Cancer Research Grants Metabolism
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hotfilder, M.
Right arrow Articles by Vormoor, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hotfilder, M.
Right arrow Articles by Vormoor, J.
[Cancer Research 65, 1442-1449, February 15, 2005]
© 2005 American Association for Cancer Research

Cell and Tumor Biology

Leukemic Stem Cells in Childhood High-Risk ALL/t(9;22) and t(4;11) Are Present in Primitive Lymphoid-Restricted CD34+CD19– Cells

Marc Hotfilder1, Silja Röttgers2, Annegret Rosemann1, André Schrauder3, Martin Schrappe3, Rob Pieters4, Heribert Jürgens1, Jochen Harbott2 and Josef Vormoor1

1 Department of Pediatric Hematology and Oncology, University Children's Hospital Münster, Münster, Germany; 2 Department of Pediatric Hematology and Oncology, University Children's Hospital Giessen, Giessen, Germany; 3 ALL-BFM Study Center, Hannover, Germany; and 4 Erasmus MC-Sophia Children's Hospital, University Medical Center, Rotterdam, the Netherlands

Requests for reprints: Josef Vormoor, Klinik und Poliklinik für Kinder- und Jugendmedizin, Pädiatrische Hämatologie und Onkologie, Universitätsklinikum Münster, Albert-Schweitzer-Str. 33, 48129 Münster, Germany. Phone: 49-251-83-47742; Fax: 49-251-83-47828; E-mail: vormoor{at}uni-muenster.de.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Open questions in the pathogenesis of childhood acute lymphoblastic leukemia (ALL) are which hematopoietic cell is target of the malignant transformation and whether primitive stem cells contribute to the leukemic clone. Although good-prognosis ALL is thought to originate in a lymphoid progenitor, it is unclear if this applies to high-risk ALL. Therefore, immature CD34+CD19– bone marrow cells from 8 children with ALL/t(9;22) and 12 with ALL/t(4;11) were purified and analyzed by fluorescence in situ hybridization, reverse transcription-PCR (RT-PCR), and colony assays. Fifty-six percent (n = 8, SD 31%) and 68% (n = 12, SD 26%) of CD34+CD19– cells in ALL/t(9;22) and ALL/t(4;11), respectively, carried the translocation. In addition, 5 of 168 (3%) and 22 of 228 (10%) myeloerythroid colonies expressed BCR/ABL and MLL/AF4. RT-PCR results were confirmed by sequence analysis. Interestingly, in some patients with ALL/t(4;11), alternative splicing was seen in myeloid progenitors compared with the bulk leukemic population, suggesting that these myeloid colonies might be part of the leukemic cell clone. Fluorescence in situ hybridization analysis, however, shows that none of these myeloid colonies (0 of 41 RT-PCR-positive colonies) originated from a progenitor cell that carries the leukemia-specific translocation. Thus, leukemic, translocation-positive CD34+CD19– progenitor/stem cells that were copurified by cell sorting were able to survive in these colony assays for up to 28 days allowing amplification of the respective fusion transcripts by sensitive RT-PCR. In conclusion, we show that childhood high-risk ALL/t(9;22) and t(4;11) originate in a primitive CD34+CD19– progenitor/stem cell without a myeloerythroid developmental potential.

Key Words: childhood leukemia • ALL • leukemic stem cells • BCR/ABL • MLL/AF4


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Chromosomal translocations are a hallmark of childhood acute lymphoblastic leukemia (ALL) and can be detected in ~75% of patients by molecular and cytogenetic methods. Individual translocations are associated with distinct gene expression profiles (1), and clinical studies have correlated specific translocations with prognosis (2), demonstrating their biological and clinical significance. Moreover, molecular characterization of these translocations has provided new insight into leukemia cell biology (2). The Philadelphia chromosome t(9;22) leading to the BCR/ABL fusion oncogene and the translocation t(4;11) with formation of the MLL/AF4 fusion oncogene have been associated with a particular poor outcome (3, 4). Although both ALL subtypes are considered high risk, differences in age distribution indicate differences in pathogenesis. Whereas ALL/t(9;22) is a leukemia mostly occurring in adults and in few adolescents, there is evidence that infant ALL/t(4;11) already originates prenatally (5).

For understanding leukemia cell biology, it is important to realize that only rare cells within the neoplastic clone are responsible for sustaining the malignant proliferation. Functional studies in human acute myelogenous leukemia have conclusively shown the existence of a small population of leukemic stem cells that are capable of initiating leukemic growth following transplantation into immune-deficient mice (6–8). The malignant phenotype is a result not only of the chromosomal translocation but also of the complex interactions of the molecular events caused by these chromosomal translocations with the endogenous expression profile/proteome of the transformed cell. Thus, identification of the normal hematopoietic cell that is the target for malignant transformation and the resultant leukemic stem cell is fundamental for understanding the pathogenesis of pediatric ALL. Very little is known of the leukemic stem cell from ALL.

Based on the detection of clonal immunoglobulin heavy chain and T-cell receptor gene rearrangements and the overall good curability of childhood ALL, it had been hypothesized that the malignant transformation in most children with ALL occurs in a lymphoid-committed progenitor cell prone to undergo apoptosis (9). Flow cytometric investigations showed that primitive progenitor/stem cells have a phenotype that is very distinct from the leukemic clone (10, 11). These observations together with molecular analyses in good-prognosis ALL/t(12/21) demonstrating that primitive CD34+CD19– do not carry the leukemia-specific chromosomal translocation (12) supported this hypothesis. However, although it seems that the primitive stem/progenitor cell compartment is not involved in this type of ALL, recent molecular analysis of clonal immunoglobulin heavy chain and T-cell receptor rearrangements showed that the leukemia can arise at different stages of B-cell differentiation (13) and in a significant subset of patients in a lymphoid progenitor cell before initiation of immunoglobulin heavy chain rearrangement (13, 14). Similar to ALL/t(12;21), in ALL with hyperdiploidy, no hyperdiploid cells could be detected within the T-lymphoid or myeloid cell compartment (15), supporting the B-lymphoid origin of good-prognosis childhood ALL.

In contrast, for the minority of children with high-risk ALL, transformation of a more primitive hematopoietic stem cell had been suspected (9). Evidence for the involvement of primitive stem/progenitor cells in childhood ALL derives from the detection of genetically aberrant cells (16) and leukemia-specific T-cell receptor rearrangements (17) within the CD34+CD38– progenitor/stem cell compartment and by a high percentage of oligoclonality regarding immunoglobulin heavy chain and T-cell receptor rearrangements (18, 19). These data support the original hypothesis proposed by Greaves that the poor outcome in high-risk ALL is consequence of the transformation of a primitive (i.e., chemotherapy- and apoptosis-resistant stem cell). In this view, both the specific chromosomal translocations involved and a specific target cell play a role in pathogenesis.

Most data on stem cell involvement are available on Philadelphia chromosome–positive ALL/t(9;22). Detection of Philadelphia chromosome–positive mature myeloid cells (20, 21) and immature myeloid colony-forming progenitors (22, 23) showed stem cell involvement in at least some patients with ALL/t(9;22); thus, the term "stem cell ALL" had been suggested (24). ALL/t(9;22) with multilineage involvement has to be distinguished from chronic myelogenous leukemia presenting in lymphoid blast crisis (chronic myelogenous leukemia-blast crisis). In the latter, the majority of myeloid cells in remission stay Philadelphia chromosome positive (conversion to chronic phase chronic myelogenous leukemia). Data on childhood ALL/t(9;22) are conflicting. Some authors detected multilineage involvement only in adult but not in pediatric patients (23) or only in chronic myelogenous leukemia-blast crisis but neither in pediatric nor in adult ALL patients (25). Others, however, clearly showed multilineage involvement in pediatric patients (20, 22). These conflicting studies show the necessity of additional studies of the stem cell compartment in childhood ALL/t(9;22).

Lineage switch in some infants with ALL/t(4;11) (26) and a high percentage of patients without clonal immunoglobulin heavy chain and T-cell receptor gene rearrangements (27) provide indirect evidence that an immature progenitor/stem cell may be the target of the chromosomal translocation in infant ALL/t(4;11). However, direct data on the involvement of primitive progenitor/stem cells and whether these cells possess a myeloid differentiation potential are lacking.

To further investigate the hypothesis of stem cell involvement in childhood high-risk ALL, purified cell populations with an immature CD34+CD19– immunophenotype from bone marrow of children with newly diagnosed B-cell precursor ALL/t(9;22) and t(4;11) were analyzed by fluorescence in situ hybridization (FISH), reverse transcription-PCR (RT-PCR), and clonogenic assays. We show here that high-risk ALL originate in primitive lymphoid-restricted CD34+CD19– stem cells, a finding that has important implications for the understanding of the biology of this disease and the identification of the therapeutic target cell.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Patients and Cell Lines
Patients. Diagnostic bone marrow samples or peripheral blood were obtained from 8 children (UPN A-H) with t(9;22)-positive B-cell precursor ALL and from 12 children (UPN 1-12) with t(4;11)-positive ALL. Patients A to E were 2 years 6 months, 6 years 11 months, 6 years 6 months, 13 years 8 months, 7 years 6 months, 13 years 9 months, 2 years 9 months, and 8 years 9 months old at diagnosis. Patients 1 to 12 were all ages <12 months, except for patients 4 and 10 who were ages 12 years and 11 years 6 months old at diagnosis, respectively. Only bone marrow samples or peripheral blood before starting chemotherapy were used for analysis. The investigation was approved by the Ethics Committee of the Medical Faculty, University of Münster.

Cell Lines. The cell lines MV4;11 [t(4;11) positive], K562 [t(9;22) positive], and BLIN-1 (negative for all fusion genes analyzed) were used as positive and negative controls. Cells were cultured in RPMI (Biochrom KG, Berlin, Germany) supplemented with 10% FCS (heat-inactivated for MV4;11), 2 mmol/L L-glutamine (Life Technologies, Karlsruhe, Germany) at 37°C and 5% CO2 in a humidified atmosphere.

Processing of Bone Marrow and Peripheral Blood Samples
Cell Sorting. Frozen mononuclear cells (1 x 107-7 x 107 cells) from diagnostic bone marrow and peripheral blood samples were thawed, washed with Iscove's modified Dulbecco's medium containing 10% FCS and stained with saturating amounts of anti-CD19 phycoerythrin (J4.119, Beckman Coulter, Krefeld, Germany) and anti-CD34 FITC (581, Beckman Coulter) antibody conjugates in a total volume of 100 to 200 µL Iscove's modified Dulbecco's medium plus 10% FCS for 20 minutes at 4°C. Cells were resuspended in Iscove's modified Dulbecco's medium with 10% FCS at a concentration of 107 cells/mL. Analysis and cell sorting were done on a FACSVantage (Becton Dickinson, Heidelberg, Germany). Sorting gates were placed on CD34+CD19– and CD34+CD19+ populations (Fig. 1) using CellQuestPro software (Becton Dickinson). Flow cytometric reanalysis of the sort fractions was done on a FACSCalibur (Becton Dickinson). Reanalysis always showed a pure cell population; however, the antigen distribution of the CD34+CD19– and the CD34+CD19+ cell population differs slightly from the original sort gates (Fig. 1).



View larger version (18K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 1. Flow cytometric sorting of CD34+CD19– cells. A, flow cytometric analysis of patient 3 before sorting and the gates set to isolate CD34+CD19– and CD34+CD19+ cells. Reanalysis of the flow-sorted CD34+CD19– (B) and CD34+CD19+ (C) cells showing a purity of the CD34+CD19– sort fraction of 99% and the CD34+CD19+ fraction of 97%.

 
Sorting of Cells for Reverse Transcription-PCR Analysis and Isolation of RNA. Cells (n = 1,000) from each population (CD34+CD19– and CD34+CD19+) and from cell lines (controls) were sorted directly into 100 µL RLT buffer (supplied with the RNeasy Mini kit, Qiagen, Hilden, Germany). RLT buffer (250 µL) and ß-mercaptoethanol (3.5 µL) were added and the samples were passed through Qiashredder columns (Qiagen) according to the manufacturer's protocol. The lysate was frozen and stored at –80°C. Total RNA was extracted from the frozen lysates according to the RNeasy Mini kit protocol. RNA was finally eluted with 30 µL RNase-free water and stored at –80°C.

Preparation of Slides for Fluorescence In situ Hybridization Analysis. Cells (n = 600-2,000) from each population were directly sorted into 20 µL drops of PBS that were placed on a grease-free glass slide. The slides were incubated for 10 minutes in a moist chamber to allow settling of the cells within the PBS drop and adherence to the glass slide. Subsequently, excessive PBS was carefully removed with a paper towel. The cells were fixed on the slide with ice-cold methanol/glacial acid (3:1, v/v). Air-dried slides were analyzed by FISH (see below).

Purification of Cells for Colony Assays. For colony assays, 3,000 CD34+CD19– and 30,000 CD34+CD19+ cells were directly sorted into 300 µL Iscove's modified Dulbecco's medium with 10% FCS.

Colony Assays. Sorted cells (n = 3,000-30,000) or unsorted cells (6 x 104-2.3 x 105) in 300 µL Iscove's modified Dulbecco's medium with 10% FCS were added to 2.7 mL MethoCult H4434 (Stem Cell Technologies/Cell Systems GmbH, St. Katharinen, Germany), which supports colony formation of myeloid progenitor cells. Cells were plated in duplicate. Colonies were counted and photographed 18 to 28 days after plating. For expression analysis of BCR/ABL or MLL/AF4 fusion transcripts within colonies using RT-PCR, individual colonies were picked and transferred into 350 µL RLT buffer plus 3.5 µL ß-mercaptoethanol (RNeasy Mini kit). Preparation of RNA and RT-PCR analysis were done as already described. Some colonies were transferred into 400 µL PBS, split in two. Half was used for RT-PCR analysis where as the other half was used to prepare a cytospin for FISH analysis (see below).

Molecular Analysis of Sorted Cell Populations and Myeloid Colonies
Reverse Transcription-PCR Analysis of Cellular Material. Qualitative RT-PCR analysis of sorted cell populations and isolated myeloid colonies for GAPDH, m-BCR/ABL, M-BCR/ABL, and MLL/AF4 was done with the following PCR primers for m-BCR/ABL and M-BCR/ABL: ABL external sense CCAGACTGTTGACTGGCGTGATGT, ABL internal sense TTCACACCATTCCCCATTGTGATT, mBCR external antisense CAACAGTCCTTCGACAGCAGCAGT, mBCR internal antisense ATGACGAGGGCGCCTTCCATGGAG, M-BCR external antisense CCTCTGACTATGAGCGTGCAGAGT, and M-BCR internal antisense AGAAGTGTTTCAGAAGCTTCTCCCT. The primer sets for detection of MLL/AF4 fusion transcripts were MLL external sense CTGAATCCAAACAGGCCACCACCACTC, MLL internal sense GGTCTCCCAGCCAGCACTGGTC, AF-4 external antisense GTCACTGAGCTGAAGGTCGTCT, and AF-4 internal antisense AGCATGGATGACGTTCCTTGCTGA. Primers for GAPDH have been described (12). GAPDH amplification and the first amplification round of BCR/ABL or MLL/AF4 were done by using the One-Step RT-PCR kit (Qiagen). 2.5 µL (for BCR/ABL RT-PCR), 5 µL (for MLL/AF4 RT-PCR) or 3 µL (for GAPDH RT-PCR) total RNA were transcribed into cDNA. The reverse transcription reaction and amplification were done in a total volume of 50 µL containing 0.2 µmol/L of each primer, 400 µmol/L of each deoxynucleotide triphosphate, 1x One-Step RT buffer, and One-Step RT-PCR enzyme mix. Reverse transcription and amplification conditions were 30 minutes at 50°C (reverse transcription reaction), 15 minutes at 95°C followed by 35 PCR cycles (15 seconds at 94°C, 45 seconds at 64°C, and 45 seconds at 72°C). For GAPDH, amplification conditions were 30 minutes at 50°C (reverse transcription reaction), 15 minutes at 95°C followed by 30 PCR cycles (30 seconds at 94°C, 45 seconds at 66°C, and 60 seconds at 72°C). All reactions were terminated by a final extension step of 10 minutes at 72°C. GAPDH amplification product (20 µL) was loaded onto a 0.8% agarose gel containing 0.5 µg/mL ethidium bromide.

A second PCR for BCR/ABL or MLL/AF4 amplification was done in a total volume of 50 µL containing 5 µL of the first PCR product, 0.2 µmol/L of each corresponding nested primer, 200 µmol/L of each deoxynucleotide triphosphate, 10 mmol/L Tris-HCl (pH 8.3), 50 mmol/L KCl, 1.5 mmol/L MgCl2, 0.1 mg/mL bovine serum albumin, 0.05% Triton X-100, and 1 unit Taq. PCR was done with a denaturing step (60 seconds at 94°C) followed by 25 cycles (15 seconds at 94°C, 45 seconds at 60°C, and 45 seconds at 72°C) and 6 minutes at 72°C for final extension. Amplification product (20 µL) was loaded onto a 0.8% agarose gel.

Sequencing of Reverse Transcription-PCR Products. RT-PCR amplification products were excised from agarose gels and eluted with the QIAquick gel extraction kit (Qiagen). Sequencing reactions were done with the above-mentioned internal sense or internal reverse primers and the use of the ABI Prism Big Dye Terminator version 3.0 Ready Reaction Cycle Seq kit (Applied Biosystems, Darmstadt, Germany) with the following cycle program: 4 minutes 96°C, 35 cycles of 20 seconds at 96°C, 10 seconds at 50°C, and 2 minutes 60°C. Excess primers and nucleotides were removed by using Sephadex G50 columns (Amersham Bioscience, Freiburg, Germany) and sequencing reactions were run on a ABI Prism 3700 sequencer (Applied Biosystems). The obtained BCR/ABL and MLL/AF-4 fusion transcript sequences were named according to the nomenclature used by van Dongen et al. (28).

Dual-Color Fluorescence In situ Hybridization for t(9;22) and t(4;11). FISH analyses were done using the commercially available Vysis LSI BCR/ABL ES Dual Color Translocation Probe and the LSI MLL Dual Color Break Apart Rearrangement Probe (Abott, Wiesbaden, Germany).

The slides with sorted cells or cytospin preparations of myeloid colonies were rehydrated in an alcohol series of 100%, 70% 50%, and 30% ethanol for 1 minute each, passed through 0.1x SSC, and incubated in 2x SSC for 30 minutes at 70°C. After a second 0.1x SSC step, chromosomal DNA was denatured in 0.07 N NaOH for 1 minute at room temperature and chilled in 0.1x and 2x SSC for 1 minute each. The slides were dehydrated in 30%, 50%, 70%, and 100% ethanol and air dried. Probes were denatured and hybridized according to manufacturer's instructions. Hybridization was done in a moist chamber at 37°C overnight. Posthybridization washes were done in 2x SSC for 10 minutes at room temperature, 1x SSC at 72°C for 5 minutes, and 2x SSC/Triton X-100 for 5 minutes at room temperature. The slides were passed through PBS, dehydrated in an ascending alcohol series, and air dried. Cells were counterstained with 4',6-diamidino-2-phenylindole and mounted with Vectashield (Vector Laboratories, Burlingame, CA).

Analysis of FISH preparations was done with a Zeiss Axiophot epifluorescence microscope (Zeiss, Oberkochem, Germany) equipped with a 100 W mercury lamp and an appropriate filter combination. For evaluation of the FISH results, 100 to 200 nuclei were analyzed.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Through extensive flow cytometric studies of immature cell populations in childhood ALL, we have shown that expression of the B-cell antigen CD19 is a suitable marker to distinguish immature progenitor/stem cells from the bulk leukemic population (10, 11). CD19 is part of the CD19/CD21 complex that modulates B-cell receptor signaling (29). Its expression is an early event in B-cell development (30) directly following DJH but preceding or simultaneously occurring with VDJH rearrangement (31). Analysis of immature CD34+CD19– cells for expression of CD45, CD117, and CD133 in the bone marrow from children with B-cell precursor ALL showed that these cells have an immunophenotype similar to normal progenitor/stem cells (10, 11). Accordingly, these CD34+CD19– cells have a similar clonogenicity in myeloid colony assays compared with CD34+CD19– cells from normal bone marrow (12).

Fluorescence In situ Hybridization Analysis of Purified Cell Populations for t(9;22) and t(4;11). For FISH analysis, CD34+CD19– cells were purified by cell sorting as described previously (12). To ensure a high purity of the sorted cell population and exclude sorter errors, reanalysis of the sort fractions was done by flow cytometry whenever possible (Fig. 1). Reanalysis showed a mean purity of the immature CD34+CD19– fraction of 95.4% (n = 6, SD 2.9%) in patient samples with ALL/t(9;11) and 96.0% (n = 11, SD 2.2%) in patient samples with ALL/t(4;11). The purity of the sorted CD34+CD19+ leukemic cell fraction was similar in both groups: ALL/t(9;22) –98.9% (n = 6, SD 0.5%) and ALL/t(4;11) –98.5% (n = 14, SD 0.8%).

As expected, in both ALL/t(9;22) and ALL/t(4;11), the chromosomal translocations were present in the majority of all B-lymphoid CD34+CD19+ cells (on average >93%), confirming that these cells belong to the leukemic clone (Table 1). In contrast to our previous results in good-prognosis ALL/t(12;21) (12), the percentage of immature B lineage-negative cells (CD34+CD19–) that were positive for the Philadelphia chromosome was high, on average 56% (ranging from 15% in patient D to 95% in patient B). Patients diagnosed with t(4;11) had an even higher content of translocation-positive cells (68%) ranging from 28% (patient 7) to 93% (patient 9) within the CD34+CD19– progenitor/stem cell compartment (Table 1). Semiquantitative real-time RT-PCR using dilutions of CD34+CD19+ as standards confirmed high expression of BCR/ABL and MLL/AF4 in CD34+CD19– cells (data not shown). These results show that the leukemia-specific chromosomal translocations are present in a high percentage of immature CD34+CD19– progenitor/stem cells.


View this table:
[in this window]
[in a new window]

  		Table 1. FISH analysis of purified cell populations

 
Colony Assays with Sorted Cell Populations. To characterize the myeloid differentiation and proliferation potential of these primitive CD34+CD19– cells, sorted CD34+CD19– cells were seeded into methylcellulose cultures containing myeloid growth factors. The clonogenicity of these cells in patients with ALL/t(9;22) and ALL/t(4;11) was similar [4.1% (n = 8, SD 3.7%) and 1.7% (n = 13, SD 1.9%) of plated cells, respectively]. The whole spectrum of colonies, including CFU-G, CFU-M, CFU-GM, BFU-E, and CFU-GEMM, was generated (Fig. 2A-D). This clonogenicity is comparable with CD34+CD19– cells purified by cell sorting from previously frozen control bone marrow (6.5%, n = 3, SD 0.8%; ref. 12). In contrast, B-lymphoid leukemic CD34+CD19+ cells were unable to proliferate and differentiate under these conditions (data not shown). These results show that CD34+CD19– cells from patients with ALL/t(9;22) or t(4;11) have a similar albeit slightly lower myeloid-erythroid clonogenic potential compared with normal bone marrow.



View larger version (52K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 2. Molecular analysis of myeloid colonies. Multilineage CFU-GEMM (A), CFU-G (B), BFU-E (C), and CFU-M (D) generated from CD34+CD19– cells (A and B) and unsorted BM (C and D) in methylcellulose cultures from patient 3. Original magnification, x50. E, RT-PCR analysis of 26 colonies from patient 9 showing that CFU derived from CD34+CD19– or unsorted bone marrow express MLL/AF-4 fusion transcripts. Sequence analysis of RT-PCR products identified the fusion transcript e9-e4 (424 bp) in colonies c, t-z, and A. +, cell line MV4;11 containing e9-e5 (379 bp); -, negative control. For details of the MLL/AF-4 fusion transcripts identified in patient 9 and MV4;11, see Fig. 3B.

 


View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 3. MLL/AF-4 fusion transcripts in sorted cells and myeloid colonies. A, RT-PCR analysis of sorted CD34+CD19+ (+) and myeloid colonies derived from sorted CD34+CD19– or unsorted cells from patients 3, 5, and 8. B, schematic diagram of the MLL/AF-4 fusion transcripts identified in patients 3, 5, 8, and 9 and MV4;11. Arrows, relative position of the second primer pair.

 
Reverse Transcription-PCR Analysis of Myeloid Colonies. To analyze if these colony-forming progenitor cells contained the chromosomal translocation of the leukemic clone or if they were normal, individual colonies were isolated and subjected to RT-PCR for BCR/ABL or MLL/AF4. Only in two of the eight patients with ALL/t(9;22) (patients B and D), low numbers of BCR/ABL-positive colonies were detected when sorted CD34+CD19– cells were seeded into methylcellulose cultures: 5 of 168 colonies (3.0%). Similarly, in seven of nine evaluable patients with ALL/t(4;11) (patients 2, 4, 5, 8, 9, 11, and 12), MLL/AF4-positive myeloid colonies were found: 22 of 228 colonies (9.6%; Table 2; Fig. 2E). This was much lower than expected from the percentage of FISH-positive leukemic cells within the CD34+CD19– progenitor/stem cell compartment. Detection of the fusion oncogenes was not restricted to a particular colony type but was found in granulocyte/macrophage (CFU-GM) as well as in erythroid (BFU-E) and multilineage (CFU-GEMM) colonies.


View this table:
[in this window]
[in a new window]

  		Table 2. Analysis of BCR/ABL and MLL/AF4 fusion transcripts in myeloid colonies

 
Sequence Analysis of BCR/ABL and MLL/AF4 Reverse Transcription-PCR Products. To analyze if the detection of BCR/ABL and MLL/AF4 fusion transcripts in myeloid colonies was due to low-level contamination with leukemic cells that under these culture conditions survive but do not proliferate, the PCR products were isolated, sequenced, and compared with the fusion transcripts amplified from the bulk leukemic population (Table 2). Due to the rarity of CD34+CD19– cells, unsorted as well as sorted CD34+CD19– cells were plated into methylcellulose cultures for this analysis to increase the number of evaluable myeloid colonies.

Gel electrophoresis revealed that PCR products of different length were amplified in different cell populations from the same patient. In some patients, two transcripts were coamplified in purified cell populations (patient 8), or individual colonies from the same patient expressed different fusion transcripts (patient 5 and 8; Fig. 3A), or the PCR product identified in myeloid colonies differed from that of the bulk leukemic population (patient 3; Fig. 3A).

RT-PCR products were sequenced from three patients with ALL/t(9;22). Two patients expressed the m-BCR/ABL fusion transcript e1-a2 within the CD34+CD19+ bulk leukemic population (patients A and B). Primitive CD34+CD19– cells from patient A, however, contained a longer fusion transcript that was generated by uncompleted splicing. This fusion transcript contained sequences from the intron between "alternative exon 2" and exon 2 (e2). In myeloid colonies from patient B, the same e1-a2 transcript was found as in CD34+CD19+ cells. Leukemic cells from patient D expressed the M-BCR/ABL fusion transcript b3-a2, which was also found in the myeloid colonies.

From eight patients with ALL/t(4;11) in whom sequence analysis was done, seven (patients 1, 2, 4, 5, 6, 8, and 9) had one distinct fusion transcript present in the bulk leukemic population (Table 2). In contrast, in the CD34+CD19+ population of patient 3, two fusion transcripts were coamplified (Fig. 3A). Sequencing identified the bigger one as an e10-e6 fusion transcript, whereas the smaller one was generated by differential splicing leading to deletion of MLL exon 9 (Fig. 3B). In three patients, the same fusion transcript present in the bulk leukemic population was also detected within the myeloid colonies (patients 2, 4, and 9). Alternative splicing, however, was a common event detected by RT-PCR of myeloid colonies. Patient 5 expressed an e10-e4 fusion transcript in the CD34+CD19+ population. This transcript was found in one myeloid colony, whereas in another colony a smaller e10-e4 transcript lacking MLL exon 9 (Fig. 3) was amplified. Alternative splicing could also be shown in myeloid colonies from patient 8 expressing e11-e4. From some myeloid colonies e11-e4 was amplified, from others e10-e4, indicating deletion of MLL exon 11 during splicing (Fig. 3A). Interestingly, in all myeloid colonies from this patient, a 3-bp deletion of the 5' end of AF4 exon 4 was found irrespective if e11 was deleted or not. Another splicing event occurred in the myeloid colonies of patient 3 with e10-e6 (see above) expressed in the bulk leukemic population. In all fusion transcript-positive colonies, an e11-e6 fusion transcript was detected, indicating that the breakpoint on the DNA level in this patient was 3' of MLL exon11.

This high frequency of alternative splicing found in myeloid colonies compared with the bulk leukemic cell population suggested that these myeloid colonies might be part of the leukemic cell clone (32).

Fluorescence In situ Hybridization Analysis of Reverse Transcription-PCR–Positive Myeloid Colonies. To definitely exclude that the detection of BCR/ABL and MLL/AF4 fusion transcripts and its splice variants in myeloid colonies was due to contamination of the methylcellulose cultures with leukemic blasts, individual colonies were isolated and split for RNA extraction and FISH analysis. Colonies from which the respective fusion transcripts could be amplified by RT-PCR were selected for further analysis.

Eleven BCR/ABL-positive myeloid colonies from two patients with ALL/t(9;22) and 30 MLL/AF4-positive myeloid colonies from six patients with ALL/t(4;11) were analyzed by FISH for the respective translocation (Table 3). Each myeloid colony derives from a single clonogenic progenitor cell. Therefore, a colony originating from a leukemic progenitor cell should consist of leukemic cells only (i.e., >90% translocation-positive cells by FISH analysis). Surprisingly, the percentage of translocation-positive cells by FISH in these colonies was low, ranging from 0.5% to 27.5% (mean 6.5%, n = 41, SD 6.7%). This clearly shows that none of these myeloid colonies originated from a progenitor cell that carries the leukemia-specific translocation.


View this table:
[in this window]
[in a new window]

  		Table 3. Analysis of purified myeloid colonies

 
Control experiments with methylcellulose taken from the space in between individual colonies resulted in amplification of MLL/AF4 resp. BCR/ABL fusion transcripts (data not shown) and thus prove contamination of these methylcellulose assays with leukemic cells. This correlates with the high frequency of CD34+CD19– cells carrying the leukemia-specific translocation [56% in ALL/t(9;22) and 68% in ALL/t(4;11)] that are copurified on cell sorting. Apparently, these leukemic CD34+CD19– cells are able to survive for up to 28 days but unlike their normal counterparts are unable to proliferate and differentiate into myeloid cells under these cell culture conditions.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
In the experiments described here, we have been able to show that in childhood high-risk ALL/t(9;22) and t(4;11) the leukemic cell clone originates in a primitive B lineage-negative but still lymphoid-restricted progenitor/stem cell.

Our conclusions are based on the following observations: leukemia-specific translocations could be detected in a high percentage of progenitor/stem cells with a primitive B lineage-negative (i.e., CD34+CD19–) immunophenotype. By FISH analysis, on average 56% of CD34+CD19– cells in ALL/t(9;22) and 68% in ALL/t(4;11) belonged to the leukemic cell clone. This is in contrast to our previous results in ALL/t(12;21) where we were unable to detect t(12;21)-positive CD34+CD19– cells by FISH analysis above background (12).

Functional analysis of the sorted CD34+CD19– progenitor/stem cells in high-risk ALL in a myeloid differentiation assay revealed a close to normal clonogenicity compared with corresponding progenitor cells from nonleukemic controls. Interestingly, in a low number of these myeloid colonies, including CFU-GM, BFU-E, and rare primitive CFU-GEMM, BCR/ABL (3% of the colonies) or MLL/AF4 (10% of the colonies) could be amplified. These data were supported by the observation that in some patients PCR products of different length were amplified in different cell populations. Sequence analysis revealed common splice variants. Particularly for patients with t(4;11), these splice variants have been well characterized (28, 33) and all preserve the mRNA reading frame.

Although the percentage of RT-PCR-positive colonies was much lower than the percentage of FISH-positive CD34+CD19– cells, these data suggested that the myeloid colonies may derive from a leukemic progenitor (32). However, FISH analysis of these colonies showed that amplification of the fusion transcripts by RT-PCR was due to low-level contamination of the culture assay with leukemic cells and that the myeloid colonies derived from normal progenitors. Thus, leukemic, translocation-positive CD34+CD19– progenitor/stem cells that were copurified by cell sorting were unable to proliferate and differentiate into myeloid cells under these conditions. Nevertheless, these cells were able to survive in these colony assays for up to 28 days allowing amplification of the respective fusion transcripts by sensitive RT-PCR. The high frequency of amplification of rare splice products different from the bulk leukemic populations was attributed to preferential amplification of the dominant splice variant in the bulk population.

There is growing evidence that certain ALL subtypes originate in a more primitive progenitor cell than previously assumed. Transplantation of sorted CD34+CD19– has been shown to transfer the leukemia onto immune-deficient mice (34, 35), demonstrating that this cell fraction harbors the clonogenic leukemic stem cells. Here, we are able to show that in high-risk ALL/t(4;11) and t(9;22) these CD34+CD19– malignant stem cells are lymphoid restricted. Although a high percentage of CD34+CD19– cells contain the leukemic translocation, they are unable to differentiate into myeloid cells under standard cell culture conditions optimized for myeloid development.

The inability of leukemic CD34+CD19– to differentiate into myeloid cells could be due to the lineage restriction of the transformed progenitor/stem cell or a differentiation block induced by the chromosomal translocation. The example of the translocation t(9;22) supports the first hypothesis of a lineage-restricted progenitor/stem cells. If the translocation t(9;22) occurs in primitive pluripotent stem cells, the patient will develop chronic myeloid leukemia demonstrating that expression of the BCR/ABL fusion oncogene is not prohibitive of myeloid differentiation. If the t(9;22) occurs in a lymphoid-restricted progenitor cell, the patient will develop ALL.

These results have major implications for leukemia cell pathogenesis as they stress the importance of the cellular context in which specific chromosomal translocations occur. The endogenous expression profile/proteome of the cell that is target of the malignant transformation is of utmost importance for the biology and the aggressive clinical behavior of the resulting malignancy.

We therefore propose a model of stem cell hierarchy for ALL: whereas good-prognosis ALL [e.g., ALL with t(12;21) (12) or hyperdiploidy (15)] originates in a CD19+ lymphoid progenitor prone to undergo apoptosis, high-risk ALL develops in a more primitive CD34+CD19– but still lymphoid-restricted progenitor that is more resistant to standard chemotherapy. This hypothesis of a stem cell hierarchy in ALL has therapeutic implications: a cellular immunotherapy directed against CD19 (36, 37) may spare the clonogenic cells in high-risk ALL. Characterization of the malignant stem cells in different ALL subtypes is therefore a prerequisite for the development of therapies specifically targeted against the clonogenic leukemic blasts.


   Acknowledgments
 
Grant support: Deutsche José Carreras-Leukämie-Stiftung e.V. grant DJCLS-R03/03 (J. Vormoor).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Prof. Rolf Marschalek for sharing his experience on MLL/AF4 splicing; Prof. John Dick and Dr. Claudia Rössig for critically reading the article and many helpful comments; and Thomas Jung and Andrea Lücke for their excellent technical help.


   Footnotes
 
Note: M. Hotfilder and S. Röttgers contributed equally to this work.

Received 4/16/04. Revised 11/10/04. Accepted 12/13/04.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Yeoh EJ, Ross ME, Shurtleff SA, et al. Classification, subtype discovery, and prediction of outcome in pediatric acute lymphoblastic leukemia by gene expression profiling. Cancer Cell 2002;1:133–43.[CrossRef][Medline]
  2. Rubnitz JE, Look AT. Molecular genetics of childhood leukemias. J Pediatr Hematol Oncol 1998;20:1–11.[CrossRef][Medline]
  3. Pui CH, Chessells JM, Camitta B, et al. Clinical heterogeneity in childhood acute lymphoblastic leukemia with 11q23 rearrangements. Leukemia 2003;17:700–6.[CrossRef][Medline]
  4. Arico M, Valsecchi MG, Camitta B, et al. Outcome of treatment in children with Philadelphia chromosome-positive acute lymphoblastic leukemia. N Engl J Med 2000;342:998–1006.[Abstract/Free Full Text]
  5. Ford AM, Ridge SA, Cabrera ME, et al. In utero rearrangements in the trithorax-related oncogene in infant leukaemias. Nature 1993;363:358–60.[CrossRef][Medline]
  6. Lapidot T, Sirard C, Vormoor J, et al. A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature 1994;367:645–8.[CrossRef][Medline]
  7. Bonnet B, Dick JE. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat Med 1997;3:730–7.[CrossRef][Medline]
  8. Jordan CT. Unique molecular and cellular features of acute myelogenous leukemia stem cells. Leukemia 2002;16:559–62.[CrossRef][Medline]
  9. Greaves M. Stem cell origins of leukaemia and curability. Br J Cancer 1993;67:413–23.[Medline]
  10. Vormoor J, Baersch G, Baumann M, Ritter J, Jürgens H. Flow cytometric identification of candidate normal stem cell populations in CD45-negative B-cell precursor acute lymphoblastic leukaemia (ALL). Br J Haematol 1998;100:501–8.[CrossRef][Medline]
  11. Baersch G, Baumann M, Ritter J, Jürgens H, Vormoor J. Expression of AC133 and CD117 on candidate normal stem cell populations in childhood B-cell precursor acute lymphoblastic leukaemia. Br J Haematol 1999;107:572–80.[CrossRef][Medline]
  12. Hotfilder M, Röttgers S, Rosemann A, et al. Immature CD34+CD19– progenitor/stem cells in TEL/AML-1-positive acute lymphoblastic leukemia are genetically and functionally normal. Blood 2002;100:640–6.[Abstract/Free Full Text]
  13. Weston VJ, McConville CM, Mann JR, et al. Molecular analysis of single colonies reveals a diverse origin of initial clonal proliferation in B-precursor acute lymphoblastic leukemia that can precede the t(12;21) translocation. Cancer Res 2001;61:8547–53.[Abstract/Free Full Text]
  14. Pine SR, Wiemels JL, Jayabose S, Sandoval C. TEL-AML1 fusion precedes differentiation to pre-B cells in childhood acute lymphoblastic leukemia. Leuk Res 2003;27:155–64.[CrossRef][Medline]
  15. Kasprzyk A, Harrison C J, Secker-Walker LM. Investigation of clonal involvement of myeloid cells in Philadelphia-positive and high hyperdiploid acute lymphoblastic leukemia. Leukemia 1999;13:2000–6.[CrossRef][Medline]
  16. Quijano CA, Moore D, Arthur D, et al. Cytogenetically aberrant cells are present in the CD34+CD33–CD38–CD19– marrow compartment in children with acute lymphoblastic leukemia. Leukemia 1997;11:1508–15.[CrossRef][Medline]
  17. George AA, Franklin J, Kerkof K, et al. Detection of leukemic cells in the CD34+CD38– bone marrow progenitor population in children with acute lymphoblastic leukemia. Blood 2001;97:3925–30.[Abstract/Free Full Text]
  18. Green E, McConville CM, Powell JE, et al. Clonal diversity of Ig and T-cell-receptor gene rearrangements identifies a subset of childhood B-precursor acute lymphoblastic leukemia with increased risk of relapse. Blood 1998;92:952–8.[Abstract/Free Full Text]
  19. Stankovic T, Weston V, McConville CM, et al. Clonal diversity of Ig and T-cell receptor gene rearrangements in childhood B-precursor acute lymphoblastic leukemia. Leuk Lymphoma 2000;36:213–24.[Medline]
  20. Anastasi J, Feng J, Dickstein JI, et al. Lineage involvement by BCR/ABL in Ph+ lymphoblastic leukemias: chronic myelogenous leukemia presenting in lymphoid blast vs Ph+ acute lymphoblastic leukemia. Leukemia 1996;10:795–802.[Medline]
  21. Schenk TM, Keyhani A, Bottcher S, et al. Multilineage involvement of Philadelphia chromosome positive acute lymphoblastic leukemia. Leukemia 1998;12:666–74.[CrossRef][Medline]
  22. Tachibana N, Raimondi SC, Lauer SJ, Sartain P, Dow LW. Evidence for a multipotential stem cell disease in some childhood Philadelphia chromosome-positive acute lymphoblastic leukemia. Blood 1987;70:1458–61.[Abstract/Free Full Text]
  23. Kalousek DK, Dube ID, Eaves CJ, Eaves AC. Cytogenetic studies of haemopoietic colonies from patients with an initial diagnosis of acute lymphoblastic leukaemia. Br J Haematol 1988;70:5–11.[Medline]
  24. Secker-Walker LM, Craig JM. Prognostic implications of breakpoint and lineage heterogeneity in Philadelphia-positive acute lymphoblastic leukemia: a review. Leukemia 1993;7:147–51.[Medline]
  25. Pajor L, Vass JA, Kereskai L, et al. The existence of lymphoid lineage restricted Philadelphia chromosome-positive acute lymphoblastic leukemia with heterogeneous bcr-abl rearrangement. Leukemia 2000;14:1122–6.[CrossRef][Medline]
  26. Ridge SA, Cabrera ME, Ford AM, et al. Rapid intraclonal switch of lineage dominance in congenital leukaemia with a MLL gene rearrangement. Leukemia 1995;9:2023–6.[Medline]
  27. Peham M, Panzer S, Fasching K, et al. Low frequency of clonotypic Ig and T-cell receptor gene rearrangements in t(4;11) infant acute lymphoblastic leukaemia and its implication for the detection of minimal residual disease. Br J Haematol 2002;117:3115–21.
  28. van Dongen JJ, Macintyre EA, Gabert JA, et al. Standardized RT-PCR analysis of fusion gene transcripts from chromosome aberrations in acute leukemia for detection of minimal residual disease. Report of the BIOMED-1 Concerted Action: investigation of minimal residual disease in acute leukemia. Leukemia 1999;13:1901–28.[CrossRef][Medline]
  29. Fearon DT, Carroll MC. Regulation of B lymphocyte responses to foreign and self-antigens by the CD19/CD21 complex. Annu Rev Immunol 2000;18:393–422.[CrossRef][Medline]
  30. Loken MR, Shah VO, Dattilio KL, Civin CI. Flow cytometric analysis of human bone marrow. II. Normal B lymphocyte development. Blood 1987;70:1316–24.[Abstract/Free Full Text]
  31. LeBien TW. Fates of human B-cell precursors. Blood 2000;96:9–23.[Abstract/Free Full Text]
  32. Hotfilder M, Röttgers S, Harbott J, et al. Unexpected myeloid differentiation potential of leukemic CD34+CD19– cells expressing t(4;11) and t(9;22) fusion transcripts in childhood high-risk ALL predicts the leukemia-initiating cell derives from the stem cell compartment. Blood 2003;102:22a.
  33. Marschalek R, Greil J, Lochner K, et al. Molecular analysis of the chromosomal breakpoint and fusion transcripts in the lymphoblastic SEM cell line with chromosomal translocation t(4;11). Br Hematol 1995;90:308–20.
  34. Cox CV, Everly RS, Oakhill A, et al. Characterization of acute lymphoblastic leukaemia progentior cells. Blood 2004;104:2919–25.[Abstract/Free Full Text]
  35. Cobaleda C, Gutierrez-Cianca N, Perez-Losada J, et al. A primitive hematopoietic cell is the target for the leukemic transformation in human Philadelphia-positive acute lymphoblastic leukemia. Blood 2000;95:1007–13.[Abstract/Free Full Text]
  36. Rischer M, Pscherer S, Duwe S, et al. {gamma}{delta} T cells for chimeric-receptor mediated antigen-specific tumor immune therapy. Br J Haematol 2004;126:583–92.[CrossRef][Medline]
  37. Rössig C, Pscherer SP, Baer A, et al. Targeting CD19 with genetically modified EBV-specific human T lymphocytes. Ann Hematol 2002;82:S42–3.



This article has been cited by other articles:


Home page
 BloodHome page
L. Wang, H. O'Leary, J. Fortney, and L. F. Gibson
Ph+/VE-cadherin+ identifies a stem cell like population of acute lymphoblastic leukemia sustained by bone marrow niche cells
Blood, November 1, 2007; 110(9): 3334 - 3344.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
S. B. van Waalwijk van Doorn-Khosrovani, J. Janssen, L. M. Maas, R. W.L. Godschalk, J. G. Nijhuis, and F. J. van Schooten
Dietary flavonoids induce MLL translocations in primary human CD34+ cells
Carcinogenesis, August 1, 2007; 28(8): 1703 - 1709.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
G. J. L. Kaspers
Win-WNT pathway in ALL
Blood, April 15, 2007; 109(8): 3135 - 3136.
[Full Text] [PDF]

Home page
 BloodHome page
L. M. Serrano, T. Pfeiffer, S. Olivares, T. Numbenjapon, J. Bennitt, D. Kim, D. Smith, G. McNamara, Z. Al-Kadhimi, J. Rosenthal, et al.
Differentiation of naive cord-blood T cells into CD19-specific cytolytic effectors for posttransplantation adoptive immunotherapy
Blood, April 1, 2006; 107(7): 2643 - 2652.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hotfilder, M.
Right arrow Articles by Vormoor, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hotfilder, M.
Right arrow Articles by Vormoor, J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online