| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell and Tumor Biology |
1 Microbiology and Tumor Biology Centre, Karolinska Institutet, Stockholm, Sweden and 2 Department of Biochemistry, Biomedical Centre, Uppsala University, Uppsala, Sweden
Requests for reprints: Maria G. Masucci, MTC Karolinska Institutet, Box 280, S-171 77 Stockholm, Sweden. Phone: 46-8-52486755; Fax: 46-8-331399; E-mail: Maria.Masucci{at}mtc.ki.se.
| Abstract |
|---|
|
|
|---|
Key Words: TPP II c-Myc Burkitt's lymphoma mitosis siRNA
| Introduction |
|---|
|
|
|---|
The contribution of TPP II to cellular proteolysis is poorly understood. The finding that TPP II is up-regulated in cells adapted to grow in the presence of toxic doses of proteasome inhibitors (5, 7) has led to the suggestion that TPP II may facilitate the activity of the proteasome by accelerating the production of free amino acids from longer precursors (8, 9). This possibility was recently substantiated by the finding that TPP II is the only cytosolic aminopeptidases that can recognize peptides longer than 15 amino acids, a preferred length of proteasomal products (10). In addition, TPP II seems to be involved in the processing of certain cellular substrates as it is the main cholecystokinin-inactivating enzyme in rat brain (6) and regulates apoptotic responses by promoting the maturation of procaspase-1 in macrophages infected with the Shigella flexneri (11). Recent evidence suggests that TPP II may also participate in the regulation of immune responses by producing a specific subset of antigenic peptides in cells with impaired proteasome activity (10, 12, 13) . Some of these functions could be dependent on the endopeptidase activity of TPP II (5, 12), which may allow the generation of longer peptides from intact proteins or polypeptide precursors.
We have previously shown that TPP II is highly expressed in Burkitt's lymphoma (BL) that carry a chromosomal translocation leading to deregulation of the c-myc oncogene (14). The contribution of c-Myc to TPP II overexpression was confirmed by the finding that the enzyme is up-regulated in parallel with the switch to a BL-like phenotype in an EBV transformed lymphoblastoid cell line (LCL) carrying a tetracycline-inducible c-myc gene. Treatment with an inhibitor of TPP II induced apoptosis in BL and BL-like cells suggesting that the enzyme may control processes that are intimately associated with the growth and survival of this tumor. A similar involvement of TPP II in the regulation of tumor cell growth was recently suggested by the finding that up-regulation of TPP II in proteasome inhibitors adapted EL4 cells correlated with enhanced tumorigenicity in vivo and with up-regulation of members of the IAP family of antiapoptotic proteins (15).
In addition to chromosomal translocations, Burkitt's lymphoma cells frequently display signs of mitotic infidelity with gains and losses of whole chromosomes (16). Such chromosomal aberrations often arise from abnormal multipolar cell divisions (17) following centrosome duplication errors and the generation of supernumerary spindle poles (18, 19). Centrosomes are the major microtubule-organizing center in mammalian cells and, to organize a bipolar mitotic spindle, the centrosome duplicates once during mitosis. Initiation of centrosome duplication is dependent on proteolytic processes mediated by the ubiquitin/proteasome system (20). Thus, deregulation of intracellular proteolysis could have far-reaching consequences in the establishment of malignant transformation and tumor progression.
We have addressed the role of TPP II in the regulation of cell growth by investigating the effects of overexpression and functional knockdown in cells transfected with TPP II-expressing plasmids or infected with a lentivirus expressing TPP II specific small interfering RNAs. Our data point to a role of TPP II in the generation of cells with altered centrosome homeostasis and mitotic fidelity, suggesting that this enzyme may be a critical player in the c-Myc induced deregulation of the cell cycle in malignant cells.
| Materials and Methods |
|---|
|
|
|---|
Western Blotting. Cells (2 x 106) were lysed in NP40 lysis buffer [50 mmol/L Tris-HCl (pH 7.5), 150 mmol/L NaCl, 0.5% NP40, and 1 mmol/L phenylmethylsulphonyl fluoride], centrifuged at 14,000 rpm for 15 minutes and the protein concentration of the supernatants was determined by protein assay reagent; bicinchoninic acid protein assay (Pierce, Rockford, IL). Twenty micrograms of cell lysates were mixed with equal volume of SDS-PAGE loading buffer, separated in an 8% polyacrylamide gel, and electroblotted to Protan nitrocellulose membranes (Schleicher and Schuell, Keene, NH). The blots were probed with a chicken antibody specific for TPP II (Immunesystem, Uppsala, Sweden), and developed by enhanced chemiluminescence (Amersham-Pharmacia Biotech, Uppsala, Sweden). Densitometric analysis was done using the Image Quant software (Molecular Dynamics, Sunnyvale, CA).
Enzyme Assays. Cells (2 x 106) were lysed in 100 µL of 50 mmol/L Tris-buffer (pH 7.5), containing 1% Triton X-100. After centrifugation for 30 minutes at 14,000 rpm and the supernatant was diluted 10-fold with 100 mmol/L potassium phosphate buffer (pH 7.5), containing 30% (w/v) glycerol and 1 mmol/L DTT and protein concentration was determined by bicinchoninic acid protein assay. Fluorogenic substrates (100 µmol/L) detecting TPP II activity (AAF-AMC) were incubated for 45 minutes at 37°C with 1 µg of cytosolic extracts in buffer containing 50 mmol/L Tris-HCl (pH 7.5), 5 mmol/L MgCl2, and 1 mmol/L DTT in a final volume of 100 µL. The fluorescence emission was determined by fluorimeter (Perkin-Elmer, Beaconsfield, United Kingdom) with excitation at 380 nm and emission at 460 nm and is presented as arbitrary units.
Proliferation Assays and Growth Curves. Cells (5 x 103) were distributed in triplicates wells of 96-well U-bottomed microtiter plates in DMEM containing the indicated amounts of FCS. After culture for 48 hours, the cells were pulsed with 0.5 µCi per well [3H]thymidine for 6 hours and then harvested onto glass filters. Incorporated radioactivity was counted on a Wallac 1450 Microbeta liquid scintillation counter (Wallac, Finland). Cells (4 x 103) from exponentially growing cultures were plated in 35 x 10 mm cell culture dishes with 2-mm grids (Nalge Nunc International, Rochester, NY) in 2 mL of DMEM supplemented with 10% FCS. Half of the medium was replaced every other day. The cell number was scored visually by counting at least 20 squares per plate. When indicated the cultures were split equally so that every sample contained equal amount of cells. Cultures of Namalwa cells were seeded at a density of 3 x 105 cells /mL and the number of live cells was counted by trypan blue dye exclusion.
Mitotic Index and Chromosome Counts. Cells (2 x 106) were harvested by trypsinization, washed twice in PBS and resuspended in 75 mmol/L KCl for 5 minutes at room temperature. The cell pellets were then fixed by incubation for 5 minutes in 5% glacial acetic acid and 3% methanol and 5 minutes in freshly prepared fixative solution (3:1, methanol and acetic acid), resuspended in 0.5 mL of fixative solution and dropped onto a clean, wet slide. After air-drying the slides were stained with Giemsa (Merck, Darmstadt, Germany) and metaphases were scored in a phase contrast microscope. Triplicate slides were prepared for each cell line and 10 fields containing 70 to 100 cells were scored from each slide. The mitotic index (MI) corresponds to the % cells in mitosis. Chromosome preparations were made by culturing semiconfluent cells with 50 ng/mL colcemid (Invitrogen AB Life Technologies, Lidingö, Sweden) for 1 hour at 37°C. Pictures of
100 cells from each clone were taken with a cooled CCD camera (Hamamatsu, Osaka, Japan).
Immunofluorescence and Flow Cytometry. Cells (3 x 104) were washed twice in PBS and 100 µL of cell suspension was used for cytospin preparations. The cells were fixed in 4% paraformaldehyde in PBS and permeabilized with 0.2% Triton-X 100 in PBS for 10 minutes at room temperature. For detection of centrosome the slides were stained with a mouse monoclonal anti
-tubulin antibody (GTU-88, Sigma-Aldrich, St. Louis, MO) at a 1:300 dilution followed by Alexa fluor 594 labeled goat anti-mouse antibody (Molecular Probes, Eugene, OR) at a 1:1,000 dilution. Pericentrin and
-tubulin costaining was done by sequential incubation with a rat monoclonal anti-
-tubulin antibody (Serotec, Oxford, United Kingdom) at 1:50 dilution and a rabbit anti-pericentrin serum (Covance/Babco, Berkeley, CA) at a 1:50 dilution. Cells were counterstained with 4',6'-diamidino-2-phenylindole (Vector, Burlingame, CA). Fluorescence was analyzed using a CCD camera equipped LEITZ-BMRB fluorescence microscope (Leica, Wetzlar, Germany) and images were analyzed using the Adobe's Photoshop software. Flow cytometric analysis was done using a FACSort flow cytometer (Becton Dickinson, Sunnyvale, CA) and CELLQUEST software. For cell cycle analysis the cells fixed with 70% ice-cold ethanol and incubated with a propidium iodine (5 mg/mL, Sigma) solution containing 10 mg/mL sodium citrate, 0.3% octylphenoxy-polyethoxyethanol (Igepal CA-630, Sigma), and 1 mg/mL RNAase.
Production of Lentiviruses and Infections. The oligonucleotides TPP II-1 forward 5'-CCGGTGTGGCGATGTGAATACTGCTACTCGAGTAGCAGTATTCACATCGCCACTTTTTG-3' and TPP II-1 reverse 5'-AATTCAAAAAGTGGCGATGTGAATACTGCTAC TCGAGTAGCAGTATTCACATCGCCACA-3'and TPP II-2 forward 5'-CCGGTGATCCTGGC CCTGTATATGACCTCGAGGTCATATACAGGGCCAGGATCTTTTTG-3' and TPP II-2 reverse 5'-AATTCAAAAAGATCCTGGCCCTGTATATGACCTCGAGGTCATATACAGGG CCAGGATCA-3' were annealed and cloned into the into the AgeI and EcoRI sites of the pLKO.puro.1 plasmid containing the human U6 promoter (28). Lentivirus stocks were produced in 293T cells cotransfected with the plasmids lent-VSV-G, Lent-PACK pLKO.puro.1 plasmid containing the RNAi cassette at a 1:2:3 ratio using LipofectAMINE 2000 (Invitrogen, San Diego, CA). Control lentivirus was produced by using the backbone vector pLKO.puro.1. Namalwa cells were plated at a density of 0.5 x 106 cells per well in 6-well plates and infected with 500 µL of virus stock for 2 hours at 37°C. Transduced cells were selected in medium containing 5 µg/mL puromycin (Sigma) for 2 weeks before phenotypic and functional analysis.
| Results |
|---|
|
|
|---|
|
The proliferative capacity of the TPP II overexpressing and control cell lines was further assessed by measuring their MI (i.e., the percentage of cells undergoing cell division at any given time in unsynchronized cultures). The MI of the three vector transfected clones was 3.1, 3.1, and 3.3, whereas a reproducibly higher MI (4.5, 4.7, and 4.9) was recorded in the three TPP II expressing clones. Calculation of the Ps using the two-tailed Student's t test showed that the differences between individual TPP II and control clones were either significant (P < 0.05) or very significant (P < 0.001).
TPP II Overexpression Is Associated with Chromosomal Instability and Mitotic Aberrations in HEK-293 Cells. Because TPP II overexpression correlated with enhanced DNA synthesis and faster cell proliferation we investigated whether other variables linked to cell division might also be affected. Chromosome counts in TPP II and vector transfected cells revealed that the mean chromosome number was higher in the TPP II expressing clones (63.9, 64.6, and 65 for TPP II-17, TPP II-23, and TPP II-5, respectively) compared with vector transfected and parental cells (59.1 and 56.7, respectively). Furthermore, the TPP II overexpressing clones showed a higher degree of aneuploidy with chromosome numbers ranging from 34 to 133 in individual cells whereas a much narrower spread (42-71 chromosomes) was detected in vector-transfected (Fig. 2) and untransfected cells (data not shown).
|
-tubulin, a marker of pericentriolar material. Numerical and structural centrosome abnormalities were detected in the TPP II overexpressing cells (Table 1; Fig. 3). Approximately 23% of the cells in the TPP II-17 clone contained large
-tubulin stained bodies that seemed to be centrosome conglomerates (Fig. 3). This correlated with the presence of multipolar mitosis with more than two
-tubulin positive spindle poles.
|
|
-tubulin (microtubules) and pericentrin (pericentriolar material; Table 3; Fig. 3F). Approximately 40% of the mitotic cells in the Namalwa, Akata, BL 41, and Raji cell lines showed a gravely abnormal spindle apparatus, which seemed as a star-shaped clump with very short microtubules often departing from a central conglomerate of centrosome-like material, whereas the majority of mitotic LCL cells exhibited a normal bipolar spindle (Fig. 3C and E).
|
|
|
10% of the cells by 4',6-diamidino-2-phenylindole staining and fluorescence microscopy (Fig. 5D). A similar percentage of cells with a more than diploid DNA content was detected by propidium iodine staining and fluorescence-activated cell sorting analysis (Fig. 5D). In addition, down-regulation of TPP II correlated with significant slowdown of cell proliferation (Fig. 5E). This slowdown was reproducibly observed in the BL lines Namalwa, Raji, and BL28 during a time window of 2 to 5 weeks post-infection, after which the proliferation rate slowly returned to the levels observed in control cells. This reversion of growth phenotype correlated with progressive increase of TPP II expression in spite of continuous puromycin selection suggesting that the revertants have a selective advantage in culture.
|
| Discussion |
|---|
|
|
|---|
The most surprising aspect of our findings is the correlation between TPP II overexpression and disturbance of mitosis, including the accumulation of numerical and structural centrosome abnormalities and the formation of multipolar spindles. This is likely to be the primary mechanism underlying the enhanced aneuploidy observed in the HEK-293 transfectants and could also play a role in the mitotic infidelity with loss and gain of whole chromosomes that frequently occurs in BLs (29). Two possible scenarios may be considered. TPP II may be involved in the turnover of one or more regulators of cell division. Many of these proteins are known substrates of the ubiquitin-proteasome system and TPP II was shown to interact with this proteolytic machinery, probably by acting downstream of the proteasome and facilitating the flow-through of substrates (5, 7, 8, 15). Thus, whereas lacking the exquisite substrate specificity of ubiquitin-dependent proteolysis, TPP II may still preferentially affect the turnover of certain substrates and favor the selection of cells with distinct growth advantages. However, TPP II may also act independently of the proteasome because overexpression of TPP II did not affect proteasome activity in transfected HEK-293 cells and, in contrast to the reported effect in EL4 cells (8), it did not protect the transfectants from intoxication with various types of proteasome inhibitors (data not shown). The possibility that TPP II may by an independent player in proteolysis is in line with its multimeric structure (5) and potential association-dependent regulation of enzyme activity (30). This structural complexity suggests that TPP II may be capable of sophisticated functions, including endopeptidase activity and substrate recognition. TPP II is exclusively localized in the cytosol and could therefore gain access to nuclear regulator of the cell cycle only after disappearance of the nuclear membrane during mitosis. The peculiar phenotype of TPP II overexpressing cells where multiple centrosomes and spindle abnormalities are accompanied by accelerated cell proliferation, and the appearance of multinucleated cells following TPP II knockdown, suggest that TPP II may be involved in processes that connect centrosome duplication with late events leading to the separation of daughter cells after mitosis. Indeed, recent evidence confirms that the centrosome plays a direct role in the completion of cytokines via relocalization of the mother centriole to the intercellular bridge close to the midbody (31). Whereas the molecular events triggered by this relocalization remain unknown, time lapse videomicroscopy studies have shown that cell separation starts only when the cetriole has moved away from the bridge, whereas removal of the centrosome results in defects of cytokinesis and polyploidy (reviewed in ref. 32).
Although a direct role of TPP II in the regulation of cell division seems likely, we cannot formally exclude that TPP II may indirectly promote the accumulation of genetically altered cells by affecting their capacity to undergo apoptosis. Overexpression of c-Myc was shown to be associated with DNA damage (33) and the rapid induction of numerical and structural chromosomal aberration in normal fibroblasts and other cell types (3436). Furthermore, numerical and structural centrosome defects are often observed in cells expressing viral oncogenes, including HPV-16 E7 and adenovirus E1A and E1B proteins (17). Thus, adenovirus-transformed HEK-293 cells and BL lines share the expression of viral or cellular oncogenes that may promote mitotic infidelity. The genetically altered cells generated as a consequence of aberrant mitosis may not survive unless apoptosis is also blocked. A possible involvement of TPP II in the regulation of apoptosis was suggested by the finding that TPP II overexpressing EL-4 cells express high levels of the inhibitor of apoptosis protein c-IAP-1 and fail to degrade c-IAP- 1 and XIAP after treatment with etoposide (15). Interestingly, another member of the IAP family, survivin, was shown to play a double role in the regulation of cell survival and cell division (37). In addition to spontaneous apoptosis, antisense suppression of survivin was shown to produce a phenotype of aberrant mitotic progression with supranumerary centrosome, formation of multipolar mitotic spindles, failure of cytokinesis, and generation of multinucleated cells (38) that bears striking similarity to that of the functional TPP II knockdown observed in our experiments. It should be stressed, however, the mechanism underlying that stabilization of IAPs following TPP II overexpression remains unclear and a direct role of the enzyme in the turnover of these antiapoptotic proteins seems unlikely since their level of expression was not affect following TPP II knockdown in BL cells (data not shown).
Our results highlight an unexpected role of TPP II in the regulation of cell division. By acting in concert with cellular or viral oncogenes, TPP II seems to play an important role in promoting the survival of cells with numerical and structural chromosomal aberration, a hallmark of malignant transformation and progression. These findings warrant further investigation on the potential therapeutic use of TPP II inhibitors to target genetic instability, tumor progression and the development of drug resistance in various types of malignancies.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Drs. S.A. Stewart and L. Naldini (University of Torino, Italy) for the kind gifts of the lentiviral plasmids and all the colleagues who have helped us to critically evaluate and discuss our data.
Received 6/15/04. Revised 11/ 9/04. Accepted 12/ 7/04.
| References |
|---|
|
|
|---|
in a conditional fashion. Virology 1995;214:6759.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
E. Firat, C. Tsurumi, S. Gaedicke, J. Huai, and G. Niedermann Tripeptidyl Peptidase II Plays a Role in the Radiation Response of Selected Primary Cell Types but not Based on Nuclear Translocation and p53 Stabilization Cancer Res., April 15, 2009; 69(8): 3325 - 3331. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Huai, E. Firat, A. Nil, D. Million, S. Gaedicke, B. Kanzler, M. Freudenberg, P. van Endert, G. Kohler, H. L. Pahl, et al. Activation of cellular death programs associated with immunosenescence-like phenotype in TPPII knockout mice PNAS, April 1, 2008; 105(13): 5177 - 5182. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Blanco, G. Larrinaga, I. Perez, J. I. Lopez, J. Gil, E. Agirregoitia, and A. Varona Acid, basic, and neutral peptidases present different profiles in chromophobe renal cell carcinoma and in oncocytoma Am J Physiol Renal Physiol, April 1, 2008; 294(4): F850 - F858. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Hong, L. Lei, B. Kunert, R. Naredla, S. E. Applequist, A. Grandien, and R. Glas Tripeptidyl-peptidase II Controls DNA Damage Responses and In vivo {gamma}-Irradiation Resistance of Tumors Cancer Res., August 1, 2007; 67(15): 7165 - 7174. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Varona, L. Blanco, J. I. Lopez, J. Gil, E. Agirregoitia, J. Irazusta, and G. Larrinaga Altered levels of acid, basic, and neutral peptidase activity and expression in human clear cell renal cell carcinoma Am J Physiol Renal Physiol, February 1, 2007; 292(2): F780 - F788. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |