| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell and Tumor Biology |
1 Graduate School of Medical and Pharmaceutical Sciences, Kumamoto University, Kumamoto, Japan; 2 Faculty of Pharmaceutical Sciences and 3 Graduate School of Medicine and Dentistry, Okayama University and 4 Department of Clinical Pharmacy, Shujitsu University School of Pharmacy, Okayama, Japan
Requests for reprints: Tohru Mizushima, Graduate School of Medical and Pharmaceutical Sciences, Kumamoto University, Kumamoto 862-0973, Japan. Phone: 81-96-371-4323; Fax: 81-96-371-4323. E-mail: mizu{at}gpo.kumamoto-u.ac.jp.
| Abstract |
|---|
|
|
|---|
Key Words: NSAIDs tight junction claudin-4 calcium cancer
| Introduction |
|---|
|
|
|---|
The anti-inflammatory action of NSAIDs is mediated through its inhibition of cyclooxygenase (COX). COX is an enzyme essential for the synthesis of prostaglandins, which have a strong propensity for inducing inflammation. Prostaglandins, such as prostaglandin E2 (PGE2), inhibit apoptosis and stimulate cell growth, angiogenesis, and metastasis (68). Furthermore, overexpression of COX-2 (a subtype of COX) has been reported in various tumor cells and tissues (9, 10). Therefore, the inhibition of COX by NSAIDs was thought previously to be the sole explanation for their chemopreventive effect. However, several lines of evidence suggest that chemoprevention by NSAIDs also involves COX-independent mechanisms. Sulindac sulfone, a derivative of the NSAID sulindac, does not inhibit COX activity and has been shown to display antitumor activity in vivo as well as induce apoptosis and inhibit cell growth in tumor cells in vitro (11, 12). Moreover, the induction by NSAIDs of apoptosis and the inhibition of cell growth in COX-null fibroblasts and tumor cells in which COX expression was absent have been reported (13, 14). Therefore, it is important that the COX-independent mechanisms for chemoprevention by NSAIDs are elucidated to develop more effective NSAIDs.
Tight junctions are the most apical intercellular structure in epithelial and endothelial cells and create a physiologic barrier separating the apical and basolateral spaces; in other words, they create a paracellular permeability barrier. Tight junctions contain the transmembrane proteins occludin and claudin, which are connected to the cytoskeleton via zonula occludens (ZO-1; ref. 15). Several studies have shown a correlation between a reduction in tight junction function and tumor progression. A loss of tight junction structure is frequently observed in epithelium-derived cancers, whereas some tumor-promoting agents are known to disrupt tight junctions (16, 17). Furthermore, overexpression of tight junctionrelated proteins (such as claudin-1, claudin-4, and occludin) in cancer cells has been reported to induce apoptosis and suppress the invasive potential of these cells (18, 19).
NSAIDs affect the expression of several genes in a COX-independent manner. For example, NSAIDs induce NAG-1, a transforming growth factor-ß superfamily member protein, which is involved in the induction of apoptosis by NSAIDs (20). We reported recently that NSAIDs induce CCAAT/enhancer binding protein homologous transcription factor, which is involved in the induction of apoptosis by endoplasmic reticulum stressors. By using a CCAAT/enhancer binding protein homologous transcription factordeficient mouse, we showed that this induction is essential for NSAID-induced apoptosis (21). Therefore, systematic screening of genes whose expression is induced by NSAIDs is important for understanding the COX-independent mechanism of chemoprevention by NSAIDs. In this study, we searched for genes in human gastric carcinoma (AGS) cells whose expression is induced by indomethacin. We found that claudin-4, claudin-1, and occludin were induced in these cells in the presence of indomethacin. We propose that the induction of claudin-4 is mediated by an increase in the intracellular Ca2+ concentration. Moreover, by using claudin-4-overexpressing cells and small interfering RNA (siRNA), we show that claudin-4 is involved in the NSAID-mediated suppression of anchorage-independent growth and cell migration.
| Materials and Methods |
|---|
|
|
|---|
Cell Culture and Overexpression of Claudin-4. AGS cells were cultured in Ham's F-12 medium containing 10% fetal bovine serum. Other cell types (MKN-45, KATO-III, Caco-2, and HCT-15) were cultured in RPMI 1640 containing 10% fetal bovine serum. Cells (2 x 105 per well in a 24-well plate) were cultured for 24 hours and used in the experiments. Cell viability was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide method as described previously (22).
A full-length human claudin-4 cDNA was PCR amplified from the cDNA of AGS cells and cloned into pcDNA3.1(-) (Invitrogen). Transfection of AGS cells with plasmids was carried out using LipofectAMINE 2000 (Invitrogen) according to the manufacturer's protocols. The stable transfectants expressing claudin-4 were selected by immunoblotting analysis. Positive clones were maintained in the presence of 300 µg/mL G418.
DNA Microarray Analysis. Total RNA was extracted from cells treated with 0.3 mmol/L indomethacin for 4 hours or nontreated cells using a RNeasy kit (Qiagen, Hilden, Germany) according to the manufacturer's protocols. Samples (10 µg RNA) were labeled with cyanine 3 or cyanine 5conjugated dUTP with the use of an Agilent cDNA labeling kit. The fluorescent-labeled cDNAs were mixed and hybridized simultaneously to Agilent cDNA microarray human I. The microarray was scanned with a DNA Microarray Scanner (Agilent, Palo Alto, CA) using laser excitation at 532 and 635 nm wavelengths for the cyanine 3 and cyanine 5 labels, respectively. The raw pixel intensity images were analyzed using the Feature Extraction and Analysis Software version 7.5 (Agilent). After pixel intensity determination and background subtraction, the ratio of the intensity of the treated cells to the intensity of the control was calculated following normalization.
Reverse Transcription. Total RNA was extracted from cells using a RNeasy kit according to the manufacturer's protocols. Samples (10 µg RNA) were reverse transcribed using a first-strand cDNA synthesis kit (Amersham Tokyo, Japan) according to the manufacturer's instructions. For traditional reverse transcriptioncoupled PCR (RT-PCR), synthesized cDNA was amplified by PCR [Takara (Shiga, Japan) PCR Thermal Cycler] using KOD Plus Polymerase (Toyobo, Osaka, Japan), and reaction products were analyzed by agarose gel electrophoresis. For real-time RT-PCR, synthesized cDNA was applied to real-time RT-PCR (ABI PRISM 7700) using SYBR Green PCR Master Mix (ABI) and analyzed with ABI PRISM 7700 Sequence Detection Software according to the manufacturer's instructions. Real-time cycle conditions were 2 minutes at 50°C followed by 10 minutes at 90°C and then for 45 cycles at 95°C for 30 seconds and 63°C for 60 seconds. Specificity was confirmed by electrophoretic analysis of the reaction products and by inclusion of template-free or reverse transcriptasefree controls. To normalize the amount of total RNA present in each reaction, GAPDH or actin genes were used as an internal standard.
Primer Design. Primers were designed using the Primer3 Web site (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi). Primers are listed as gene name, forward primer, reverse primer. For RT-PCR: claudin-1, CCGTTGGCATGAAGTGTATG, CCAGTGAAGAGAGCCTGACC; claudin-4, CTCTGTGGCCTCAGGACTCT, CAGGACTTCCAAGGGTGAAG; occludin, TCCAATGGCAAAGTGAATGA, GCAGGTGCTCTTTTTGAAGG; COX-1, CTGGCTCCGGAATTCACT, CATCTGGCAACTGCTTCTTC; COX-2, CCACCAACTTACAATGCTGC, CACCAGACCAAAGACCTCC; and actin, GGACTTCGAGCAAGAGATGG, AGCACTGTGTTGGCGTACAG. For PCR cloning: claudin-4, CGGGATCCCTGACAATGGCCTCCATGGGGCT, GCTCTAGATTACACGTAGTTGCTGGCAGC.
Immunoblotting and Northern Blotting Analyses. Whole cell extracts were prepared as described previously (23). The protein concentration of samples was determined by the Bradford method. Samples were applied to 12% SDS-PAGE gels and subjected to electrophoresis, and proteins were then immunoblotted with respective antibodies.
Total RNA was extracted from the cells using a RNeasy kit according to the manufacturer's protocols. Samples (5 µg RNA) were separated by agarose (1%) gel electrophoresis in the presence of 6.3% formaldehyde and blotted onto nylon membranes. DNA probes for claudin-4 were amplified by PCR and labeled with [
-32P]dCTP (6,000 Ci/mmol, Amersham) using the Rediprime II DNA Labeling System (Amersham) according to the manufacturer's instructions. After hybridization and washing, membranes were analyzed with BAS2000A (Fujix, Kanagawa, Japan).
Measurement of the Intracellular Ca 2+ Concentration, [Ca2+]i. The intracellular Ca2+ concentration, [Ca2+]i, was monitored according to manufacturer's protocols (24). Cells were washed with assay buffer containing 115 mmol/L NaCl, 5.4 mmol/L KCl, 1.8 mmol/L CaCl2, 0.8 mmol/L MgCl2, 20 mmol/L HEPES, and 13.8 mmol/L glucose. Cells were then incubated with 4 µmol/L fluo-3/AM in the assay buffer containing 0.1% bovine serum albumin, 0.04% Pluronic F127, and 2 mmol/L probenecid for 40 minutes at 37°C. After washing twice with the assay buffer, cells were suspended in assay buffer containing 2 mmol/L probenecid. Fluo-3 fluorescence of cells in a water-jacketed cuvette (1.6 x 106 cells per cuvette) was measured with a Hitachi (Tokyo, Japan) F-4500 spectrofluorophotometer by recording excitation signals at 490 nm and the emission signal at 530 nm at 1-second intervals. Maximum and minimum fluorescence values (Fmax and Fmin) were obtained by adding 10 mol/L ionomycin and 10 mol/L ionomycin plus 5 mmol/L EGTA (in Ca2+-free medium), respectively. [Ca2+]i was calculated according to the following equation: [Ca2+]i = Kd(F Fmin) / (Fmax F), where Kd is the apparent dissociation constant (400 nmol/L) of the fluorescence dye-Ca2+ complex (24).
Cell Migration Assays. In vitro wound healing assays were used to assess cell migration as described previously (25). Confluent AGS cells on a 24-well plate were used. Two linear wounds were scratched with a p200 pipette tip. The cell-free area was measured before and after 24 hours of incubation (healing step) using Scion Image software (Scion Corp., Frederick, MD).
Soft Agar Assay. Soft agar assay was done as described previously (26). Cells (2 x 104 per dish) were suspended in 0.5 mL of 0.3% Noble agar (Difco, Detroit, MI) supplemented with complete culture medium. This suspension was layered over 0.5 mL of a 0.8% agar medium base layer in 35 mm culture dishes (Iwaki, Chiba, Japan). After 10 days, cells were stained with crystal violet and colonies were counted.
siRNA Targeting of Claudin-4. Synthetic siRNAs were purchased from Qiagen. The target DNA sequence of claudin-4 is CCCGCACAGACAAGCCTTACT and siRNA 5'-CGCACAGACAAGCCUUACUUU-3' and 5'-AGUAAGGCUUGUCUGUGCGGG-3' were used as annealed oligonucleotides. AGS cells were transfected with siRNA using RNAiFect Transfection Reagent (Qiagen) according to the manufacturer's instructions.
Statistical Analysis. All values are expressed as mean ± SE. One-way ANOVA followed by Scheffe's multiple comparison test was used for evaluation of differences between the groups. The Student's t test for unpaired results was done for the evaluation of differences between two groups, which were considered to be significant for values of P < 0.05.
| Results |
|---|
|
|
|---|
|
|
We then examined whether the induction of claudin-4 by indomethacin is specific to AGS cells or is a general property also observed in other cell types. We used MKN-45 and KATO-III cells (derived from gastric cancer tissue) and Caco-2 and HCT-15 cells (derived from colon cancer tissue) to test this effect. As shown in Fig. 1E, indomethacin induced claudin-4 in each of the cell lines tested, with the concentration of indomethacin required for the induction being similar for each cell line.
Diclofenac, another NSAID, also induced claudin-4 in a dose-dependent manner (Fig. 1D). Some NSAIDs are specific in their effect on COX, which exists in two forms, COX-1 and COX-2. Celecoxib, a COX-2-specific NSAID, induced claudin-4 not only in AGS cells (Fig. 1D) but also in the other cell lines tested (Fig. 1F). These results suggest that NSAIDs induce claudin-4 irrespective of whether they are specific for COX-2. It has been reported that both COX-1 and COX-2 mRNA are expressed in AGS, MKN-45, and Caco-2 cells, whereas COX-2 mRNA expression is very low in KATO-III and HCT-15 cells (2933). COX-1 mRNA expression was confirmed by RT-PCR in each of the cell lines tested, whereas COX-2 mRNA expression was detected only in AGS, MKN-45, and Caco-2 cells (Fig. 1G). Therefore, COX-2-specific NSAIDs (in this case, celecoxib) induce claudin-4 not only in COX-2-expressing cells but also in cells lacking COX-2 expression. Furthermore, whereas indomethacin inhibited both COX-1 and COX-2 at a concentration of <1 nmol/L (34), the induction of claudin-4 required higher concentrations (Fig. 1). These findings strongly suggest that NSAIDs induce claudin-4 independently of COX-inhibition.
Mechanism for Induction of Claudin-4 by Indomethacin. For further confirmation that NSAIDs induce claudin-4 independently of COX-inhibition, we examined the effect of PGE2, a major prostaglandin in the gastric mucosa, on the induction of claudin-4 by indomethacin. PGE2 (0.1-10 µmol/L) did not affect the level of claudin-4 in the presence and absence of indomethacin (Fig. 2A). We determined previously the level of PGE2 in the culture medium of AGS cells to be
10 nmol/L (23). Therefore, inhibition of PGE2 synthesis by indomethacin does not seem to be involved in the induction of claudin-4 by indomethacin.
|
(35). To test the contribution of this activity to the induction of claudin-4 by indomethacin, we examined the effect of a peroxisome proliferator-activated receptor-
antagonist (GW9662) on the induction of claudin-4 by indomethacin. As shown in Fig. 2B, GW9662 did not inhibit but rather slightly heightened the induction of claudin-4 by indomethacin. The different concentrations of GW9662 tested did not affect cell viability (data not shown), but based on data from a previous report, these concentrations are considered sufficient to inhibit agonist binding to peroxisome proliferator-activated receptor-
(36). Therefore, peroxisome proliferator-activated receptor-
does not seem to be associated with the induction of claudin-4 by indomethacin. It has been reported that some NSAIDs increase reactive oxygen species production (37). To test the contribution of reactive oxygen species to the induction of claudin-4 by indomethacin, we examined the effects of the antioxidants N-acetylcysteine and SOD. As shown in Fig. 2C and D, neither N-acetylcysteine nor SOD affected claudin-4 expression in either the presence or the absence of indomethacin. Activation of the extracellular signal-regulated kinase pathwayone of the mitogen-activated protein kinase pathwayshas been reported to stimulate the expression of claudin-4. Although some NSAIDs have been reported to activate the extracellular signal-regulated kinase pathway (19, 38), an inhibitor of extracellular signal-regulated kinase (PD98059) did not affect the expression of claudin-4 in either the presence or the absence of indomethacin (Fig. 2E). N-acetylcysteine, SOD, and PD98059 did not affect cell viability at the concentrations used (data not shown). These results suggest that neither reactive oxygen species nor extracellular signal-regulated kinase is responsible for the induction of claudin-4 by indomethacin.
Some NSAIDs have been reported to increase the intracellular Ca2+ concentration, [Ca2+]i (39, 40). In this study, we tested whether an increase in [Ca2+]i by NSAIDs is responsible for the induction of claudin-4. Firstly, we confirmed that a NSAID-induced increase in [Ca2+]i occurred under the same conditions as those in which the induction of claudin-4 in AGS cells was observed. As shown in Fig. 3A, all NSAIDs tested (indomethacin, diclofenac, and celecoxib) increased [Ca2+]i at the same NSAID concentrations that caused the induction of claudin-4.
|
Role of Claudin-4 Induction in the In vitro Antitumor Action of NSAIDs. As described in Introduction, various mechanisms have been proposed for the chemopreventive action of NSAIDs; these include the inhibition of cell growth, stimulation of apoptosis, and inhibition of metastasis. Here, we examined the contribution that NSAID induction of claudin-4 makes to the antitumor effect of NSAIDs in vitro. We constructed stable transfectants of AGS cells that continuously overexpress claudin-4 and selected four clones (clones 1, 6, 7, and 11) in which the level of expression of claudin-4 varied (clone 7 > clone 11 > clone 1 > clone 6; Fig. 4A).
|
We also examined the effect of overexpression of claudin-4 on the induction of apoptosis. In the absence of indomethacin, the cell viability of each clone, as determined by the trypan blue exclusion test, was close to 100%, showing that expression of claudin-4 does not affect cell viability. As shown in Fig. 4C, the dose-response curve for the decrease in cell viability by indomethacin was indistinguishable between each of the claudin-4-overexpressing clones and the mock transfectant control. Further, we confirmed that the cell death (Fig. 4C) was mediated by apoptosis as evidenced by apoptotic DNA fragmentation, activation of caspase-3, and chromatin condensation (data not shown). The results presented in Fig. 4C show that claudin-4 overexpression does not affect the indomethacin-induced cell apoptosis. Therefore, the induction of claudin-4 by NSAIDs does not seem to be involved in NSAID-mediated apoptosis.
The anchorage-independent growth of tumor cells, which can be measured by colony formation in soft agar, is important for tumor progression. NSAIDs are known to inhibit colony formation of some cancer cells in soft agar (13); recently, it was reported that overexpression of claudin-4 in pancreatic cancer cells inhibited colony formation in soft agar (19). In this study, we examined the effect of claudin-4 overexpression and the presence of indomethacin on the anchorage-independent growth of AGS cells. We first examined the colony-forming ability of each of the claudin-4-overexpressing clones in soft agar. All clones showed less activity for colony formation in soft agar than the mock transfectant control (Fig. 4D), which is consistent with previous results obtained using pancreatic cancer cells (19). We compared the extent of inhibition of colony formation in soft agar with the degree of claudin-4 overproduction in these clones and found a close correlation between the two (Fig. 4A and D).
We also examined the effect of indomethacin on colony formation of AGS cells in soft agar. Because a long incubation period (10 days) was required for this assay, relatively low concentrations of indomethacin were used. As shown in Fig. 4E, indomethacin (100 µmol/L) significantly decreased the colony-forming ability of AGS cells in soft agar. Real-time RT-PCR experiments confirmed that claudin-4 mRNA expression in AGS cells was induced at the concentration of indomethacin used (Fig. 4F). These results suggest that the induction of claudin-4 is involved in the indomethacin-dependent inhibition of AGS cell colony formation in soft agar.
The migration activity of tumor cells is also very important for tumor progression. We examined the relationship between expression of claudin-4 and migration activity in AGS cells. Wound healing assays were carried out in which the cell-free area was measured at the time a wound was made and then 24 hours later. Because neither claudin-4 overexpression nor addition of NSAIDs affected the growth of AGS cells (Fig. 4B; data not shown), a smaller cell-free area is indicative of a higher activity for cell migration. As shown in Fig. 5A, claudin-4-overexpresing cells (clone 7) showed less cell migration activity than the mock transfectant control. Furthermore, transfection of siRNA for claudin-4 stimulated the migration activity of AGS cells even in the absence of indomethacin (Fig. 5B). We confirmed that the transfection almost completely inhibited the expression of claudin-4 in AGS cells (Fig. 5C). These results suggest that the migration activity of AGS cells decreases as claudin-4 expression increases.
|
| Discussion |
|---|
|
|
|---|
It is known that various factors disrupt or stimulate the function of tight junctions. For example, tumor necrosis factor-
, transforming growth factor-
, and interleukin-1 disrupt tight junctions, whereas transforming growth factor-ß, interleukin-10, and PGE2 are known to stimulate the function of tight junctions (41). However, the effect of these factors on the expression of components of tight junctions (such as claudin-4) has not been examined to the same extent. It seems that the alteration of tight junction function is not always correlated with an alteration in the expression of tight junction components. For example, we have found that PGE2, which is known to stimulate the function of tight junctions, does not induce claudin-4. Because the expression of claudin-4 affects various aspects of cancer progression (see below), we consider that the effect of cancer-promoting agents or anticancer drugs on claudin-4 expression should be examined more extensively.
As for a mechanism of claudin-4 induction by NSAIDs, we postulate that it is mediated by an increase in [Ca2+]i based on the following observations: (a) NSAIDs increased [Ca2+]i and induced claudin-4 simultaneously, (b) thapsigargin and ionomycin increased [Ca2+]i and induced claudin-4, and (c) the intracellular Ca2+ chelator [1,2-bis(2-aminophenoxy)ethane-N,N,N', N'-tetraacetic acid] attenuated the indomethacin-dependent induction of claudin-4. As for the mechanism for the increase in [Ca2+]i by NSAIDs, both inhibition of sarcoplasmic/endoplasmic reticulum Ca2+ ATPase (endoplasmic reticulumlocated Ca2+ pump that is responsible for accumulation of Ca2+ in the endoplasmic reticulum) and stimulation of the influx of extracellular Ca2+ have been proposed (40). We found recently that all of the NSAIDs tested permeabilize the membranes of both erythrocytes and liposomes (42). This activity of NSAIDs was found to be closely related to their ability to increase [Ca2+]i, suggesting that NSAIDs permeabilize membranes and stimulate the influx of extracellular Ca2+ (42).
NSAIDs seem to achieve their chemopreventive effect via several mechanisms, such as stimulation of apoptosis, cell growth suppression, inhibition of angiogenesis, and inhibition of metastasis (4, 5) . In this study, we examined the contribution of claudin-4 induction to the antitumor activity of NSAIDs in vitro. Experiments using claudin-4-overproducing AGS cells and siRNA for claudin-4 suggested that NSAID-induced claudin-4 is involved in the NSAID-dependent suppression of anchorage-independent tumor growth and tumor cell migration but not in stimulation of apoptosis and cell growth suppression. As for cell migration, this is the first evidence showing not only that NSAIDs inhibit of cancer cell migration but also that claudin-4 is involved in cell migration. It was reported recently that overexpression of claudin-4 suppressed the invasive potential of pancreatic cancer cells (19); therefore, if NSAIDs also induce claudin-4 in vivo, then suppression of the invasive potential of tumor cells by NSAID-induced claudin-4 may be one of the mechanisms involved in the inhibition of metastasis by NSAIDs. It is also possible that the induction of claudin-4 by NSAIDs contributes to their antitumor activity through other mechanisms. Tight junctions act as a barrier for diffusion of molecules that include nutrients and growth factors. It is well known that the constitutive accessibility of nutrients and growth factors is very important for tumor progression. Therefore, if NSAIDs also induce claudin-4 in vivo, then the supply of nutrients and growth factors to a tumor may be retarded or inhibited, thereby suppressing tumor progression.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 8/ 3/04. Revised 11/22/04. Accepted 12/20/04.
| References |
|---|
|
|
|---|
B regulates cyclooxygenase-2 expression and cell proliferation in human gastric cancer cells. Lab Invest 2001;81:34960.[CrossRef][Medline]
and
are activated by indomethacin and other non-steroidal anti-inflammatory drugs. J Biol Chem 1997;272:340610.
ligands in macrophages by 12/15-lipoxygenase. Nature 1999;400:37882.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
C. Wray, Y. Mao, J. Pan, A. Chandrasena, F. Piasta, and J. A. Frank Claudin-4 augments alveolar epithelial barrier function and is induced in acute lung injury Am J Physiol Lung Cell Mol Physiol, August 1, 2009; 297(2): L219 - L227. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Namba, K.-I. Tanaka, Y. Ito, T. Ishihara, T. Hoshino, T. Gotoh, M. Endo, K. Sato, and T. Mizushima Positive Role of CCAAT/Enhancer-Binding Protein Homologous Protein, a Transcription Factor Involved in the Endoplasmic Reticulum Stress Response in the Development of Colitis Am. J. Pathol., May 1, 2009; 174(5): 1786 - 1798. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Namba, T. Homan, T. Nishimura, S. Mima, T. Hoshino, and T. Mizushima Up-regulation of S100P Expression by Non-steroidal Anti-inflammatory Drugs and Its Role in Anti-tumorigenic Effects J. Biol. Chem., February 13, 2009; 284(7): 4158 - 4167. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ishihara, K.-I. Tanaka, Y. Tasaka, T. Namba, J. Suzuki, T. Ishihara, S. Okamoto, T. Hibi, M. Takenaga, R. Igarashi, et al. Therapeutic Effect of Lecithinized Superoxide Dismutase against Colitis J. Pharmacol. Exp. Ther., January 1, 2009; 328(1): 152 - 164. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mima, M. Takehara, H. Takada, T. Nishimura, T. Hoshino, and T. Mizushima NSAIDs suppress the expression of claudin-2 to promote invasion activity of cancer cells Carcinogenesis, October 1, 2008; 29(10): 1994 - 2000. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Namba, T. Hoshino, K.-i. Tanaka, S. Tsutsumi, T. Ishihara, S. Mima, K. Suzuki, S. Ogawa, and T. Mizushima Up-Regulation of 150-kDa Oxygen-Regulated Protein by Celecoxib in Human Gastric Carcinoma Cells Mol. Pharmacol., March 1, 2007; 71(3): 860 - 870. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Aburaya, K.-I. Tanaka, T. Hoshino, S. Tsutsumi, K. Suzuki, M. Makise, R. Akagi, and T. Mizushima Heme Oxygenase-1 Protects Gastric Mucosal Cells against Non-steroidal Anti-inflammatory Drugs J. Biol. Chem., November 3, 2006; 281(44): 33422 - 33432. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Osanai, M. Murata, N. Nishikiori, H. Chiba, T. Kojima, and N. Sawada Epigenetic Silencing of Occludin Promotes Tumorigenic and Metastatic Properties of Cancer Cells via Modulations of Unique Sets of Apoptosis-Associated Genes. Cancer Res., September 15, 2006; 66(18): 9125 - 9133. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Honda, M. J. Pazin, H. Ji, R. P. Wernyj, and P. J. Morin Crucial Roles of Sp1 and Epigenetic Modifications in the Regulation of the CLDN4 Promoter in Ovarian Cancer Cells J. Biol. Chem., July 28, 2006; 281(30): 21433 - 21444. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. F. Balkovetz Claudins at the gate: determinants of renal epithelial tight junction paracellular permeability Am J Physiol Renal Physiol, March 1, 2006; 290(3): F572 - F579. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |