. Cell 1997;88:323–31.[CrossRef][Medline]
  6. Nakamura Y. Isolation of p53-target genes and their functional analysis. Cancer Sci 2004;95:7–11.[CrossRef][Medline]
  7. Shieh SY, Ahn J, Tamai K, Taya Y, Prives C. The human homologs of checkpoint kinases Chk1 and Cds1 (Chk2) phosphorylate p53 at multiple DNA damage-inducible sites. Genes Dev 2000;14:289–300.[Abstract/Free Full Text]
  8. Sarkaria JN, Busby EC, Tibbetts RS, et al. Inhibition of ATM and ATR kinase activities by the radiosensitizing agent, caffeine. Cancer Res 1999;59:4375–82.[Abstract/Free Full Text]
  9. Hirao A, Kong YY, Matsuoka S, et al. DNA damage-induced activation of p53 by the checkpoint kinase Chk2. Science 2000;287:1824–7.[Abstract/Free Full Text]
  10. Oda K, Arakawa H, Tanaka T, et al. p53AIP1, a potential mediator of p53-dependent apoptosis, and its regulation by Ser-46-phosphorylated p53. Cell 2000;102:849–62.[CrossRef][Medline]
  11. Lindquist S, Craig EA. The heat shock proteins. Annu Rev Genet 1988;22:631–77.[CrossRef][Medline]
  12. Saleh A, Srinivasula S, Balkir L, Robbins PD, Alnemri ES. Negative regulation of the Apaf-1 apoptosome by Hsp70. Nat Cell Biol 2000;2:476–83.[CrossRef][Medline]
  13. Beere HM, Wolf BB, Cain K, et al. Heat-shock protein 70 inhibits apoptosis by preventing recruitment of procaspase-9 to the Apaf-1 apoptosome. Nat Cell Biol 2000;2:469–75.[CrossRef][Medline]
  14. Samali A, Orrenius S. Heat shock proteins: regulators of stress response and apoptosis. Cell Stress Chaperones 1998;3:228–36.[CrossRef][Medline]
  15. Jaattela M, Wissing D, Kokholm K, Kallunki T, Egeblad M. Hsp70 exerts its anti-apoptotic function downstream of caspase-3-like proteases. EMBO J 1998;17:6124–34.[CrossRef][Medline]
  16. Ravagnan L, Gurbuxani S, Susin SA, et al. Heat-shock protein 70 antagonizes apoptosis-inducing factor. Nat Cell Biol 2001;3:839–43.[CrossRef][Medline]
  17. Susin SA, Lorenzo HK, Zamzami N, et al. Molecular characterization of mitochondrial apoptosis-inducing factor. Nature 1999;397:441–6.[CrossRef][Medline]
  18. Joza N, Susin SA, Daugas E, et al. Essential role of the mitochondrial apoptosis-inducing factor in programmed cell death. Nature 2001;410:549–54.[CrossRef][Medline]
  19. Ono K, Tanaka T, Tsunoda T, et al. Identification by cDNA Microarray of genes involved in ovarian carcinogenesis. Cancer Res 2000;60:5007–11.[Abstract/Free Full Text]
  20. Giaccia AJ, Kastan MB. The complexity of p53 modulation: emerging patterns from divergent signals. Genes Dev 1998;12:2973–83.[Free Full Text]
  21. Oltvai ZN, Milliman CL, Korsmeyer SJ. Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death. Cell 1993;74:609–19.[CrossRef][Medline]
  22. Yin XM, Oltvai ZN, Korsmeyer SJ. BH1 and BH2 domains of Bcl-2 are required for inhibition of apoptosis and heterodimerization with Bax. Nature 1994;369:321–3.[CrossRef][Medline]
  23. Goldstein JC, Waterhouse NJ, Juin P, Evan GI, Green DR. The coordinate release of cytochrome c during apoptosis is rapid, complete and kinetically invariant. Nat Cell Biol 2000;2:156–62.[CrossRef][Medline]
  24. Li P, Nijhawan D, Budihardjo I, et al. Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade. Cell 1997;91:479–89.[CrossRef][Medline]
  25. Saleh A, Srinivasula SM, Acharya S, Fishel R, Alnemri ES. Cytochrome c and dATP-mediated oligomerization of Apaf-1 is a prerequisite for procaspase-9 activation. J Biol Chem 1999;274:17941–5.[Abstract/Free Full Text]
  26. Qin H, Srinivasula SM, Wu G, Fernandes-Alnemri T, Alnemri ES, Shi Y. Structural basis of procaspase-9 recruitment by the apoptotic protease-activating factor 1. Nature 1999;399:549–57.[CrossRef][Medline]
  27. Jaattela M. Escaping cell death: survival proteins in cancer. Exp Cell Res 1999;248:30–43.[CrossRef][Medline]
  28. Arbiser JL. Molecular regulation of angiogenesis and tumorigenesis by signal transduction pathways: evidence of predictable and reproducible patterns of synergy in diverse neoplasms. Semin Cancer Biol 2004;14:81–91.[CrossRef][Medline]
  29. Ongusaha PP, Kim JI, Fang L, et al. p53 induction and activation of DDR1 kinase counteract p53-mediated apoptosis and influence p53 regulation through a positive feedback loop. EMBO J 2003;22:1289–301.[CrossRef][Medline]
  30. Han JA, Kim JI, Ongusaha PP, et al. p53-mediated induction of Cox-2 counteracts p53- or genotoxic stress-induced apoptosis. EMBO J 2002;21:5635–44.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Integr Cancer TherHome page
P. K. Singh, R. Kumar, A. Sharma, R. Arora, R. Chawla, S. K. Jain, and R. K. Sharma
Podophyllum hexandrum Fraction (REC-2006) Shows Higher Radioprotective Efficacy in the p53-Carrying Hepatoma Cell Line: A Role of Cell Cycle Regulatory Proteins
Integr Cancer Ther, September 1, 2009; 8(3): 261 - 272.
[Abstract] [PDF]


Home page
Cancer Res.Home page
W. Yan and X. Chen
Targeted Repression of Bone Morphogenetic Protein 7, a Novel Target of the p53 Family, Triggers Proliferative Defect in p53-Deficient Breast Cancer Cells
Cancer Res., October 1, 2007; 67(19): 9117 - 9124.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
N. Anensen, A. M. Oyan, J.-C. Bourdon, K. H. Kalland, O. Bruserud, and B. T. Gjertsen
A Distinct p53 Protein Isoform Signature Reflects the Onset of Induction Chemotherapy for Acute Myeloid Leukemia.
Clin. Cancer Res., July 1, 2006; 12(13): 3985 - 3992.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. M. Hearnes, D. J. Mays, K. L. Schavolt, L. Tang, X. Jiang, and J. A. Pietenpol
Chromatin Immunoprecipitation-Based Screen To Identify Functional Genomic Binding Sites for Sequence-Specific Transactivators
Mol. Cell. Biol., November 15, 2005; 25(22): 10148 - 10158.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Park, W.-R.
Right arrow Articles by Nakamura, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Park, W.-R.
Right arrow Articles by Nakamura, Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online