This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Narla, G. Articles by Martignetti, J. A. Search for Related Content PubMed PubMed Citation Articles by Narla, G. Articles by Martignetti, J. A.

A Germline DNA Polymorphism Enhances Alternative Splicing of the KLF6 Tumor Suppressor Gene and Is Associated with Increased Prostate Cancer Risk

Departments of ¹ Medicine and ² Human Genetics, Mount Sinai School of Medicine, New York, New York; ³ Departments of Health Sciences Research and ⁴ Laboratory Medicine and Pathology, Mayo Clinic Foundation, Rochester, Minnesota; ⁵ Brady Urological Institute, Johns Hopkins Medical Institution, Baltimore, Maryland; ⁶ Divisions of Clinical Human Biology and ⁷ Public Health Sciences, Fred Hutchinson Cancer Research Center, Seattle, Washington; ⁸ Department of Pathology, University of Michigan Medical School, Ann Arbor, Michigan; ⁹ Department of Pathology, Harvard Medical School, Brigham and Women's Hospital, Boston, Massachusetts; and ¹⁰ Center for Human Genomics, Wake Forest University School of Medicine, Winston-Salem, North Carolina

Requests for reprints: John A. Martignetti, Department of Human Genetics, Mount Sinai School of Medicine, 1425 Madison Avenue, New York, NY 10029. Phone: 212-659-6744; Fax: 212-849-2638; E-mail: john.martignetti{at}mssm.edu.

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Prostate cancer is a leading and increasingly prevalent cause of cancer death in men. Whereas family history of disease is one of the strongest prostate cancer risk factors and suggests a hereditary component, the predisposing genetic factors remain unknown. We first showed that KLF6 is a tumor suppressor somatically inactivated in prostate cancer and since then, its functional loss has been further established in prostate cancer cell lines and other human cancers. Wild-type KLF6, but not patient-derived mutants, suppresses cell growth through p53-independent transactivation of p21. Here we show that a germline KLF6 single nucleotide polymorphism, confirmed in a tri-institutional study of 3,411 men, is significantly associated with an increased relative risk of prostate cancer in men, regardless of family history of disease. This prostate cancer–associated allele generates a novel functional SRp40 DNA binding site and increases transcription of three alternatively spliced KLF6 isoforms. The KLF6 variant proteins KLF6-SV1 and KLF6-SV2 are mislocalized to the cytoplasm, antagonize wtKLF6 function, leading to decreased p21 expression and increased cell growth, and are up-regulated in tumor versus normal prostatic tissue. Thus, these results are the first to identify a novel mechanism of self-encoded tumor suppressor gene inactivation and link a relatively common single nucleotide polymorphism to both regulation of alternative splicing and an increased risk in a major human cancer.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Prostate cancer is among the most prevalent neoplasms worldwide and is the second leading cause of male cancer–related death in the United States. Incidence is expected to double among men over the age of 65 in the next 25 years (1). Despite progress in identifying the molecular pathways involved in other major cancers (2, 3), few candidate prostate cancer–associated genes have emerged (4). One approach to identify prostate cancer genes has focused on the use of linkage studies in hereditary prostate cancer families. Three notable candidate genes have however been identified: HPC2/ELAC2 (5), RNASEL (6), and MSR1 (7); yet, their effect has been limited at best to only a small subset of familial cases and susceptibility alleles are rare in the general population (8). Nonetheless, epidemiologic and molecular studies suggest that relatively common inherited genetic risks do exist and that prostate cancer, and indeed all common cancers and complex diseases, arise from the combined interplay of many genes, each having its own modest effect. Thus, targeted analysis of candidate genes having maximal biological plausibility represents another approach to identify these high-frequency, low-penetrance prostate cancer genes and their germline sequence variants.

KLF6, a Kruppel-like zinc finger transcription factor, is a tumor suppressor gene inactivated by allelic loss and somatic mutation in men with sporadic prostate cancer (9, 10). Recently, KLF6 gene mutations have also been identified in other human cancers, including colorectal cancer (11), malignant glioma (12), and nasopharyngeal carcinoma (13). Additional inactivating mechanisms include transcriptional silencing by promoter hypermethylation in esophageal cancer cell lines (14) and down-regulation of KLF6 mRNA levels in both primary lung cancer samples (15, 16) and in prostate cancer cell lines (10), whereas expression of KLF6 has been shown to revert the tumorigenic phenotype in glioblastoma cell lines in culture and in vivo (17). Furthermore, KLF6 has been shown to inhibit a number of key oncogenic signaling pathways (17), including the cyclin-dependent kinase complex CDK4-cyclinD1 (18) and c-jun (19). Especially intriguing are the most recent associations of KLF6 expression status with predictive outcomes in both prostate (20) and lung cancers (15). Combined, these studies highlight a growing number of tumors in which KLF6 is functionally inactivated and elucidate molecular mechanisms by which KLF6 functions as a tumor suppressor gene, raising the possibility of a generalized role in cancer pathogenesis. As part of our overall investigations into the molecular basis of KLF6-related tumorigenesis, we investigated the possibility that inherited KLF6 mutations or polymorphisms exist and may be associated with increased prostate cancer risk.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Study Population. The overall study population analyzed was selected from the Johns Hopkins University (JHU), Mayo Clinic (Mayo), and Fred Hutchinson Cancer Research Center prostate cancer registries, which have been previously described, along with their respective population controls (21–23). All samples were collected and analyzed under appropriate Institutional Review Board approval for each institution. The JHU prostate cancer registry comprised 142 families affected with hereditary prostate cancer. Families with at least three first-degree relatives with prostate cancer were ascertained and studied at the Brady Urology Institute at Johns Hopkins Hospital. Families were ascertained from three sources. Sixty-eight families were ascertained through referrals generated in response to a letter by one of us (P.C.W.) to 8,000 urologists throughout the United States. The second source, from which 37 families were identified, was family history records of patients seen at Johns Hopkins Hospital for prostate cancer treatment. The remaining families came from the respondents to articles, which seemed in various lay publications, describing studies of families with hereditary prostate cancer. Diagnosis was verified by medical records for each affected man studied. Age at diagnosis of prostate cancer was confirmed either through medical records or through two other independent sources. The mean age at diagnosis was 64.3 for the case subjects in these families; 84% of the families are White and 8.8% are Black.

All nonhereditary prostate cancer prostate cancer case subjects were recruited from among patients who underwent treatment for prostate cancer at the Johns Hopkins Hospital. The diagnosis for all these subjects was confirmed by pathology reports. Mean age at diagnosis for these case subjects was 58.6. Family histories were not available. More than 93% of the case subjects are White and 3.2% are Black.

Control subjects were selected from among men who participated in prostate cancer screening programs. After excluding those who had abnormal results of a digital rectal examination (DRE) or abnormal prostate-specific antigen (PSA) levels (>4 ng/mL), 264 Caucasian men were eligible for these studies. The mean age at examination was 58 years. About 5.6% of the eligible control subjects have a brother(s) or father affected with prostate cancer. The affection status of relatives was obtained by interview of the probands.

The Mayo study population with familial prostate cancer was comprised of 431 men from 177 families, such that each family had a minimum of three affected men with prostate cancer as reported by family history. All men who contributed a DNA sample had their prostate cancer diagnosis verified by review of medical records, and when possible, pathologic confirmation (21). Sporadic prostate cancer patients were selected from respondents to a family history survey, who reported no family history of prostate cancer. To ensure that the sporadic group was similar to the familial group, except for family history, eligible sporadic cases were selected by frequency matching them to the familial index cases according to year of diagnosis, age at diagnosis, and number of brothers. Multiple sporadic cases were identified for each familial case, and these case sets were randomly sampled for recruitment, with a goal of recruiting 500 men with sporadic prostate cancer. A total of 1,001 invitations were sent to men who initially reported no family history of prostate cancer. The second survey determined that only 740 of these men were eligible (i.e., still no family history of prostate cancer), and of these men, 501 agreed to contribute a blood sample. At the time when assays were done, blood samples were available for 499 men. All but 11 of these men were treated surgically for their prostate cancer.

The control population of 491 men was drawn from a sampling frame of the local population provided by the Rochester Epidemiology Project, from Olmsted County, MN and screened for evidence of prostate cancer by an extensive work-up at baseline and periodic follow-up as previously described (22). This work-up included a DRE and transrectal ultrasound of the prostate, abdominal ultrasound for post-void residual urine volume, measurement of serum PSA levels and creatinine, focused urological physical examination, and cryopreservation of serum for sex hormone assays (22). Any patient with an abnormal DRE, elevated serum PSA level, or suspicious lesion on transrectal ultrasound was evaluated for prostatic malignancy. If the DRE and transrectal ultrasound were unremarkable and the serum PSA level was elevated (>4.0 ng/mL), a sextant biopsy (three cores from each side) of the prostate was done. An abnormal DRE or transrectal ultrasound result, regardless of the serum PSA level prompted a biopsy of the area in question. In addition, a sextant biopsy of the remaining prostate was done. Those men who were found to be without PC based on this extensive work-up at baseline or at any of the follow-up exams through 1994, with augmentation with random samples from the population accrued over that time, were used as the control population for this study.

The men in the Fred Hutchinson Cancer Research Center study included participants in a population-based case-control study of sporadic prostate cancer risk factors in middle-aged men. The case-control study has been described in detail (23). Cancer patients, representing all grades, stages, and treatments, were ascertained from the Seattle-Puget Sound Surveillance, Epidemiology, and End Results cancer registry. Included were Caucasian men from King County, WA, ages 40 to 64 years, diagnosed with prostate cancer between January 1, 1993 and December 31, 1996. Of the total 917 eligible cases, 753 (82%) participated in the study, 591 provided blood samples for analysis, and of these, 558 DNA samples were genotyped for the KLF6 single nucleotide polymorphism (SNP). Population-based controls were selected from the same defined geographic region using random digit dialing. Controls were frequency matched to cases by age (same 5-year group) and recruited evenly throughout the ascertainment period of cases (23). Nine hundred forty-one individuals were eligible as controls, 703 (75%) participated, 538 provided samples for analysis, and 521 were genotyped for these studies.

Sequence and Genotype Analysis. Genomic DNA was extracted from peripheral blood samples as previously described (21–23). Initially, DNA from 142 probands from the JHU Familial Prostate Cancer Registry were analyzed by direct sequence analysis of the second exon and intron/exon boundaries using KLF6 specific primer combinations as previously described (9). PCR products were directly sequenced in both orientations after purification (QIAquick PCR purification kit, Qiagen, Chatsworth, CA). All sequencing was done either on an ABI Prism 3730 or 3700 automated DNA analyzer and sequence data was analyzed using the Sequencher 4.1 program (Gene Codes Co., Ann Arbor, MI) or Phred/Phrap/Consed (University of Washington).

Direct sequencing or a restriction enzyme based assay was also used to screen samples. Genomic DNA was amplified to generate a 171-bp amplicon using the following KLF6-specific primers: ATG forward 5'-CGGGCAGCAATGTTATCTGTCCTTC-3' and ATG reverse 5'-TTCTGAGGCTGAAACATAGCAGGG-3'. The PCR product was then either sequenced per standard protocols or digested with BsaAI (New England Biolabs, Beverly, MA) using the manufacturer's recommendations and resultant products were gel electropheresed on a 1.5% TAE gel for 1 hour at 80 V and then visualized by ethidium bromide staining. In addition, all JHU genotypes were reconfirmed at a second institutional site by BsaAI restriction enzyme digest. Genotypes for the Mayo Clinic samples were reconfirmed by pyrosequencing as previously described (21), using the same KLF6 primers described above except that one primer was biotinylated. As a control, more than half of all sample results were independently confirmed by a second institution.

To evaluate the possibility of combining the data sets, logistic regression with an interaction term (institution by KLF6 carrier status) was done to determine if the odds ratios (OR) were significantly different between the registries (24–26). This analysis was conducted for the entire group, as well as all the subgroups. No interaction was statistically significant and thus the data sets were also analyzed as a combined set.

Cell Culture and Transient Transfection. All cell lines were obtained from the American Tissue Culture Collection (Rockville, MD). All transient transfection was done with LipofectAMINE 2000 reagent according to the manufacturer's protocol (Life Technologies, Gaithersburg, MD). Stable cell lines were generated by cotransfection of the IVSA, WILD TYPE, or LacZ minigene expression constructs with a puromycin expressing plasmid. Transfected cells were selected with 2 µg/mL of puromycin.

Wild-type KLF6 and IVSA Minigene Constructs. To amplify the 6.2 kb KLF6 genomic locus including 100 bp of the 5' untranslated region and 300 bp of 3' untranslated region, 200 ng of human genomic DNA were amplified using the following set of primers: KLF6-1F TTGCAGTCAGTCCGGTGTTTG and KLF6-4R1 GGTGCTATGCCGCTTCTTACAGGAC using the EXPAND Long Template PCR system (Roche, Nutley, NJ). PCR was done according to manufacturer's suggestions. The resultant 6.2-kb PCR product was purified (Qiagen) and then subcloned into the TOPO TA expression vector (Invitrogen, San Diego, CA). The IVSA mutation was introduced into the full-length minigene construct by site-directed mutagenesis according to the manufacturer's protocol (Quick-Change, Stratagene, LA Jolla, CA). The primers used for mutagenesis were as follows: KLF6A-F GTCATGGCAATCACATGCCTTCTCTGGTT and KLF6A-R AACCAGAGAAGGCATGTGATTGCCATGAC. All intron/exon boundaries and 5' untranslated region and 3' untranslated region regions of the constructs used in this study were sequenced in both orientations before use.

KLF6, p21 Promoter, and SRp40 Constructs. Full-length KLF6 cDNA was cloned into EcoRI and XbaI sites of pCI-neo (9). KLF6SV1 and SV2 expression vectors were generated by subcloning the appropriate full-length cDNA into the EcoRI site of the pCI-neo expression vector. WtKLF6, KLF6SV1, and KLF6SV2 constructs were generated by cloning the appropriate cDNA into the EcoRI site of the FLAG expression vector pCDNA3 (Invitrogen). The wild-type (wt) and mutant p21 promoter constructs were previously described (9). The SRp40, ASF, and pCGT7 constructs (generous gifts from Dr. A. Krainer, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY) were previously described (27).

pSUPER Plasmid Construction and Transfection. The pSUPER-siSV1 and pSUPER-siSV2 plasmids used to down-regulate KLF6v1 and KLF6v2 expression were constructed similarly as described using this pSUPER vector (ref. 28; generously provided by R. Agami, Division of Tumor Biology, The Netherlands Cancer Institute, Amsterdam, The Netherlands). To insert the targeting sequence, DNA oligos were designed and cloned into the BglII/HindIII sites of the pSuper vector.

Si-SV1-F: GATCCCCAGGCTTTTCTCCTTCCCTGGCttcaagagaGCCAGGGAAGGAGAAAAGCCTTTTGGAAA

Si-SV1-R: AGCTTTTCCAAAAAGGCTTTTCTCCTTCCCTGGCtctcttgaaGCCAGGGAAGGAGAAAAGCCTGGG

Si-SV2-F: GATCCCCGCCAGGAGAAAAGCCTTACttcaagagaGTAAGGCTTTTCTCCTGGCTTTTTGGAAA

Si-SV2-R: AGCTTTTCCAAAAAGCCAGGAGAAAAGCCTTACtctcttgaaGTAAGGCTTTTCTCCTGGCGGG

Luc-F: GATCCCCTACTTCGAAATGTCCGTTCttcaagagaGAACGGACATTTCGAAGTATTTTTGGAAA

Luc-R: AGCTTTTCCAAAAATACTTCGAAATGTCCGTTCtctcttgaaGAACGGACATTTCGAAGTAGGG

Western Blot Analysis. BPH1 or 293T cells grown in 12-well dishes were transfected with 0.5 µg per well of either the IVS A, wt, or LacZ minigene expression vectors. Cell extracts for Western blotting were harvested in radioimmunoprecipitation assay buffer 24 hours following transfection (Santa Cruz Biotechnology standard protocol, Santa Cruz, CA). Equal amounts of protein (30 µg) as determined by the Bio-Rad DC Protein quantification assay were loaded and separated by PAGE and transferred to nitrocellulose membranes. Western blotting was done using rabbit polyclonal antibodies to KLF6 / Zf9, p21 (R-173 and H-164, respectively; Santa Cruz Biotechnology), a goat polyclonal antibody to actin (SC-1615), and a T7 monoclonal antibody (Novagen).

Densitometric Analysis. Enhanced chemiluminescent images of immunoblots were analyzed by scanning densitometry and quantified with a BIOQUANT NOVA imaging system. Values were expressed as fold change relative to control and normalized to actin.

Analysis of Proliferation. Proliferation was determined by estimating ³H-thymidine incorporation. BPH1 stable cell lines containing either the IVSA, wt, LacZ minigene expression vectors were plated at a density of 50,000 cells per well in 12-well dishes. Forty-eight hours after plating, 1 µCi/mL ³H-thymidine (Amersham, Arlington Heights, IL) was added. After 2 hours, cells were washed four times with ice-cold PBS and fixed in methanol for 30 minutes at 4°C. After methanol removal and cell drying, cells were solubilized in 0.25% sodium hydroxide/0.25% SDS. After neutralization with hydrochloric acid (1 N), disintegrations per minute were estimated by liquid scintillation counting.

Luciferase Transactivation. Luciferase transactivation assays were done 24 hours after transfection into 293T cells plated at 100,000 cells per well in 12-well dishes with DNA containing 1.5 µg p21 promoter constructs and either 1.5 µg pCI-neo-KLF6, pCI-neo-KLF6SV1, or pCI-neo-KLF6SV2. The TK promoter-Renilla Luciferase construct (Promega, Madison, WI; 2 ng) was used to normalize each transfection experiment. Proteins from the cells were then extracted and luminescence quantified using the Dual-Luciferase system (Promega). All experiments were done in triplicate.

RNA and Quantitative Real-time PCR Analysis. Normal, BPH, and prostate cancer RNA samples were collected and extracted as previously described (29). Cell line RNA was extracted using the Rneasy Mini kit (Qiagen). All RNA was treated with DNase (Qiagen). A total of 1 µg of RNA was reverse transcribed per reaction using first strand complementary DNA synthesis with random primers (Promega). Quantitative real-time (qRT-PCR) was done using the following PCR primers on an ABI PRISM 7900HT Sequence Detection System (Applied Biosystems, Foster City, CA): wtKLF6 forward 5'-CGGACGCACACAGGAGAAAA-3' and wtKLF6 reverse 5'-CGGTGTGCTTTCGGAAGTG-3'; Total KLF6 forward 5'-CTGCCGTCTCTGGAGGAGT-3' and Total KLF6 reverse 5'- TCCACAGATCTTCCTGGCTGTC-3'; p21 forward 5'-ACTCTCAGGGTCGAAAACGG-3' and p21 reverse 5'-CCTCGCGCTTCCAGGACTG-3'; GAPDH forward 5'-CAATGACCCCTTCATTGACC-3' and GAPDH reverse 5'-GATCTCGCTCCTGGAAGATG-3'; SRp40 forward: 5'-CCAAGGGATGCAGATGATGCTG and SRp40 reverse 5'-GGAGCATTTCGTCTATCATTTCGA-3': All experiments were done in triplicate and normalized to GAPDH. To calculate the fold change in KLF6 alternative splicing, the fold change in total KLF6 (wtKLF6 + alternatively spliced KLF6 transcripts) was divided by the fold change in wild-type KLF6 alone.

Immunocytochemistry. 293 human embryonic kidney cells were cultured on growth promoting coverslips (Fisherbrand, Raleigh, NC) in 12-well dishes. At 24 hours, cells were transfected with pCDNA3 FLAG (empty vector), FLAG-wtKLF6, FLAG-SV1, and FLAG-SV2. At 18 hours, cells were washed twice with ice-cold saline, fixed for 10 minutes with ice-cold methanol, and then with ice-cold acetone for 1 minute. Blocking was with 5% bovine serum albumin/PBS for 10 minutes before incubation with primary FLAG monoclonal antibody (1:100) and subsequent detection with Texas Red conjugated anti-mouse secondary antibody (Vector Laboratories, Burlingame, CA).

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Screening for KLF6 Polymorphisms. To begin investigating the possibility that inherited mutations or polymorphisms in the KLF6 tumor suppressor gene are associated with increased prostate cancer risk, we first sought to identify and characterize biologically relevant SNPs. Therefore, we directly sequenced genomic DNA isolated from blood samples from an exploration set of 142 probands from a familial prostate cancer registry. A number of silent, conserved, and intronic KLF6 gene changes were identified by DNA sequence analysis. A relatively common intronic KLF6 gene polymorphism, IVS1 –27 G > A, the IVSA allele, was identified as the most frequent polymorphism (Fig. 1B). In total, 26 of 142 probands (18.3%) possessed the IVSA variant. Three other variants were also detected in our sample set but not further characterized in this study because their frequencies were quite small by comparison to the IVSA variant. The most frequent of these variants (3550 G > A; silent) was only present in 3 of 142 samples (2.1%). The other two variants were present in 2 of 142 samples each (1.4%).

View larger version (22K): [in this window] [in a new window] [Download PPT slide]   Figure 1. Structure and cellular localization of KLF6 and its splice variants. A, RT-PCR of 293T cells transfected with the full-length wt KLF6 minigene construct reveals that the KLF6 gene is alternatively spliced. B, genomic organization, splice site sequences, and mRNA structures for wt and KLF6 splice variants. Nuclear localization signal (NLS). PCR primer binding sites for qRT-PCR. C, immunocytochemistry of 293 human embryonic kidney cells expressing wtKLF6, SV1, or SV2 proteins. 293HEK cells were transfected with FLAG tagged wtKLF6, KLF6SV1, or KLF6SV2 expression constructs. FLAG immunostaining revealed that wtKLF6 localizes to the nucleus, whereas the KLF6SV1 and SV2 proteins are predominantly cytoplasmic (arrows).

The IVSA variant was found to be more frequently present in men with sporadic prostate cancer when data from all three centers were combined and controls were required to minimally have had PSA testing for study inclusion (P = 0.01; OR, 1.42; 95% CI, 1.10-1.80; Table 1). Owing to study design differences between the three centers, PSA testing and DRE were minimally required for all controls in only two of the studies but not in the third. In the combined group analysis of men in these two centers (JHU and Mayo), the association of allele status and prostate cancer risk was also statistically significant and the magnitude of the relative risk for KLF6 gene variant carriers was 1.47 (P = 0.01; 95% CI, 1.08-2.00).

We next examined the potential role of this SNP in men with hereditary prostate cancer. Again, a statistically significant association was seen between the IVSA allele and cancer risk. The magnitude of the relative risk for IVSA carriers was 1.61 (P = 0.01; OR, 1.61; 95% CI, 1.20-2.16) in the combined analysis from both centers. This association was seen in one of the two registries alone (P = 0.02; OR, 1.71; 95% CI, 1.13-2.60) whereas a trend towards significance was present in the other group (P = 0.11; OR, 1.59; 95% CI, 0.98-2.57; Table 1). Interestingly, among these men with a positive family history for prostate cancer in both registries, the carrier frequency was higher among men with an earlier age of diagnosis (<65 years of age; P 0.03).

KLF6 Alternative Splicing. Thus, the epidemiologic data reinforced the previously identified role of KLF6 as a tumor suppressor gene in the pathogenesis of prostate cancer (9, 10). However, the molecular basis by which this specific noncoding germ line sequence variant resulted in increased risk was unclear. We began exploring a potential biological role for the IVSA allele in cultured cells by expressing full-length 6.2-kb KLF6 minigene constructs, containing either the wild-type or IVSA sequence. Three findings stemming from these experiments suggested that the IVSA variant effected a change in wild-type KLF6 tumor suppressor gene expression and function. First, the KLF6 gene is alternatively spliced. Second, a relative overabundance of KLF6 splice variants to wild-type tumor suppressor expression is present in tumor versus normal prostate tissue. Finally, the IVSA variant was consistently associated with enhanced KLF6 alternative splicing and variant protein expression both in cell culture and human tissues.

Direct cDNA sequence analysis from both cells transfected with the minigene constructs and from 20 different human tissues, including normal prostate and localized prostate cancer, confirmed the presence of three alternatively spliced KLF6 gene transcripts, KLF6 SV1, SV2, and SV3 (Fig. 1A). These alternatively spliced products, arising from the use of native cryptic splice sites within exon 2 (Fig. 1B), predicted protein isoforms lacking either parts or all of the wild-type activation and/or DNA binding domain. KLF6SV1 and KLF6SV3 are predicted to contain novel 21 and 12 amino acid carboxyl domains, respectively, resulting from out-of-frame splicing of their terminal exons.

To define potential differences in subcellular localization between wt and variant KLF6 proteins, we generated FLAG fusion expression constructs of wtKLF6 and two of the novel isoforms. Whereas wtKLF6 localized primarily to the cell nucleus, both the KLF6SV1 and KLF6SV2 proteins accumulated predominantly in the cytoplasm (Fig. 1C). This compartmentalization likely reflects the absence of the nuclear localization signal in these variants, which, based on previous analysis of the closely related erythroid Kruppel-like factor, maps to the terminal portion of the activation and DNA binding domains (30).

To assess potential differences in in vivo expression patterns, RNA was isolated from six normal prostate tissue samples and 15 prostate tumors and the amount of wild-type and KLF6 splice variants was determined by qRT-PCR (Fig. 2A). For qRT-PCR, primers were designed to either conserved or unique sequences in the KLF6 transcripts (Fig. 1B) such that either wtKLF6 alone or wt plus alternatively spliced transcripts (total), were amplified. As shown in Fig. 2A, normal prostate expressed twice the relative amount of wt tumor suppressor message to splice products when compared with tumors (P < 0.01).

View larger version (28K): [in this window] [in a new window] [Download PPT slide]   Figure 2. KLF6 gene is differentially spliced in tumor tissue and can be regulated in cell culture by the IVSA variant. A, qRT-PCR was done on six normal prostate tissue samples and 15 prostate cancer specimens using total and wt specific KLF6 primers. The ratio of total KLF6 to wt KLF6 was determined using the PCR primers shown in Fig. 1B and calculated by determining the amount of variant message and then dividing that value by the amount of wtKLF6 message. Prostate tumors had significantly higher splicing ratios (x = 0.83), a higher total/wtKLF6 ratio, than normal prostate tissue (x = 0.41; P < 0.01). B, results of qRT-PCR using total and wt specific KLF6 primers on cells transfected with either the wt or IVSA minigene construct. The IVSA variant increases alternative splicing of the KLF6 gene by 30% and 50% in BPH1 and 293T cells, respectively, as compared with the wt construct. **, P < 0.001 (ANOVA, Bonferroni correction applied, n = 3). C, Western blot analysis of BPH1 cells transfected with IVSA and wt minigene constructs using a KLF6 polyclonal antibody. The IVSA variant results in increased levels of both variant proteins. The ratio of splice variants to wt protein was quantitated by densitometry and increased by 90%. D, stable expression of the IVSA variant in BPH1 results in a 30% increase of KLF6 splicing as measured by qRT-PCR. **, P < 0.001 (ANOVA, Bonferroni correction applied, n = 3). E, Western blot analysis of BPH1 stable cell lines stably expressing the IVSA or wt minigene construct. IVSA BPH1 cells express 60% more variant proteins to wt KLF6 protein as compared with the wt and minigene control.

Next, we directly analyzed the effect of the IVSA variant on KLF6 splicing in noncancerous and cancerous prostatic tissues. Tissue from seven men with benign prostatic hypertrophy, a noncancerous condition, was studied. Four samples were homozygous for the wild-type G allele, three were G/A heterozygous. The IVSA allele was again associated with an 40% increase in KLF6 splicing (Fig. 3A). We then haplotyped and determined the splicing ratios of all nine of the 15 originally analyzed prostate tumor samples for which Gleason scores were available (Fig. 3B). As shown, the IVSA allele was associated with a 30% increase in splice ratio in tumors graded 3 + 3 and a 40% increase in the higher grade 4 + 4 tumors. Taken together, the cell culture and tissue results suggested that the IVSA allele results in increased splicing, whereas an association between increased KLF6 splicing and prostate cancer was noted.

View larger version (11K): [in this window] [in a new window] [Download PPT slide]   Figure 3. IVSA is associated with increased alternative splicing of the KLF6 gene in prostatic tissues. A, qRT-PCR of patient-derived benign prostatic hyperplasia tissue revealed that the presence of IVSA variant was associated with 40% increase in KLF6 splicing (P < 0.01). B, qRT-PCR of prostate cancer tissues revealed that the IVSA variant was associated with 30% and 40% increases in alternative splicing in Gleason 3 + 3 (*, P < 0.01; G/G, n = 3; G/A, n = 2) and Gleason 4 + 4 tumors (**, P < 0.001; G/G, n = 2; G/A, n = 2), respectively.

The IVSA Allele Generates a Functional SRp40 Binding Site.

View larger version (25K): [in this window] [in a new window] [Download PPT slide]   Figure 4. The IVSA variant creates a functional SRp40 binding site. A, alignment of wt and IVSA sequences with the consensus SRp40 sequence. Control experiments with HeLa cells cotransfected with increasing amounts of a SRp40 expression vector and either the IVSA variant or wt minigene constructs were done. B, qRT-PCR using SRp40-specific real-time primers confirm incremental SRp40 expression. Difference in SRp40 expression between the wt and IVSA variant cotransfected with 4 µg of the SRp40 plasmid is not statistically significant. C, Western blot analysis using a T7 monoclonal antibody confirmed SRp40 expression. D, incremental SRp40 expression resulted in increased KLF6 alternative splicing only in IVSA minigene transfected cells. **, P < 0.001; ***, P < 0.0001 (ANOVA, Bonferroni correction applied, n = 9).

View larger version (22K): [in this window] [in a new window] [Download PPT slide]   Figure 5. IVSA variant blunts p21 up-regulation and increases cellular proliferation. A, endogenous p21 levels in BPH1 cells expressing the minigene constructs. IVSA cells have 40% less p21 mRNA and 60% less p21 protein than wt cells. **, P < 0.001 (ANOVA, Bonferroni correction applied, n = 4). B, cell proliferation analysis of minigene expressing BPH1 cells. The IVSA expressing cells proliferate 30% more than the wt expressing cells. **, P < 0.001 (ANOVA, Bonferroni correction applied, n = 9). C, KLF6 variant proteins fail to transactivate the p21 promoter and up-regulate endogenous p21. 293T cells were cotransfected with a p21 reporter plasmid and either wtKLF6, SV1, or SV2 expression vectors. All values represent relative luciferase activity. wtKLF6 transactivated the p21 promoter 6-fold (***, P < 0.0001; ANOVA, Bonferroni correction applied, n = 6), whereas neither KLF6SV1 nor KLF6SV2 resulted in significant transactivation (***, P < 0.0001; ANOVA, Bonferroni correction applied, n = 9). KLF6SV1 and SV2 proteins fail to up-regulate endogenous p21. 293T cells were transfected with a wtKLF6, SV1, or SV2 expression vector and 24 hours after transfection cells were harvested and Western blot analysis was done using a p21 antibody. D, KLF6SV1 and SV2 proteins fail to suppress cell proliferation. PC3M cells were transfected with a wtKLF6, SV1, or SV2 expression vector and 3H incorporation was measured (**, P < 0.001; ANOVA, Bonferroni correction applied, n = 9). Comparisons were made between wtKLF6 and pCI-neo and variants and wtKLF6.

View larger version (32K): [in this window] [in a new window] [Download PPT slide]   Figure 6. KLF6 variants antagonize wtKLF6 ability to up-regulate p21. As a control for siRNA efficacy and specificity, 293T cells were cotransfected with either the pSUPER27 si-SV1 or si-SV2 plasmid and KLF6 and SV1 or SV2 cDNA expression vectors. A, qRT-PCR of 293T transfected cells shows that both the si-SV1 and si-SV2 plasmids result in decreased alternative splicing of the KLF6 gene as compared with a pSUPER-Luc control (***, P < 0.0001; ANOVA, Bonferroni correction applied, n = 6). B, Western blot analysis reveals target specific silencing by the pSUPER si-SV1 or si-SV2 plasmids of KLF6 variant proteins. Densitometry results. Wild-type KLF6 and SV2 proteins appear as doublets. C, 293T cells cotransfected with the wt full-length minigene construct and either pSUPER plasmids resulted in a significant up-regulation of both p21 mRNA and protein (**, P < 0.001; ***, P < 0.0001; ANOVA, Bonferroni correction applied, n = 3). D, silencing of endogenous KLF6 splice forms, SV1 or SV2, in the metastatic prostate cancer cell line PC3M resulted in significant up-regulation of p21 message (**, P < 0.001; ***, P < 0.0001; ANOVA, Bonferroni correction applied, n = 4) and p21 protein. E, silencing of endogenous SV1 but not SV2 message in PC3M cells resulted in a 50% decrease in cell proliferation (***, P < 0.0001; ANOVA, Bonferroni correction applied, n = 9).

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

Recent findings have suggested that KLF6 expression levels can be used as predictive indicators of prostate (20) and lung cancer outcomes (15). Thus, it will be highly relevant to explore the potential significance of the IVSA SNP as a predictive biomarker for lifetime prostate cancer risk in future studies as well as a possible marker for distinct clinicopathologic associations. Nonetheless, the identification of biologically active KLF6 splice variants adds to an increasing appreciation of the mechanisms by which KLF6 inactivation plays a role in human cancer. These studies show that inheritance of a single, common intronic SNP results in increased splice variant production. The novel KLF6 splice variants, in turn, functionally antagonize wtKLF6's growth suppressive properties by affecting expression levels of the cyclin-dependent kinase inhibitor p21. The splice variants may thus possess a dominant-negative function based on their inability to directly transactivate p21, possibly because they lack part or all of the wild-type DNA-binding domain (Fig. 1). Furthermore, confined to the cytoplasm, the variants may compete for transcriptional cofactors and/or lead to wtKLF6 sequestration.

Beyond its effect in cancer biology, these results also highlight the unexpected effects that polymorphisms and alternative splicing can have on major human diseases. The practical consequences of these findings are highly relevant in the genomic era, as large-scale association studies intensify to identify and characterize biologically relevant variations. In this instance, we have shown that a seemingly neutral polymorphism associated with prostate cancer risk is linked to a novel form of tumor suppressor gene inactivation through alternative splicing. Identification and biological characterization of the IVSA allele has provided mechanistic insight into a previously unknown pathway relevant to tumorigenesis. Specifically, these studies of the IVSA allele have uncovered the existence of growth-suppressive and growth-promoting forms of KLF6 in normal and cancerous tissues and highlighted a novel paradigm wherein a critical balance between these forms can profoundly influence prostate biology and disease risk.

	Acknowledgments

 
Grant support: Prostate Cancer Foundation (J.A. Martignetti, S.L. Friedman, and W.B. Isaacs), DAMD17-02-1-0720 (J.A. Martignetti and S.L. Friedman), NIH grant DK37340 (S.L. Friedman), Doris Duke Clinical Fellowship Research Program (J. Hirshfeld), Specialized Programs of Research Excellence grant CA58236 (W.B. Isaacs), P50 CA69568 (A. Chinnaiyan and M. Rubin), National Cancer Institute Specialized Programs of Research Excellence in Prostate Cancer (A. Chinnaiyan and M. Rubin), USPHS grants CA72818, DK58859, CA64220, and AR30582 (S.N. Thibodeau); CA56678 and CA82664 (J.L. Stanford); R01CA78835 (E.A. Ostrander); and PC030828 (D.M. Friedrichsen), Prostate Specialized Programs of Research Excellence grant CA91956 (S.N. Thibodeau), and Mayo Foundation (S.N. Thibodeau and D.J. Schaid).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank the individuals and families who participated in these studies, Kurt Hirschhorn for critical reading of the article and discussions, and Maria Ramirez and Linda Tringo (Mount Sinai School of Medicine) for technical assistance.

	Footnotes

 
Note: The authors disclose that they have no competing financial interests.

Received 11/29/04. Accepted 12/ 2/04.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Jemal ATA, Murray T, Thun M. Cancer statistics. CA Cancer J Clin 2002;52:23–47.[Abstract/Free Full Text]
2. Baselga J, Norton L. Focus on breast cancer. Cancer Cell 2002;4:319–22.
3. Kinzler KW, Vogelstein B. Lessons from hereditary colorectal cancer. Cell 1996;87:159–70.[CrossRef][Medline]
4. Ostrander EA, Stanford JL. Genetics of prostate cancer: too many loci, too few genes. Am J Hum Genet 2000;67:1367–75.[CrossRef][Medline]
5. Tavtigian SV, Simard J, Teng DH, et al. A candidate prostate cancer susceptibility gene at chromosome 17p. Nat Genet 2001;27:172–80.[CrossRef][Medline]
6. Carpten J, Nupponen N, Isaacs S, et al. Germline mutations in the ribonuclease L gene in families showing linkage with HPC1. Nat Genet 2002;30:181–4.[CrossRef][Medline]
7. Xu J, Zheng SL, Komiya A, et al. Germline mutations and sequence variants of the macrophage scavenger receptor 1 gene are associated with prostate cancer risk. Nat Genet 2002;32:321–5.[CrossRef][Medline]
8. Schaid DJ. The complex genetic epidemiology of prostate cancer. Hum Mol Genet 2004;13:R103–21.[Abstract/Free Full Text]
9. Narla G, Heath KE, Reeves HL, et al. KLF6, a candidate tumor suppressor gene mutated in prostate cancer. Science 2001;294:2563–6.[Abstract/Free Full Text]
10. Chen C, Hyytinen ER, Sun X, et al. Deletion, mutation, and loss of expression of KLF6 in human prostate cancer. Am J Pathol 2003;162:1349–54.[Abstract/Free Full Text]
11. Reeves HL, Narla G, Ogunbiyi O, et al. Kruppel-like factor 6 (KLF6) is a tumor-suppressor gene frequently inactivated in colorectal cancer. Gastroenterology 2004;126:1090–103.[CrossRef][Medline]
12. Jeng YM, Hsu HC. KLF6, a putative tumor suppressor gene, is mutated in astrocytic gliomas. Int J Cancer 2003;105:625–9.[CrossRef][Medline]
13. Chen HK, Liu XQ, Lin J, Chen TY, Feng QS, Zeng YX. Mutation analysis of KLF6 gene in human nasopharyngeal carcinomas. Ai Zheng 2002;21:1047–50.[Medline]
14. Yamashita K, Upadhyay S, Osada M, et al. Pharmacologic unmasking of epigenetically silenced tumor suppressor genes in esophageal squamous cell carcinoma. Cancer Cell 2002;2:485–95.[CrossRef][Medline]
15. Kettunen E, Anttila S, Seppanen JK, et al. Differentially expressed genes in nonsmall cell lung cancer: expression profiling of cancer-related genes in squamous cell lung cancer. Cancer Genet Cytogenet 2004;149:98–106.[CrossRef][Medline]
16. Ito G, Uchiyama M, Kondo M, et al. Kruppel-Like Factor 6 (KLF6) is frequently downregulated and induces apoptosis in non-small cell lung cancer cells. Cancer Res 2004;11:3838–43.
17. Kimmelman AC, Qiao RF, Narla G, et al. Suppression of glioblastoma tumorigenicity by the Kruppel-like transcription factor KLF6. Oncogene 2004;29:5077–83.
18. Benzeno S, Narla G, Allina J, et al. Cyclin dependent kinase inhibition by the KLF6 tumor suppressor protein through interaction with cyclin D1. Cancer Res 2004;64:3885–91.[Abstract/Free Full Text]
19. Slavin DA, Koritschoner NP, Prieto CC, Lopez-Diaz FJ, Chatton B, Bocco JL. A new role for the Kruppel-like transcription factor KLF6 as an inhibitor of c-Jun proto-oncoprotein function. Oncogene 2004;23:8196–205.[CrossRef][Medline]
20. Glinsky GV, Glinskii AB, Stephenson AJ, Hoffman RM, Gerald WL. Gene expression profiling predicts clinical outcome of prostate cancer. J Clin Invest 2004;113:913–23.[CrossRef][Medline]
21. Carpten J, Nupponen N, Isaacs S, et al. Germline mutations in the ribonuclease L gene in families showing linkage with HPC1. Nat Genet 2002;30:181–4.
22. Wang L, McDonnell SK, Elkins DA, et al. Role of HPC2/ELAC2 in hereditary prostate cancer. Cancer Res 2001;61:6494–9.[Abstract/Free Full Text]
23. Stanford JL, Wicklund KG, McKnight B, Daling JR, Brawer MK. Vasectomy and risk of prostate cancer. Cancer Epidemiol Biomarkers Prev 1999;8:881–6.[Abstract/Free Full Text]
24. Slager S, Schaid D. Evaluation of candidate genes in case-control studies: a statistical method to account for related subjects. Am J Hum Genet 2001;68:1457–62.[CrossRef][Medline]
25. Weir BS. Genetic Data Analysis II. Methods for discrete population genetic data. Massachusetts: Sinaur Associates, Inc.; 1996.
26. Sasieni P. From genotypes to genes: doubling the sample size. Biometrics 1997;53:1253–61.[CrossRef][Medline]
27. Liu HX, Zhang M, Krainer AR. Identification of functional exonic splicing enhancer motifs recognized by individual SR proteins. Genes Dev 1998;12:1998–2012.[Abstract/Free Full Text]
28. Brummelkamp TR, Bernards R, Agami R. A system for stable expression of short interfering RNAs in mammalian cells. Science 2002;296:550–3.[Abstract/Free Full Text]
29. Dhanasekaran SM, Barrette TR, Ghosh D, et al. Delineation of prognostic biomarkers in prostate cancer. Nature 2001;412:822–6.[CrossRef][Medline]
30. Quadrini KJ, Bieker JJ. Kruppel-like zinc fingers bind to nuclear import proteins and are required for efficient nuclear localization of erythroid Kruppel-like factor. J Biol Chem 2002;277:32243–52.[Abstract/Free Full Text]
31. Cartegni L, Wang J, Zhu Z, Zhang MQ, Krainer AR. ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acids Res 2003;31:3568–71.[Abstract/Free Full Text]

This article has been cited by other articles:

				M. Korner and L. J. Miller Alternative Splicing of Pre-mRNA in Cancer: Focus on G Protein-Coupled Peptide Hormone Receptors Am. J. Pathol., August 1, 2009; 175(2): 461 - 472. [Abstract] [Full Text] [PDF]

				X. Huang, X. Li, and B. Guo KLF6 Induces Apoptosis in Prostate Cancer Cells through Up-regulation of ATF3 J. Biol. Chem., October 31, 2008; 283(44): 29795 - 29801. [Abstract] [Full Text] [PDF]

				J. D. Fackenthal and L. A. Godley Aberrant RNA splicing and its functional consequences in cancer cells Dis. Model. Mech., July 1, 2008; 1(1): 37 - 42. [Abstract] [Full Text] [PDF]

				A. DiFeo, L. Feld, E. Rodriguez, C. Wang, D. G. Beer, J. A. Martignetti, and G. Narla A Functional Role for KLF6-SV1 in Lung Adenocarcinoma Prognosis and Chemotherapy Response Cancer Res., February 15, 2008; 68(4): 965 - 970. [Abstract] [Full Text] [PDF]

				J. Shi, Z. Hu, K. Pabon, and K. W. Scotto Caffeine Regulates Alternative Splicing in a Subset of Cancer-Associated Genes: a Role for SC35 Mol. Cell. Biol., January 15, 2008; 28(2): 883 - 895. [Abstract] [Full Text] [PDF]

				S. L. Friedman Hepatic Stellate Cells: Protean, Multifunctional, and Enigmatic Cells of the Liver Physiol Rev, January 1, 2008; 88(1): 125 - 172. [Abstract] [Full Text] [PDF]

				H. Lee, D. Kim, H. C. Dan, E. L. Wu, T. M. Gritsko, C. Cao, S. V. Nicosia, E. A. Golemis, W. Liu, D. Coppola, et al. Identification and Characterization of Putative Tumor Suppressor NGB, a GTP-Binding Protein That Interacts with the Neurofibromatosis 2 Protein Mol. Cell. Biol., March 15, 2007; 27(6): 2103 - 2119. [Abstract] [Full Text] [PDF]

				A. Srebrow and A. R. Kornblihtt The connection between splicing and cancer J. Cell Sci., July 1, 2006; 119(13): 2635 - 2641. [Abstract] [Full Text] [PDF]

				A. DiFeo, G. Narla, J. Hirshfeld, O. Camacho-Vanegas, J. Narla, S. L. Rose, T. Kalir, S. Yao, A. Levine, M. J. Birrer, et al. Roles of KLF6 and KLF6-SV1 in Ovarian Cancer Progression and Intraperitoneal Dissemination. Clin. Cancer Res., June 15, 2006; 12(12): 3730 - 3739. [Abstract] [Full Text] [PDF]

				A. Kirschenbaum, X.-H. Liu, S. Yao, G. Narla, S. L. Friedman, J. A. Martignetti, and A. C. Levine Sex steroids have differential effects on growth and gene expression in primary human prostatic epithelial cell cultures derived from the peripheral versus transition zones Carcinogenesis, February 1, 2006; 27(2): 216 - 224. [Abstract] [Full Text] [PDF]

				G. Narla, A. DiFeo, S. Yao, A. Banno, E. Hod, H. L. Reeves, R. F. Qiao, O. Camacho-Vanegas, A. Levine, A. Kirschenbaum, et al. Targeted Inhibition of the KLF6 Splice Variant, KLF6 SV1, Suppresses Prostate Cancer Cell Growth and Spread Cancer Res., July 1, 2005; 65(13): 5761 - 5768. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Narla, G. Articles by Martignetti, J. A. Search for Related Content PubMed PubMed Citation Articles by Narla, G. Articles by Martignetti, J. A.