| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Experimental Therapeutics, Molecular Targets and Chemical Biology |
Departments of 1 Surgery, Winship Cancer Institute and 2 Pathology, Emory University School of Medicine, Atlanta, Georgia and 3 The First People's Hospital of Guang Zhou, Guang Zhou, P.R. China
Requests for reprints: Lily Yang, Department of Surgery and Winship Cancer Institute, Emory University School of Medicine, 1365 C Clifton Road Northeast, Atlanta, GA 30322. Phone: 404-778-4269; Fax: 404-778-5530; E-mail: Lyang02{at}emory.edu.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Key Words: Breast cancer detection • cyclin D1 • fluorescence imaging • molecular beacon imaging • survivin • real-time gene expression
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In this study, we developed a molecular beacon fluorescence imaging approach to detect the levels of expression of multiple genes simultaneously in single cells. Molecular beacons are stem-loop type oligonucleotide probes dual-labeled with a fluorophore and a quencher. In the absence of the target, the stem brings the fluorophore and quencher molecules together, which prevents the production of a fluorescent signal. When the molecular beacon hybrids to its specific target sequence, the stem is forced to break apart, which enables it to generate a fluorescent signal (4–6). Because binding conditions between the loop and complementary target sequences are very stringent, only a target with perfectly matching sequences is able to hybridize to the molecular beacon (5). During the last several years, molecular beacon technology has been used in various applications to detect oligonucleotides in solution, including DNA mutation detection and real-time quantification of PCR products and protein-DNA interaction (6–8).
The ability of molecular beacon probes to detect specific target molecules without separation of unbound probes also provides an opportunity to detect intracellular mRNA molecules in intact cells. The feasibility of detecting intracellular mRNA has been examined in several laboratories (9–13). It has been shown that molecular beacons were able to visualize mRNA molecules in several human and animal cell lines after introducing into cells through microinjection or liposome delivery (9–11, 14) . It has also been shown that the detection limit of preformed molecular beacon/ß-actin mRNA duplexes microinjected into the cells is 10 mRNA molecules, suggesting that molecular beacon technology is a very sensitive method for detecting mRNAs in cells (9).
Although previous studies suggested that detection of intracellular mRNA using molecular beacons is a feasible approach, the question remains of how to develop this novel technology into a simple procedure that can be used broadly in basic research and clinical laboratories. To address this issue, we developed procedures that enable us to detect gene expression in fixed as well as viable cells. We designed molecular beacons targeting survivin and cyclin D1 mRNAs, which are highly expressed in breast cancer cells (15, 16). Survivin is a member of the inhibitor of apoptosis protein family that plays a crucial role in the apoptosis resistance of tumor cells (17). Increasing evidence indicates that survivin is also a promising tumor marker because it is normally expressed during fetal development but is not expressed in most normal adult tissues (18). However, high levels of survivin are detected in many human cancer types including 70% of breast cancers (16, 19) . Also, cyclin D1, an important regulator of cell cycle, is overexpressed in 50% to 80% of breast cancer tissues, whereas it is low or absent in normal breast tissues (15). In this study, we examined the feasibility of detecting expression of survivin and cyclin D1 genes in human breast cancer cells using the molecular beacon–imaging technology.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Frozen human breast cancer and normal tissues were obtained according to an approved institutional review board protocol at Emory University from breast cancer patients during surgery to remove the tumors. Tissues were frozen immediately in liquid nitrogen and kept at –80°C.
Design and Synthesis of Molecular Beacons
The sequences of molecular beacons targeting survivin or cyclin D1 mRNAs were unique for each gene. These include (a) survivin MB-FITC: 5'-FITC-TGGTCCTTGAGAAAGGGCGACCA-Dabcyl-3', (b) survivin MB-Cy3: 5'-Cy3-CTGAGAAAGGGCTGCCAGTCTCAG-Dabcyl-3', and (c) Cyclin D1 MB-Texas Red: 5'-Texas-Red-TGGAGTTGTCGGTGTAGACTCCA-Dabcyl-3'. Control molecular beacons for targeting human glyceraldehyde-3-phosphate dehydrogenase (GAPDH), GAPDH MB-Cy 3 or GAPDH MB-6-FAM, were also synthesized as the following: 5'-Cy3 or 6-FAM-CGAGTCCTTCCACGATACCCACTCG-Dabcyl-3'. The underlined bases were those added to form a stem with an optimal Tm condition. All molecular beacons were synthesized by MWG-Biotech Inc. (High Point, NC).
The specificity of the molecular beacons in solution was determined using synthesized oligonucleotide targets (Sigma Genosys, Woodlands, TX). These include (a) survivin target: 5'-CCTGCCTGGCAGCCCTTTCTCAAGGACCACCGCATCTCTACATTCAAGAAC-3', (b) cyclin D1 target: 5'-AGAAGCTGTGCATCTACACCGACAACTCCATCCGGC-3', (c) HER-2/neu gene target: 5'-AGTGTGCACCGGCACAGACATGAAGCTGCGGCTCCCT-3', and (d) K-ras gene: 5'-GTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAATT CAG-3'. Survivin or cyclin D1 molecular beacon (200 nmol/L) was mixed with 1 µmol/L of various DNA targets in 100 µL of Opti-MEM (Invitrogen, Carlsbad, CA). After incubating at 37°C for 60 minutes, fluorescence intensity was measured by a fluorescence microplate reader (Bioteck FL600 fluorometer, Winooski, VT).
Real-time Reverse Transcription–PCR
Total RNAs were isolated and amplified with an Omniscript reverse transcription kit (Qiagen Inc, Valencia, CA). Real-time PCR was done on an ABI PRISM 7000 sequence detection system (Applied Biosystems, Foster City, CA). The primer pairs for detecting the expression of survivin gene were survivin forward 5'-TCCACTGCCCCACTGAGAAC-3' and survivin reverse 5'-TGGCTCCCAGCCTTCCA-3'. PCR primers for cyclin D1 were forward 5'-AGAAGCTGTGCATCTACACCGACAACTCCATCCGGC-3' and reverse 5'-GGTTCCACTTGAGCTTGTTCACAA-3'. The primer pairs for ß-actin gene were ß-actin forward, 5'-AAAGACCTGTACGCCAACACAGTGCTGTCTGG-3', and ß-actin reverse, 5'-CGTCATACTCCTGCTTGCTGATCCACATCTGC-3', and for GAPDH were forward 5'-TGAAGGTCGGAGTCAACGGATTTGGT-3' and reverse 5'-CATGTGGGCCATGAGGTCCACCAC-3'.
Western Blot Analyses
Cell lysates were collected after different treatments and total cellular protein was resolved on polyacrylamide SDS gels. Western blot analysis for the level of survivin protein was done according to a standard protocol as described (19). The membranes were incubated for 1 hour with goat anti-human survivin (Santa Cruz Biotechnology, Santa Cruz, CA) and mouse monoclonal antibodies to ß-actin (Sigma Chemical Co, St. Louis, MO). The levels of specific proteins in each lysate were detected by enhanced chemiluminescence using ECL plus (Amersham International, Buckingham, United Kingdom) followed by autoradiography.
Detection of Gene Expression in Fixed Cells
Cells were plated on chamber slides for 24 hours and then fixed with ice-cold acetone for 5 to 10 minutes. The slides were stained with a mixture of 200 nmol/L of survivin MB-FITC and cyclin D1 MB-Texas Red in Opti-MEM at 37°C for 60 minutes and then examined using a confocal microscope (LSM 510 Meta, Carl Zeiss Microimaging, Inc., Thornwood, NY).
For detecting survivin gene expression on tissue sections, 5-µm frozen sections of breast normal and cancer tissues fixed with ice-cold acetone were incubated with 200 nmol/L survivin MB-Cy3 for 60 minutes and then counterstained with 10 µg/mL Hoechst 33342 (Molecular Probes, Inc., Eugene, OR). For immunofluorescence labeling, acetone-fixed frozen sections were incubated with a goat anti-human survivin antibody and then with FITC-conjugated anti-goat antibody. For double-labeling survivin MB and human endothelial cell marker CD31, tissue sections were incubated with survivin MB-Cy3 and then with an anti-CD31 antibody followed by a FITC-conjugated secondary anti-mouse antibody. One tissue section was double-labeled with goat anti-human survivin and mouse anti-human CD31 antibodies followed by FITC-labeled donkey anti-goat antibody or biotinylated horse anti-mouse antibody and Texas Red avidin. The tissue slides were observed under a Nikon fluorescence microscope (Nikon Eclipse E800, Nikon Instruments Inc. Melville, NY). Fluorescence images were taken using an Optronics Magnafire digital imaging system (Meyer Instruments, Houston, TX).
Quantification of the Level of Gene Expression in Viable Cells using Molecular Beacons
FACScan Analysis. Cells were plated in six-well plates and cultured in medium containing 2% fetal bovine serum overnight. The cells were transfected with 400 nmol/L of either survivin MB-FITC or GAPDH MB-6FAM using LipofectAMINE 2000 in Opti-MEM (Invitrogen). Three hours after transfection, 100 ng of human recombinant epidermal growth factor (EGF; Invitrogen) were added to the EGF-treated group for 1 hour and the cells were collected for FACScan analysis (Becton Dickinson, Mansfield, MA).
Cells transduced with an adenoviral vector expressing a wild-type p53 gene (Adp53, Qbiogene, Carlsbad, CA) or control adenoviral vector (Adcmv) at a multiplicity of infection of 50 plaque-forming units for 24 hours were collected and divided into two groups. One group of the cells was transfected with 400 nmol/L of survivin MB-FITC and the other was transfected with 400 nmol/L of GAPDH MB-6-FAM using LipofectAMINE 2000 in Opti-MEM (Invitrogen). Fluorescence intensity of the cells from all groups was examined using FACScan analysis.
Fluorescence Microplate Reader. Cells were plated in 96-well culture plates at 80% confluence for 24 hours. EGF-treated and nontreated groups were cultured in the medium with 2% fetal bovine serum. The cells were then transfected with a mixture of 400 nmol/L of survivin MB-FITC and internal control GAPDH MB-Cy 3. At 3 hours after transfection, 100 ng of EGF was then added to the wells in the EGF-treated group and 10 or 50 nmol/L of docetaxel (Aventis Pharma, Bridgewater, NJ) were added to the docetaxel-treated group. The culture plates were immediately placed in the microplate reader and fluorescence units in each well were measured at different time points.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
|
|
In addition, we found that survivin gene–expressing cells in breast cancer tissues included cancer cells as well as cells in the vascular structures (Fig. 3C). When the same section was double-labeled with an antibody specific for a CD31 human endothelial cell marker (20), those survivin-expressing cells in the vascular structures were shown to be endothelial cells (Fig. 3C). Establishment of this molecular beacon detection method for measuring gene expression in situ should provide pathologists with a new tool to identify cancer cells in clinical samples.
Monitoring the Level of Real-time Gene Expression Using Survivin Molecular Beacon. We used three model systems to determine whether survivin molecular beacon was able to detect changes of survivin gene expression in viable cells, including EGF or docetaxel induced up-regulation and tumor suppressor gene p53–induced down-regulation of survivin gene expression (21, 22). Breast cancer cells were transfected with a mixture of survivin and GAPDH molecular beacons and observed under a fluorescence microscope after treatment with EGF for 1 hour or docetaxel for 24 hours. Our results showed that treatment of the cells with EGF or docetaxel increased the level of survivin gene expression. Under a fluorescence microscope, the green fluorescence intensity (survivin MB-FITC) was stronger in the cells treated with either EGF or docetaxel compared with untreated control whereas the fluorescent signal for GAPDH molecular beacon (Cy3, red) was relatively consistent (Fig. 4A). We further used FACScan analysis to determine the mean fluorescence intensity in each cell population. Consistent with our observation with the fluorescence microscopy, we detected higher levels of fluorescent signal in EGF-treated cells compared with the untreated group in breast cancer cells (Fig. 4B). The relative level of survivin mRNA could be quantified from the FACScan data using the fluorescence unit of GAPDH gene as an internal control. We found that EGF treatment induced 
1.5-fold increases in the level of survivin gene expression in breast cancer cells.
|
2-fold in Adp53 vector–transduced cells compared with the untreated or empty Adcmv vector control group (Fig. 4C). The ability of molecular beacons to detect a decreased level of gene expression suggests that the fluorescent signals detected intracellularly after molecular beacon transfection are not from nonspecific degradation of the molecular beacons because the same amount of survivin and GAPDH molecular beacons were delivered into Adp53 and control vector–transduced cells. The results from real-time reverse transcription-PCR (RT-PCR) further confirmed that EGF increased the transcription of survivin gene and overexpression of the p53 gene decreased the level of survivin mRNA (Fig. 4D). Although detection of the level of gene expression by FACScan could accurately measure the fluorescence intensity in individual cells as well as in cell populations, the procedure for FACScan is time-consuming and does not easily detect changes of gene expression in real time in the same cell population. To develop a high-throughput method for monitoring the changes of gene expression in real time in viable cells, we examined the feasibility of detecting levels of gene expression in cells cultured in 96-well plates using the molecular beacon-transfection approach. Breast cancer cells were plated in 96-well plates and transfected with a mixture of survivin and GAPDH molecular beacons for 3 hours. After adding EGF or docetaxel, the fluorescence units were measured at different time points using a fluorescence microplate reader. We found that EGF-induced up-regulation of survivin gene expression occurred as early as 15 minutes after the treatment and lasted for >3 hours (Fig. 5A). There were 2.3 (MCF-7)- to 2.8 (MDA-MB-231)-fold increases in the relative levels of survivin mRNA after EGF treatment. We also examined the level of survivin protein using Western blot analysis and further confirmed that the level of survivin protein increased after EGF treatment (Fig. 5A).
|
1.5-fold higher in docetaxel-treated cells than control cells and the difference detected 48 hours after docetaxel treatment is statistically significant (Student's t test, P < 0.05 for both MCF-7 and MDA-MB-231 cell lines). We also found a similar increase in the level of survivin mRNA detected by real-time RT-PCR compared with survivin molecular beacon detection, and the level of increase in survivin protein after docetaxel treatment (Fig. 5B, inset is real-time RT-PCR result). One of the important issues to be addressed in developing an oligo-based approach for detecting gene expression in viable cells is whether the binding of the molecular beacon probes to their target RNA leads to degradation of the mRNA by RNase H, which may affect the level of target mRNA (23). To answer this question, we transfected breast cancer cells with either survivin molecular beacon or control GAPDH molecular beacon for 24 hours and then examined the level of survivin protein by Western blot analysis. We found that compared with cells transfected with a nonspecific GAPDH molecular beacon, the presence of the survivin molecular beacon in the cells did not reduce the level of survivin protein (Fig. 5C).
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
At present, molecular beacon technology has been mainly used in various applications in vitro, which were done in solutions with defined molecular beacon-target conditions. Although previous studies showed the feasibility of detecting mRNAs and monitoring the transportation of RNAs in cells, the procedure for delivery of the molecular beacons through microinjection or by liposome delivery has made it difficult to apply this technology into broad research areas or into a routine clinical procedure (9–12). A recent study showed that it is feasible to transfect a molecular beacon into living cells to detect doxorubicin-induced activation of p21 gene expression (13).
We developed this molecular beacon-based procedure for the detection of gene expression in viable cells. We showed that transfecting survivin molecular beacon into cells produces a strong fluorescent signal in survivin-expressing tumor cells and the level of survivin gene expression can be monitored real time in cells either by FACScan or by using a fluorescence microplate reader. Using these methods, we detected an increase in the level of survivin gene expression following EGF and docetaxel treatment. Although we used GAPDH molecular beacon as an internal control for our experiments, simultaneous detection of survivin and GAPDH gene expression real time in viable cells indicates that it is feasible to monitor the levels of expression of several genes in the same cell population using molecular beacons labeled with different fluorophores.
Quantitative measurement of mRNA levels by molecular beacons is very important for the future use of this technology for cancer cell detection because many tumor marker genes are not unique to cancer cells and the difference between normal and cancer cells can be only the level of gene expression. Although we used two molecular beacons to detect the expression of tumor marker genes, a proof of principle from this study will lead to the use of more molecular beacons with multiple dye molecules to analyze the expression of several tumor genes. In addition, because only a small amount of abnormal cells are present in a large amount of normal cell background in clinical samples, there is a clear advantage of direct fluorescence imaging of individual cells expressing tumor marker genes for early detection of cancer cells compared with conventional RT-PCR to amplify the expression of tumor marker genes from isolated total RNA, which may be difficult to detect the differences in the level of gene expression in a few cancer cells over the normal background.
Current methods for the identification and classification of cancer cells from clinical samples rely on examining the morphology of the cells or immunostaining with antibodies for tumor-related protein markers. Although the in situ hybridization using labeled linear probes has been used to detect gene expression in tissue sections, it is very time-consuming and usually accompanied by a high background because unbound probes also produce fluorescent signals. In our study, we found that molecular beacons could be used to detect the expression of genes on frozen tissue sections. The procedure is very simple and results can be examined within 30 to 60 minutes without the extensive staining and washing steps. Demonstration of the feasibility of combining the molecular beacon and immunofluorescence approaches to detect the expression of tumor marker genes and proteins in situ in the same cell population makes its potential application in pathologic diagnosis of human cancers more appealing. It is possible that the level of gene expression detected by molecular beacon-fluorescence imaging in clinical samples with intact tumor cells, such as fine-needle aspirates and exfoliated cells in body fluids is more quantitative than that detected in cancer cells on frozen tissue sections because most cells in tissue sections have been cut through and lost part of their cellular components.
One concern in the delivery of unmodified molecular beacons to viable cells is that the molecular beacons may be digested by nucleases in the cells or nonspecific interaction between molecular beacons, and cellular proteins may open up the stem of the molecular beacons, resulting in nonspecific fluorescence. However, our results showed that the fluorescence intensity detected by either FACScan or microplate reader correlated well with the level of survivin mRNA in the tumor cells. Because a similar level of the molecular beacons was delivered into the tumor cells, it seemed that increases in the fluorescence intensity in EGF- and docetaxel-treated cells or a decrease in p53-expressing cells were not due to nonspecific degradation of the molecular beacons.
In this study, we showed that molecular beacon imaging of tumor cells is a simple and specific approach for the detection of breast cancer cells. This study is the first to apply state-of-the art molecular beacon–based methodology for cancer cell detection and for real-time monitoring the level of expression of tumor marker genes in viable cells. Based on this study, high-throughput assays for measuring the expression of multiple genes critical for drug response can be developed for screening cancer drugs that target specific molecules or pathways in cancer cells. To increase the specificity of molecular beacon detection, the molecular beacons can be further modified to make them resistant to nuclease or RNase H, such as by using 2'-O-methyl molecular beacon probes (12).
|
Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Dr. Toncred Styblo and Beth Sumpter (Department of Surgery, Emory University School of Medicine, Atlanta, GA) for providing us with breast cancer and normal tissues and Drs. Mark Behlke for his suggestion on survivin MB-Cy3 sequence and Gang Bao for helpful discussions.
Received 9/ 3/04. Revised 12/ 8/04. Accepted 12/29/04.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  A. K. Chen, M. A. Behlke, and A. Tsourkas Sub-cellular trafficking and functionality of 2'-O-methyl and 2'-O-methyl-phosphorothioate molecular beacons Nucleic Acids Res., October 9, 2009; (2009) gkp837v1. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. K. Chen, M. A. Behlke, and A. Tsourkas Efficient cytosolic delivery of molecular beacon conjugates and flow cytometric analysis of target RNA Nucleic Acids Res., July 1, 2008; 36(12): e69 - e69. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. K. Chen, M. A. Behlke, and A. Tsourkas Avoiding false-positive signals with nuclease-vulnerable molecular beacons in single living cells Nucleic Acids Res., August 15, 2007; (2007) gkm593v1. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X.-H. Peng, P. Karna, R. M. O'Regan, X. Liu, R. Naithani, R. M. Moriarty, W. C. Wood, H.-Y. Lee, and L. Yang Down-Regulation of Inhibitor of Apoptosis Proteins by Deguelin Selectively Induces Apoptosis in Breast Cancer Cells Mol. Pharmacol., January 1, 2007; 71(1): 101 - 111. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X.-H. Peng, P. Karna, Z. Cao, B.-H. Jiang, M. Zhou, and L. Yang Cross-talk between Epidermal Growth Factor Receptor and Hypoxia-inducible Factor-1{alpha} Signal Pathways Increases Resistance to Apoptosis by Up-regulating Survivin Gene Expression J. Biol. Chem., September 8, 2006; 281(36): 25903 - 25914. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. A. Marti, S. Jockusch, Z. Li, J. Ju, and N. J. Turro Molecular beacons with intrinsically fluorescent nucleotides. Nucleic Acids Res., January 1, 2006; 34(6): e50 - e50. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
