Cancer Research The Future of Cancer Research: Science and Patient Impact AACR Conference on Molecular Diagnostics - 2008
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schwegler, C.
Right arrow Articles by Neumaier, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schwegler, C.
Right arrow Articles by Neumaier, M.
[Cancer Research 65, 1925-1933, March 1, 2005]
© 2005 American Association for Cancer Research

Experimental Therapeutics, Molecular Targets and Chemical Biology

Monoclonal Anti-idiotype Antibody 6G6.C4 Fused to GM-CSF Is Capable of Breaking Tolerance to Carcinoembryonic Antigen (CEA) in CEA–Transgenic Mice

Christian Schwegler1, Alexandra Dorn-Beineke2, Stefanie Nittka2, Carol Stocking3 and Michael Neumaier2

1 Department of Internal Medicine and Clinical Immunology Bad Bramstedt, University of Lübeck, Lübeck, Germany; 2 Institute for Clinical Chemistry, Faculty for Clinical Medicine Mannheim, University of Heidelberg, Heidelberg, Germany; and 3 Heinrich-Pette Institute for Virology, University of Hamburg, Hamburg, Germany

Requests for reprints: Michael Neumaier, Institute for Clinical Chemistry, University Hospital Mannheim, University of Heidelberg, Theodor-Kutzer-Ufer 1-3, 68167 Mannheim, Germany. Phone: 49-621-383-2222; Fax: 49-621-383-3819; E-mail: michael.neumaier{at}ikc.ma.uni-heidelberg.de.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Internal image anti-idiotypic antibodies are capable of mimicking tumor-associated antigens and thus may serve as surrogate for vaccination strategies in cancer patients. The monoclonal antibody (mAb) 6G6.C4 mimics an epitope specific for the human carcinoembryonic antigen (CEA) and generates a CEA-specific response (Ab3) in various experimental animals. In humans, however, 6G6.C4 only yields a very limited humoral anti-CEA reaction presumably due to tolerance against the CEA autoantigen. In this study, we investigated the CEA-specific Ab3 response in mice transgenic for the human CEA and tested whether the antigen tolerance could be overcome by fusing a recombinant single-chain variable fragment of 6G6.C4 (scFv6G6.C4) to the murine granulocyte macrophage colony-stimulating factor (GM-CSF).

Like mAb 6G6.C4, the fusion protein (scFv6G6.C4/GM-CSF) retained binding to the CEA-specific idiotype mAb T84.66. Also, scFv6G6.C4/GM-CSF was biologically active as measured by proliferation of the GM-CSF-dependent murine FDC-P1 cells in vitro. After immunization with the scFv6G6.C4/GM-CSF fusion protein, CEA-transgenic animals showed significantly enhanced Ab3 antibody responses to scFv6G6.C4 (P = 0.005) and to CEA (P = 0.012) compared with the scFV6G6.C4 alone. Sera from mice immunized with the fusion protein specifically recognized CEA in Western blot analyses with no cross-reaction to CEA-related antigens. Finally, the Ab3 antisera detected single CEA-expressing tumor cells in suspension as shown by flow cytometry. Taken together, these data show in a model antigenically related to the human system that vaccination with scFv6G6.C4/GM-CSF improves vaccination against an endogenous tumor-associated antigen resulting in a highly specific humoral Ab3 response in vivo that is capable of bind single circulating CEA-positive tumor cells.

Key Words: CEA • anti-idiotype • anti-CEA • vaccination • immunotolerance • transgenic • immunotherapy


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
The human carcinoembryonic antigen (CEA), originally described as a tumor-specific antigen, is a member of the CEA-related cell adhesion molecule (CEACAM) family expressed on the apical surface of colon epithelial cells. CEA expression is maintained in >95% of the colorectal carcinomas and their metastases, making this glycoprotein the most widely used human tumor marker (1). Circulating CEA can be detected in the serum of patients with CEA-positive tumors and has been extensively used as a serum marker in the monitoring of tumor stage in these cancer patients. A number of studies have been reported recently in which monoclonal anti-CEA antibodies have been used for antigen-specific passive immunotherapy in cancer patients (2, 3).

In contrast, an active specific humoral immunotherapy would aim to sensitize the patient's immune system against his tumor cell using tumor-associated antigens (TAA) as vaccines allowing for a self-sustained immunity against the cancer cells.

According to Niels Jerne's idiotypic network hypothesis, antigenic epitope structures can be mirrored through an anti-idiotypic cascade of antibodies. Of these, the so-called internal image anti-idiotypic (Ab2ß) antibodies can mimic epitopes of self-antigens and serve for tumor vaccination strategies (4–8).

Clinical studies have shown the induction of TAA-specific antibody (Ab3) responses by Ab2ß anti-idiotypes in tumor patients bearing a variety of tumors (9–14).

It has been shown that the Ab2ß against the monoclonal antibody (mAb) chT84.66, a chimeric human/mouse mAb recognizing a CEA-specific epitope, can serve as a surrogate antigen for CEA in experimental animals and is capable to generate an anti-CEA response with the same specificity as the T84.66 idiotype antibody (15, 16).

To improve the efficacy of the antitumor response, antibodies have been fused to cytokines or growth factors including interleukin (IL)-2, IL-6, granulocyte macrophage colony-stimulating factor (GM-CSF; refs. 17–21).

GM-CSF is an immunoregulatory cytokine that induces the growth of granulocyte and monocyte progenitors and possesses important functions in the differentiation and maturation of hematopoietic cells, up-regulates class II MHC molecules (22), and enhances their phagocytic activity and antigen-presenting capabilities (23). GM-CSF stimulates the proliferation and survival of Langerhans cells and dendritic cells in vitro (24) and has been postulated to be a critical mediator in the primary immune response because of its action on these and other antigen-presenting cells (25).

In vitro and in vivo studies have shown that GM-CSF fused to antibody molecules retains its biological activity and continues to mediate both antibody-dependent cellular cytotoxicity and complement-dependent cytotoxicity (20, 26).

In earlier studies, we have raised the monoclonal anti-idiotype 6G6.C4 against the anti-CEA mAb chT84.66 (15) known to possess a high affinity and specificity for CEA. It has been shown that 6G6.C4 is capable to elicit a CEA-specific response in experimental animals and thus may have the potential to function as a vaccine in active immunotherapy against CEA-positive carcinomas (15, 16) .

In this study, we report the design of the single-chain (scFv) fusion protein scFv6G6.C4/GM-CSF by genetic engineering and characterize its capability to elicit a specific humoral anti-CEA response (Ab3 response) in CEA-tolerant transgenic mice. We also show that Ab3 antibodies generated by vaccination with scFv6G6.C4/GM-CSF will detect single CEA-expressing tumor cells by flow cytometry.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Antigens and Antibodies. Purified CEA and murine mAbs T84.1 and mT84.66 were kindly provided by J.E. Shively (Division of Immunology, Beckman Research Institute of the City of Hope, Duarte, CA). The chimeric human/mouse mAb chT84.66 has been described previously (27). The murine mAbs BY114 and 29H2 were purchased from InnoGenex (San Ramon, CA) and Novocastra Laboratories (Newcastle upon Tyne, United Kingdom) respectively.

Cell Lines and Protein Extracts. Jurkat wild-type cells, the murine colon carcinoma cell line MC38 and its CEA-transfected subline C15-A.3 and its CEACAM1-transfected subline MC38-BGP, and CEACAM6-transfected HeLa-NCA cells were kindly provided by J.E. Shively. The human colon carcinoma cell line HT29 was purchased from American Type Culture Collection. Human granulocytes were obtained from healthy donors after informed consent. Human normal colon tissue was obtained from surgical specimens. All cell lines were grown in DMEM or RPMI (Life Technologies, Karlsruhe, Germany) containing 10% FCS, 4 mmol/L glutamine (PRA International, Lenexa, KS), and penicillin/streptomycin (100 units/mL and 10 µg/mL, Biochrom, Berlin, Germany).

Cell extracts were prepared for Western blot analyses in TNE buffer [50 mmol/L Tris (Life Technologies), 150 mmol/L NaCl, 2 mmol/L EDTA (Merck, Darmstadt, Germany), 1% Triton X-100 (pH 7.6, Sigma-Aldrich, Taufkirchen, Germany)]. As proteinase inhibitors, 1 mol/L Na3OV4, 1 mg/mL aprotinin/leupeptin, and 0.5 mol/L NaF were included.

Granulocyte membrane extracts were prepared as follows: Granulocytes were isolated from buffy coats following lysis of erythrocytes in a buffer containing 155 mmol/L NH4Cl, 10 mmol/L KHCO3, and 0.1 mmol/L EDTA (pH 8.0). The cell pellet was treated with 1% NP40 diluted in PBS containing 5 mmol/L benzamidine, 10 mmol/L EDTA, 100 mmol/L 6-aminohexanoic acid, and 2 mmol/L phenylmethanesulfonylfluoride for 12 hours at 4°C. Following centrifugation (10,000 x g; 30 min), the NP40-soluble supernatant was concentrated 10-fold using Centricon 30 membranes (Amicon, Witten, Germany). Buffer was adjusted to a final concentration of 0.1% NP40 in PBS with proteinase inhibitor concentrations as mentioned above.

Human colon tissue was kept on wet ice at all times. After mechanical disruption to pieces of ~5 mm3, the tissue was homogenized using an Ultra-Turrax homogenizer (IKA Labortechnik, Staufen, Germany). Glycoproteins were extracted from the homogenates using 1.6 mol/L perchloric acid. After centrifugation (3,000 x g, 20 min), the supernatant was passed through gauze and the pellet was discarded. The supernatant was neutralized at pH 7 to 8 using 1 and 5 mol/L NaOH and was subsequently dialyzed extensively against tap water and finally against distilled water. The colon extract was then centrifuged (3,000 x g, 15 min) to remove precipitates before concentrating it using a Minitan ultrafiltration system (Millipore, Schwalbach, Germany).

Construction of scFv6G6.C4 and scFv6G6.C4/GM-CSF Fusion Protein. The 6G6.C4 scFv fragment was constructed from the cloned heavy and light chain genes of the monoclonal anti-idiotype 6G6.C4 by PCR (16). Briefly, the primers VH5.1_NdeI (29 nt) 5'-TACATATGCAGGTCCAACTACAGCAGCCT and VHLIN_BamHI (55 nt) 5'-ACCACTCTCACAGTCTCCTCATCAGGAGGAGGCTCAGGTGGTGGTGGATCCAAG were used to amplify the heavy chain variable (VH) region gene. The primers VLLIN_BglII (53 nt) 5'-AAAGATCTGGTGGAGGAGGATCTGGGGAGAGAGACATTGTGATGATCCAGTCT and VL3.2_XhoI (32 nt) 5'-AGCTCGAGGCCACGTTTGATTTCCCAGCTTGGT were used to amplify the light chain variable (VL) region gene. After purification by phenol/chloroform extraction and precipitation, the VH and VL amplicons were digested with BamHI and BglII, respectively, and subsequently ligated using T4-ligase (New England Biolabs GmbH, Frankfurt am Main, Germany) overnight at 16°C. The ligation products were purified from 1.5% agarose gels using the QiaEx method according to the manufacturer's recommendation (Qiagen, Hilden, Germany) and reamplified by Pfu Polymerase (Stratagene, La Jolla, CA) using VH5.1_NdeI and VL3.2_XhoI as primers. After phenol/chloroform extraction and precipitation, the scFv fragment was restricted with NdeI and XhoI and ligated into pET27b(+) plasmids (EMD Biosciences, Inc., Novagen Brand, Madison, WI) previously cut with NdeI and XhoI. Clones with correct scFv genes were verified by their resistance against BamHI and BglII and their sensitivity against BstYI. Finally, the integrity of the recombinant scFv was verified by DNA sequencing.

The GM-CSF cassette was amplified from pUC18-BBG39 (British Biotech, Oxford, United Kingdom) harboring the murine GM-CSF as a designer gene with E. coli codon usage for optimal expression. PCR amplification was done using GM-CSFL1_NdeI (29 nt) 5'-TACATATGGCTCCGACGCGAGCCCGATC and GM-CSFR1_SfiI (33 nt) 5'-GGGCCGACTGGGCCTTTTGGACTGGTTTTTTGC, and the product was cloned into pCRII (Invitrogen GmbH, Karlsruhe, Germany). Clones with the GM-CSF cassette in the orientation of the lacZ{alpha} transcription were verified and further processed by SfiI and XhoI digestion. The 6G6.C4 scFv cassette was PCR-amplified using VH5.2_SfiI (38nt) 5'-CCAAGGCCCAGTCGGCCCAGGTCCAACTACAGCAGCCT and VL3.2_XhoI (see above) using PfuI Polymerase (Stratagene) and subsequently restricted with SfiI and XhoI. After phenol/chloroform extraction and precipitation, the digested DNA fragment was ligated into the recombinant pCRII/mGM-CSF plasmid previously digested with SfiI and XhoI.

Bacterial Expression and Preparation of Protein Fractions. Protein expression was done using BL21DE3 cells previously transformed with the recombinant pET27(+) plasmids (EMD Biosciences, Inc., Novagen Brand). Bacteria were grown in Luria-Bertani medium with 100 µg/mL kanamycin (Life Technologies) to an absorbance of 0.8 ({lambda} = 600 nm) after which isopropyl-L-thio-B-D-galactopyranoside (MBI Fermentas GmbH, St. Leon-Rot, Germany) was added to a final concentration of 1 mmol/L. Culture was continued at 40°C for additional 4 hours.

Subsequently, the cells were centrifuged (12,000 x g, 4°C, 20 min), and the pellet was resuspended in 50 mmol/L Tris-HCl (pH 8.0), 2 mmol/L EDTA, 0.35 mmol/L Lysozyme (Sigma Aldrich, Steinheim, Germany), and 0.1% Triton X-100 for 15 minutes at 30°C. The cells were then cooled on ice, disrupted by ultrasound, and centrifuged (12,000 x g, 4°C, 20 min). Aliquots of both the soluble and the insoluble protein fraction were examined by SDS-PAGE and Western blot analysis. The yield of recombinant proteins per milligram wet weight of the crude bacterial extract was assessed semiquantitatively in SDS-PAGE gels by comparing the intensities of stained fusion protein bands to known amounts of the benchmark molecular weight marker proteins (Life Technologies).

Refolding and Purification of the Insoluble Protein Fractions. The insoluble inclusion bodies were extensively purified by five cycles of washing with PBS and subsequent centrifugation. The insoluble protein fraction was then denatured in a buffer containing 8 mol/L urea, 5 mmol/L reduced glutathione, 0.5 mmol/L oxidized glutathione, and 0.05 mol/L DTT (Sigma-Aldrich, Taufkirchen, Germany) for 12 hours on an overhead shaker. The denatured proteins were then diluted 1:10 (v/v) in 8 mol/L urea and incubated for additional 60 minutes while shaking. Subsequently, the proteins were extensively dialyzed against PBS (pH 8.5) at 4°C with frequent change of dialysis buffer and then centrifuged (12,000 x g, 20 min). The soluble renatured proteins were purified by gel filtration using a 120 mL HiPrep Sephacryl S-200 column (Pharmacia/Biotech, Freiburg, Germany) equilibrated in PBS (pH 8.5) on a fast protein liquid chromatography system (Pharmacia, Freiburg, Germany) at 0.5 mL/min. The chromatography was monitored at 280 nm. Five-milliliter fractions were collected and analyzed for the recombinant proteins by SDS-PAGE.

SDS-PAGE and Western Blot Analysis of Recombinant Proteins. Proteins were separated by PAGE on 7.5% polyacrylamide gels under denaturating and reducing conditions. Gels were either developed with Silver Stain Plus (Bio-Rad Laboratories GmbH, Munich, Germany), Brilliant Blue G Colloidal protein stain (Sigma-Aldrich, Taufkirchen, Germany) or blotted onto BA45 nitrocellulose membranes (Schleicher & Schuell, Dassel, Germany) using a semidry blotter (Biometra, Göttingen, Germany) for 60 minutes at 100 V. For Western blot analysis, the membranes were blocked with 5% nonfat dry milk/PBS and incubated with mouse herpes simplex virus–tag monoclonal IgG1 antibody (1:5,000, EMD Biosciences, Inc., Novagen Brand) for 60 minutes at room temperature. Following three washes with PBS/Tween, bound HSV-tag antibody was detected using peroxidase-conjugated goat anti-mouse IgG (Fc-specific; 1:1,000, Dianova, Hamburg, Germany) and diaminobenzidine.

Functional Characterization of scFv6G6.C4/GM-CSF Fusion Protein. The binding of scFv6G6.C4 and the scFv6G6.C4/GM-CSF fusion protein to the T84.66 idiotype antibody was determined by sandwich ELISA. Chimeric human/mouse T84.66 (chT84.66) was used as the catcher antibody. Ninety-six-well plates were coated with chT84.66 at 2 µg/mL overnight, then blocked with blocking buffer containing 5% bovine serum albumin/PBS for 2 hours. The scFv6G6.C4 and the scFv6G6.C4/GM-CSF were adjusted to equimolar concentrations and incubated for 1 hour at room temperature with the chT84.66 catcher. After three washes, the plates were incubated with HSV-tag antibody (1:1,000, EMD Biosciences, Inc., Novagen Brand) for 1 hour. Following washing, the immune complexes were detected with peroxidase-conjugated goat anti-mouse IgG (Fc specific; 1:1,000, Dianova) and OPD. Measurements were done at 492 nm using a microplate ELISA reader (SLT, Crailsheim, Germany).

To determine the biological activity of the growth factor part of the scFv6G6.C4/GM-CSF fusion protein, we did a cell growth assay using GM-CSF-dependent FDC-P1 cells (28). Before cell culture, the soluble scFv6G6.C4/GM-CSF and scFv6G6.C4 preparations were dialyzed against tissue culture medium for 12 hours. Briefly, FDC-P1-cells were maintained in MEM supplemented with 10% FCS and 2% glutamine (Life Technologies). scFv6G6.C4/GM-CSF fusion protein, murine GM-CSF, or scFv6G6.C4 were added to the cells at different concentrations and the cell culture was continued for 48 hours at 37°C in 5% CO2. Thereafter, [methyl-3H]thymidine (Amersham Biosciences, Little Chalfont, Buckinghamshire, United Kingdom) was added for another 12 hours of incubation, after which the FDC-P1-cells were harvested using a Combi-12 Cell Harvester (Molecular Devices GmbH, Munich, Germany) and transferred to a Filter (Ready Filter, Beckman Coulter GmbH, Krefeld, Germany). Thymidine incorporation was determined using a liquid scintillation ß-counter (LS 1701, Beckman Coulter GmbH). All measurements were done in triplicates.

Immunization Studies. Nine female 6-week-old C57BL/6 mice transgenic for CEA were divided into three groups for immunizations (29). As adjuvant, QS21 was used (kindly provided by Antigenics, Inc., New York, NY; ref. 30). All animals were immunized s.c. four times at 3-week intervals. Animals in group 1 received 5 µg QS21 adjuvants only; group 2 animals received 5 µg QS21 together with 13 µg scFv6G6.C4; and animals in group 3 received 5 µg QS21 together with 24 µg scFv6G6.C4/GM-CSF. Sera were collected 1 week after the final immunization and investigated for specific Ab3 antibody responses against 6G6.C4 and CEA using ELISA, Western blot analysis, and flow cytometry.

Detection of CEA- and scFv6G6.C4-specific Antibody (Ab3) Responses. Briefly, 96-well microtiter plates CovaLink (Nalge Nunc International, Wiesbaden, Germany) were coated with 200 ng/mL scFv6G6.C4 or 2 µg/mL CEA for 2 hours. After washing and blocking with 5% bovine serum albumin/PBS, the plates were incubated with the sera of the immunized mice previously diluted 1:20 to 1:640 (v/v) for 60 minutes. Following three washing steps with PBS/Tween, the bound murine immunoglobulins were incubated with peroxidase-conjugated goat anti-mouse IgG (Fc-specific, 1:1,000, Dianova). After three washing steps with PBS/Tween, the assays were developed with OPD measured at 492 nm (SLT).

To evaluate the cross-reactivity of the Ab3 response with CEA-like proteins of the CEACAM family, Western blot analyses were carried out as follows: Cell extracts from human normal colon tissue, human granulocytes, human HT29 colon carcinoma cells, and Jurkat wild-type cells were separated by SDS-PAGE on 7.5% gels under denaturating and reducing conditions and subsequently blotted onto nitrocellulose BA45 membranes (Schleicher & Schuell). After blocking with 5% nonfat dry milk/PBS, the membranes were incubated with the sera harvested from immunized mice, diluted 1:100 in blocking buffer. MAbs mT84.66 (specific for CEA), T84.1 (anti-CEA, cross-reactive with CEACAM1 and CEACAM6), BY114 (specific for CEACAM6), and 29H2 (specific for CEACAM1) were used as control antibodies. Sera from nonimmunized CEA-transgenic mice were used as negative controls. Bound antibodies were detected with peroxidase-conjugated goat anti-mouse IgG (Fc-specific; diluted 1:20,000, Dianova). Bound antibodies were visualized by chemiluminescence using the ECL+ Western Blotting Detection System (Amersham Biosciences).

CEA-specific binding of Ab3 antibodies in the sera of immunized mice was tested by flow cytometry using CEA-expressing murine and human colon carcinoma cells. In brief, 1 x 106 cells/mL of each murine MC38 colon carcinoma cells, the transfected MC38 subline C15-A.3, and MC38-BGP as well as CEACAM6-transfected human HeLa and human HT29 cells were incubated with the immune sera (1:50 diluted). MAbs mT84.66 and T84.1 were used as positive controls at 2 and 1.25 µg/mL, respectively, for 1 hour at 4°C. After washing, cells were stained with phycoerythrin-labeled goat anti-mouse IgG (DAKO, Hamburg, Germany) for 30 minutes at 4°C. Preimmune sera (1:50 diluted) were used as negative controls. Fluorescence-activated cell sorting analyses were done using a FACS Calibur benchtop flow cytometer (Becton Dickinson, Heidelberg, Germany).

Statistical Analysis. The statistical analyses were done with the Mann-Whitney U test using the WinSTAT software version 1999.2 (Robert K. Fitch software, Staufen, Germany). Findings were regarded as significant at P < 0.05.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Construction of Recombinant Genes. A scFv fragment gene coding for the monoclonal anti-idiotype antibody 6G6.C4 was generated by engineering an 18 amino acid linker between VH and VL gene via PCR amplification (Fig. 1A). As defined by the primers VHLIN_BamHI and VLLIN_BglII, the linker sequence was included in the amplification of the VH and the VL region gene, respectively. Upon ligation of the PCR fragments, the BamHI- and BglII-compatible ends were replaced by a BstYI site. Restriction with BstYI of insert-positive clones was successfully used to screen for the correct assembly of the scFv fragment. The GM-CSF cassette was positioned amino terminally to the scFv6G6.C4 gene by directional cloning using a SfiI site included into the PCR primers GM-CSFR1_SfiI and VH5.2_SfiI (Fig. 1B). Final DNA sequencing of the construct confirmed the sequences published for mAb 6G6.C4 (16) and also for the GM-CSF gene cassette as provided by the vendor (data not shown). The expression of the recombinant proteins in E. coli BL21DE3 resulted in polypeptides of predicted molecular masses of 47 and 26 kDa for scFv6G6.C4/GM-CSF and scFv6G6.C4, respectively (Fig. 2A). Up to 15 µg recombinant protein per milligram wet weight was obtained as judged from comparing known amounts of marker proteins with serial dilutions of bacterial extracts on SDS-PAGE gels after Coomassie Blue staining. The presence of the HSV-tag was shown in the recombinant proteins by the HSV-tag antibody in Western blot analyses (data not shown) and by ELISA (see Materials and Methods).



View larger version (13K):
[in this window]
[in a new window]
  		Figure 1. Cloning strategy for the construction of recombinant scFv6G6.C4 (A) and the fusion protein scFv6G6.C4/GM-CSF (B). A, the VH region and the VL region were amplified using primer pairs 1 & 2 and 3 & 4, respectively. Ligation of the products eliminated the BamHI and BglII sites generating the scFv fragment with a diagnostic BstYI restriction site. B, after reamplification of scFv6G6.C4, GM-CSF cassettes were assembled using the SfiI restriction included in primers 5 and 7.

 


View larger version (80K):
[in this window]
[in a new window]
  		Figure 2. SDS-PAGE analyses of recombinant proteins. A, unpurified protein fractions achieved after culture of transfected BL21DE3 E. coli cells separated in a 7.5% SDS polyacrylamide gel and stained with Brilliant Blue G Colloidal protein stain. Lane 1, reference standard; lane 2, insoluble protein fraction containing scFv6G6.C4/GM-CSF with an apparent mass of ~47 kDa; lanes 3 and 5, insoluble protein fraction containing scFv6G6.C4 with an apparent mass of ~26 kDa; lane 4, soluble protein fraction containing scFv6G6.C4. B, purified protein fractions of scFv6G6.C4/GM-CSF and scFv6G6.C4 were electrophoretically separated in a 7.5% polyacrylamide gel and silver stained. Lane 1, reference standard; lane 2, 1.5 µL soluble scFv6G6.C4/GM-CSF; lane 3, 1.5 µL soluble scFv6G6.C4.

 
Preparation of Protein Fractions. The recombinant proteins were found as insoluble bacterial inclusion bodies and were processed as described (31). The repeated washing/centrifugation steps of the inclusion bodies already resulted in a substantial purification. After denaturation under reducing conditions, refolding step, and fast protein liquid chromatography, the purity and stability of the recombinant proteins was examined in a 7.5% SDS polyacrylamide gel. The purity of the recombinant proteins was judged to be higher than 90% by silver staining (Fig. 2B). No degradation was observed after 14 days of storage of 4°C.

Functional Properties of scFv6G6.C4/GM-CSF and scFv6G6.C4. As shown in Fig. 3A, the immunologic capability to bind to its idiotype mAb chT84.66 was shown for both scFv6G6.C4 and for scFv6G6.C4/GM-CSF. Under equimolar conditions of 130 ng/mL for scFv6G6.C4 and 230 ng/mL for scFv6G6.C4/GM-CSF, the average binding seemed slightly higher for scFv6G6.C4/GM-CSF (0.86 ± 0.09) than for scFv6G6.C4 (0.81 ± 0.09), but not statistically significant (P = 0.11).



View larger version (16K):
[in this window]
[in a new window]
  		Figure 3. Functional characterization of scFv6G6.C4/GM-CSF fusion protein. A, antigen-binding assays using a 96-well sandwich ELISA system. White columns, A492 values using scFv6G6.C4/GM-CSF as primary antibody (1. mAb); striped columns, A492 values using scFv6G6.C4 as primary antibody. Shown are the binding capacities of scFv6G6.C4/GM-CSF and scFv6G6.C4 compared with the following negative controls: measurements without using primary mAb, measurements without using detection antibody (2. mAb, HSV-tag), and measurements without T84.66 coating. Without using peroxidase-conjugated goat anti-mouse IgG, no A492 was measured for scFv6G6.C4/GM-CSF and scFv6G6.C4 (0.00 ± 0.00, data not shown). Bars, SD. Results are from nine duplicates (scFv6G6.C4-GM-CSF fusion protein and scFv6G6.C4) and three duplicates (all negative controls). B, GM-CSF bioactivity of scFv6G6.C4/GM-CSF fusion protein. GM-CSF- and IL3-dependent FDC-P1 cells were incubated for 48 hours in the presence of increasing amounts (0.026-2600 ng/mL, X-axis) of the scFv6G6.C4/GM-CSF fusion protein ({blacksquare}), murine GM-CSF as positive control ({square}), and scFv6G6.C4 as negative control ({blacktriangleup}). Proliferation of the cells was determined by [methyl-3H]thymidine incorporation assay as described under Materials and Methods. Y-axis, proliferation of FDC-P1 cells in counts per minute (cpm). Points, mean of triplicate measurements; bars, SD. Proliferation of FDC-P1-cells was sustained by scFv6G6.C4/GM-CSF and mGM-CSF, not by scFv6G6.C4.

 
scFv6G6.C4/GM-CSF Exhibits GM-CSF Activity. We tested the GM-CSF bioactivity of the 6G6.C4/GM-CSF fusion protein using GM-CSF- and IL3-dependent FDC-P1-cells compared with murine GM-CSF used as a positive control. As shown in Fig. 3B, the fusion protein sustained proliferation of FDC-P1-cells in a dose-dependent manner. The half-maximal proliferation was achieved at a concentration of 2.6 ng/mL scFv6G6.C4/GM-CSF. Murine GM-CSF used in identical protein concentration as for the fusion protein scFv6G6.C4/GM-CSF sustained a comparable proliferation of the FDC-P1-cells. As expected, scFv6G6.C4 alone had no effect in proliferation. This experiment clearly shows that the GM-CSF fusion partner of scFv6G6.C4/GM-CSF has retained growth factor properties to stimulate cell growth of factor-dependent cells.

Immunologic Responses after Immunization with the Recombinant Proteins scFv6G6.C4/GM-CSF and scFv6G6.C4. We analyzed the Ab3 response in C57BL/6 mice transgenic for the human CEA after repeated immunizations with the adjuvant QS21 (control group), the recombinant scFv6G6.C4, or the scFv6G6.C4/GM-CSF fusion protein. For this study, three animals in each group were immunized using equimolar amounts of the recombinant proteins. Importantly, none of the animals showed signs of illness or weight loss as indicators of autoimmune reactions (not shown). Figure 4A shows the response directed against the idiotopes of the scFv fragment (i.e., the anti-6G6.C4 response). A significant difference in immunogenicity can be observed between the single-chain fragment alone and the single chain as molecular part of the GM-CSF growth factor–bearing fusion protein. Indeed, dilutions of the hyperimmune sera against the scFv alone did not result in a regular ELISA titration curve, indicating that very little antibody is being produced against 6G6.C4. In contrast, a pronounced anti-6G6.C4 (Ab3) response was readily detectable using dilutions of the immune sera of well below 1:640 (v/v). Immunization with QS21 resulted in no detectable anti-6G6.C4 response (Fig. 4A).



View larger version (16K):
[in this window]
[in a new window]
  		Figure 4. Antibody titers after vaccination of CEA-transgenic C57BL/6 mice. A and B, Mice were immunized (three animals per group) by s.c. injection of 24 µg scFv6G6.C4/GM-CSF ({blacksquare}) or 13 µg scFv6G6.C4 ({blacktriangleup}), which is the equimolar amount. All groups received 5 µg QS21 (one control group {square}). After the third boost, the serum titers of anti-scFv6G6.C4 and anti-CEA antibodies were determined by the CovaLink ELISA system coated with scFv6G6.C4 and CEA. A, anti-scFv6G6.C4 Ab3 response. B, anti-CEA Ab3 response. Points, mean titers of three identically treated animals measured in triplicates; bars, SD. C, comparison of immune responses of mice immunized with the scFv6G6.C4 or the fusion protein. Normalized ratios of the Ab3 titers of animals immunized with the fusion protein and mice immunized with scFv6G6.C4 were built. White columns, anti-scFv6G6.C4 titers; striped columns, anti-CEA titers. A column indicates the ratio of three identically immunized animals each.

 
Sera collected after the third boost at the end of week 10 were analyzed for the presence of anti-CEA-specific Ab3 response (Fig. 4B). No immune response was noted in mice immunized with QS21 alone, whereas a very limited CEA-specific binding was observed in animals immunized with scFv6G6.C4 antibody alone. Again, the titers were very low and seemed to resemble unspecific interaction below dilutions of 1:40. In contrast, when scFv6G6.C4/GM-CSF was used under identical conditions and equimolar amounts in the transgenic animals, anti-CEA (Ab3) titers of well below 1:640 were easily detectable. Anti-scFv6G6.C4 or anti-CEA responses were significantly higher in immune sera raised against the fusion protein compared with the immunizations with equimolar amounts of scFv6G6.C4 alone (anti-scFv6G6.C4 response: P = 0.005; anti-CEA response: P = 0.012) or the control group (anti-scFv6G6.C4 and anti-CEA response: P = 0.002). Ab3 titers induced by scFv6G6.C4 were also significantly different compared with the control group (anti-scFv6G6.C4 response: P = 0.012; anti-CEA response: P = 0.002). Figure 4C shows the ratios of the Ab3 titers against 6G6.C4 and CEA in animals immunized with either the single-chain fragment or the fusion protein. Up to a dilution of 1:160, the strength of the anti-CEA response (white columns) is comparable with the anti-scFv6G6.C4 response (striped columns) with a drop in A492 nm readings to 50% at 1:640 dilution. However, over all dilutions of mice sera, the difference was not significant (P = 0.212). These results clearly show that scFv6G6.C4 functions as an internal image of CEA as has been described for the full murine monoclonal 6G6.C4 (15). Also, these results show that a sufficient anti-CEA response in an immunotolerant (i.e., CEA-expressing host can be achieved using a GM-CSF fusion to anti-idiotypic antibodies). We tested the specificity of the scFv6G6.C4/GM-CSF-induced anti-CEA (Ab3) response using Western blot analyses of tissues expressing CEA-related antigens. As shown in Fig. 5A, CEA is absent in granulocyte as shown by lack of reactivity with the CEA-specific mAb chT84.66, whereas the CEA-related antigens CEACAM1 and CEACAM6 are readily detected by specific mAbs 29H2 and BY114, respectively. In colon extracts and human HT29 colon cancer cells, CEA and CEACAM1 can be shown by mAbs chT84.66 and 29H2, respectively. The slight differences in molecular mass of molecules of the CEACAM family observed with both antibodies are due to known glycosylation differences between materials obtained from tissue versus from cell culture.



View larger version (43K):
[in this window]
[in a new window]
  		Figure 5. Ab3 antibodies from sera of CEA-transgenic C57BL/6 mice immunized with scFv6G6.C4/GM-CSF bind to CEA antigen. A, detection of CEA-related molecules in various human tissues by mAbs by Western blot. Lanes 1-3, crude extract of human granulocytes. Lanes 4 and 6, protein extracts from normal human colon mucosa. Lanes 5 and 7, crude extract from HT29 colon cancer cells. Samples were separated by 7.5% SDS-PAGE under denaturating and reducing conditions and blotted onto nitrocellulose membranes. Antibodies used were mAb mT84.66 (T), mAb BY114 (B), and mAb 29H2 (H). B, specificity of Ab3 antibodies from sera of CEA-transgenic mice before and after vaccination with scFv6G6.C4/GM-CSF fusion protein. Crude extracts of HT29 cells (HT), Jurkat wild-type cells (J), and human granulocytes (G) were separated by 7.5% SDS-PAGE under denaturating and reducing conditions and blotted onto nitrocellulose membranes. All antisera were diluted 1:100 (v/v) before probing of the blots. Lanes 1-3, detection with sera from CEA-transgenic animals vaccinated with scFv6G6.C4/GM-CSF; lanes 4 and 5, pools of preimmune sera of CEA-transgenic C57BL/6 (n = 7) and wild-type mice (n = 3); lanes 6 and 7, preimmune sera of a CEA-transgenic and a wild-type animal.

 
Hyperimmune sera from transgenic mice immunized with the scFv6G6.C4/GM-CSF fusion protein specifically bound to 180 kDa CEA antigen extracted from HT29 human colon cancer cells (Fig. 5B) but did not recognize CEA-related antigens present in the granulocyte extracts (32) or HT29 cells (compare Fig. 5A). Extracts from Jurkat cells were not recognized by the hyperimmune sera. Expectedly, preimmune sera of C57BL/6 transgenic mice or C57 BL/6 wild-type mice showed no cross-reactivity with CEA-related antigens. Taken together, these results clearly show that the Ab3 response after vaccination with the scFv6G6.C4/GM-CSF fusion protein is highly specific and capable to distinguish between CEA and the highly homologous antigens.

The ability of Ab3 antibodies from scFv6G6.C4/GM-CSF vaccinated CEA-transgenic mice to detect CEA-expressing cells in whole blood was analyzed by flow cytometry. The results in Fig. 6A show specific binding to CEA in the CEA-positive cell lines C15-A.3 and HT29 compared with the preimmune sera that showed no shift in immunofluorescence. Figure 6B shows the results for the IgG1 isotype–matched controls to the CEA-mAb T84.1 (1.25 µg/mL) that is known to cross-react with CEA-related antigens or the CEA-specific mAb mT84.66 (2 µg/mL). No binding to CEA-negative cell lines was observed in the preimmune sera or the hyperimmune sera.



View larger version (25K):
[in this window]
[in a new window]
  		Figure 6. Ab3 antibodies from sera of CEA-transgenic C57BL/6 mice immunized with scFv6G6.C4/GM-CSF bind to CEA+ C15-A.3 and HT29 cells. A, CEA– BGP– NCA– MC38 cells, CEA+ C15-A.3 cells, BGP+ MC38-BGP cells, NCA+ HeLa-NCA cells, and CEA+ BGP+ NCA+ HT29 cells were incubated with 1:50 diluted preimmune sera and immune sera of C57BL/6 Han TgN (CEAgen) HvdP mice. B, all cells, excluding C15-A.3, were incubated with IgG1 isotype control and mAbT84.1 (1.25 µg/mL). C15-A.3 cells were incubated with IgG1 isotype control and mT84.66 (2 µg/mL). Bound Ab3 antibodies were detected with phycoerythrin-labeled goat anti-mouse IgG. The cells were analyzed by flow cytometry and the data presented in histograms were overlaid. Conjugate controls of each cell line (data not shown) showed no background staining. Binding of immune sera (A), mAb T84.1, and mT84.66 (B) is indicated by solid lines; binding of preimmune sera (A) and isotype control IgG1 (B) is shown by dotted lines.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The use of internal image anti-idiotypic antibody vaccines mimicking TAAs aims to elicit effective immune responses that will be capable to eradicate tumor cells and prevent tumor recurrence. However, TAAs like the human CEA are self-antigens against which clinically relevant humoral or cellular immune responses are not easily achieved. Specifically, clinical studies with anti-idiotype antibodies mimicking CEA have shown Ab3 immune responses (11, 33–35) but the benefit for the patients thus far has been limited. Similarly, we have observed only marginal CEA-specific responses following vaccination with the full murine anti-idiotypic mAb 6G6.C4 in patients with R0-resected CEA-positive pancreatic cancers.4 Because previous studies had shown that 6G6.C4 effectively functions as a surrogate antigen for CEA in mice, rats, and rabbits (15), we have attributed this failure in humans to an insufficient breaking of tolerance toward CEA. Different immunostimulatory cytokines, growth factors, or co-stimulatory antigens have been used either after fusion or by co-administration with antigens or antibodies to improve immune responses (17, 18, 21, 26, 36, 37) HREF="#B18">. For example, most recently, Reinartz et al. (13) have reported on the superiority of a fusion between IL6 and the anti-idiotype antibody (ACA125) mimicking the CA125 TAA compared with the co-administration of the respective single components. However, because this study was conducted in a nontolerant animal model, the immunogenicity of the IL-6 fusion antigen is unknown in the immunotolerant situation. To address this question, we have previously generated a CEA-transgenic mouse expressing CEA as a self-antigen in a tissue-specific manner comparable with humans (29) and have used this system to investigate a recombinant fusion vaccine that consists of the anti-idiotype and murine GM-CSF. We have chosen GM-SCF as a fusion partner, because it effectively stimulates professional antigen-presenting cells including dendritic cells. We speculated that the fusion protein of the 6G6.C4 anti-idiotype with GM-CSF would effectively "address" to the GM-CSF receptor, thereby enhancing the contact of the internal image of the CEA-specific T84.66 epitope to antigen-presenting cells for an improved antigen presentation. Indeed, the protein efficiently stimulates growth of the follicular dendritic cell line FDC-P1 (Fig. 3B) and achieves an effective anti-CEA response not seen with the anti-idiotype 6G6.C4 alone (Fig. 4B). Saha et al. (38) have shown that the pulsing of dendritic cells with an internal image CEA anti-idiotype can result in breaking of humoral and cellular tolerance in CEA-transgenic mice and protect immunized animals from a lethal tumor challenge. These data emphasize the importance of dendritic cells for active specific immunotherapy and confirm our assumption regarding the potential of fusion proteins consisting of an anti-idiotypic antibody and GM-CSF. Work is in progress in the laboratory to show whether the convenient administration of an anti-idiotype fusion vaccine will be an attractive alternative to the ex vivo pulsing of dendritic cells. Taken together, the results presented here are, to the best of our knowledge, the first that show the efficiency of an anti-idiotype/GM-CSF fusion vaccine against a human TAA and the effect on humoral immune response in an immunotolerant in vivo system.

It is known that co-administration of GM-CSF with antibodies against TAAs leads to a strong increase of human anti-mouse antibody (39). To avoid such unwanted immunoreactivity in the GM-CSF fusion protein, we have converted the full mAb to the scFv fragment to yield the scFv6G6.C4/GM-CSF vaccine. Recently, scFv have been successfully used to generate specific Ab3 antibody (7, 18, 40). The binding to the T84.66 idiotype in vitro and the capability to elicit a CEA-specific response shows that the fusion construct retains its image-bearing immunologic features. Compared to the scFv6G6.C4 alone, the scFv6G6.C4/GM-CSF greatly improved the immune response in general through its contribution from the GM-CSF fusion partner. Specifically, the internal image anti-idiotypic scFv6G6.C4 fails to yield significant anti-CEA titers in the CEA-tolerant transgenic mice (Fig. 4A and B). While Ab3 antibodies are readily detected against 6G6.C4 idiotopes (Fig. 4A), a very weak anti-CEA antibody response can only be shown in dilutions up to 1:40 (v/v; Fig. 4B). In contrast, we found that equimolar amounts of the fusion protein scFv6G6.C4/GM-CSF used under identical experimental conditions improved the antibody response in general against both the 6G6.C4 idiotopes and the CEA internal image. Indeed, anti-CEA antibodies were detectable in dilutions of 1:640 (v/v; Fig. 4B).

The reactivities against the 6G6.C4 idiotopes and the internal image of CEA were analyzed as the normalized ratios of the antisera against scFv6G6.C4 or scFv6G6.C4/GM-CSF. These ratios show that the two vaccines generate similar antibody responses up to dilutions of 1:160 beyond which the anti-CEA antibody is somewhat weaker than the anti-6G6.C4 response (Fig. 4C). This is not surprising as the anti-CEA antibodies are generated against the confined paratope structure, which represents only a part of the total number of 6G6.C4 idiotopes. Also, the paratope may be less immunogenic. Taken together, these results clearly show that breaking of tolerance against endogenous CEA can be achieved in transgenic mice and results in a strong humoral response, when the internal image scFv6G6.C4 is coupled to a potent immunostimulatory molecule.

Other studies have investigated a different approach to overcome the humoral and cellular tolerance toward CEA in the same CEA-transgenic mouse model by using vaccines comprising full CEA in recombinant viral vectors with or without additional stimulatory cytokines (41–44). These reports have shown that protection against tumor challenges can be achieved in the immunized animals. However, it remains to be seen if full antigen vaccines capable of breaking tolerance lead to anti-CEA antibodies that will cross-react with other members of the CEACAM family of glycoproteins and are significant for autoimmunity in humans. Indeed, such cross-reactive immune response has resulted from the use of a CEA-expressing cell vaccine in CEA transgenes (45). Interestingly, breaking of immunotolerance against CEA does not lead to autoimmune colitis in the transgenes (21, 43–45). In contrast, it is possible that cross-reactive immune responses may lead to an autoimmune reaction in human tissues that physiologically express CEA-related antigens (e.g., against granulocytes) because these do express large amounts of CEACAMs 1, 6, and 7. We feel strongly that the question of autoimmunity is particularly important for the full antigen vaccines but cannot be answered appropriately in the current transgenic model systems. Unfortunately, no transgenic animals exist that harbors the complete human chromosome 19 CEA gene cluster.

In contrast, anti-idiotype vaccination strategies can be directed against a single non-cross-reacting TAA epitope and may therefore provide a considerable advantage over full antigen vaccines in complex antigen systems like the human CEACAMs featuring a greater number of highly homologous and cross-reacting epitopes. As shown here and by the work of Saha et al. (38), the efficient addressing of the antigen to antigen-presenting cells is sufficient to overcome immunotolerance and will stimulate the desired immune response. Thus, the use of strong xenogenic immunostimulants may not be necessary.

In addition, the highly specific mimicry of a CEA epitope has resulted in a specific immune response (i.e., no binding of Ab3 antibodies was noted against the major CEA-like antigens that are expressed on the surface of granulocytes and in the human colon cancer cells HT29; Fig. 5B). As suggested by flow cytometry, the humoral immunity conferred by scFv6G6.C4/GM-CSF is able to recognize, and may presumably eliminate, circulating tumor cells in cancer-bearing animals. This fusion protein may therefore be a valuable vaccine for an active specific immunotherapy of CEA-positive human cancers. Further studies are now under way to investigate the tumor protective properties of scFv6G6.C4/GM-CSF.


   Acknowledgments
 
Grant support: Deutsche Krebshilfe grant to MN W56/94/NE2.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank John Shively for kindly providing purified CEA and transfected cell lines, Dr. Weiss for statistical advice, and Kerstin Reher and Raika Gimmini for their excellent technical skills.


   Footnotes
 
4 Unpublished data. Back

Received 10/ 6/04. Revised 12/13/04. Accepted 12/23/04.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hammarstrom S, Baranov V. Is there a role for CEA in innate immunity in the colon? Trends Microbiol 2001;9:119–25.[CrossRef][Medline]
  2. Abe H, Kuroki M, Tachibana K, et al. Targeted sonodynamic therapy of cancer using a photosensitizer conjugated with antibody against carcinoembryonic antigen. Anticancer Res 2002;22:1575–80.[Medline]
  3. Behr TM, Liersch T, Greiner-Bechert L, et al. Radioimmunotherapy of small-volume disease of metastatic colorectal cancer. Cancer 2002;94:1373–81.[CrossRef][Medline]
  4. Baral R, Sherrat A, Das R, et al. Murine monoclonal anti-idiotypic antibody as a surrogate antigen for human Her-2/neu. Int J Cancer 2001;92:88–95.[CrossRef][Medline]
  5. Schlebusch H, Wagner U, Grunn U, et al. A monoclonal antiidiotypic antibody ACA 125 mimicking the tumor-associated antigen CA 125 for immunotherapy of ovarian cancer. Hybridoma 1995;14:167–74.[Medline]
  6. Spendlove L, Li L, Potter V, et al. A therapeutic human anti-idiotypic antibody mimics CD55 in three distinct regions. Eur J Immunol 2000;30:2944–53.[CrossRef][Medline]
  7. Tripathi PK, Qin H, Deng S, et al. Antigen mimicry by an anti-idiotypic antibody single chain variable fragment. Mol Immunol 1998;35:853–63.[CrossRef][Medline]
  8. Uemura H, Beniers AJ, Okajima E, et al. Vaccination with anti-idiotype antibodies mimicking a renal cell carcinoma-associated antigen induces tumor immunity. Int J Cancer 1994;58:555–61.[Medline]
  9. Alfonso M, Diaz A, Hernandez AM, et al. An anti-idiotype vaccine elicits a specific response to N-glycolyl sialic acid residues of glycoconjugates in melanoma patients. J Immunol 2002;168:2523–9.[Abstract/Free Full Text]
  10. Foon KA, Oseroff AR, Vaickus L, et al. Immune responses in patients with T-cell lymphoma treated with an anti-idiotype antibody mimicking a highly restricted T-cell antigen. Clin Cancer Res 1995;1:1285–94.[Abstract]
  11. Foon KA, John WJ, Chakraborty M, et al. Clinical and immune responses in resected colon cancer patients treated with anti-idiotype monoclonal antibody vaccine that mimics the carcinoembryonic antigen. J Clin Oncol 1999;17:2889–5.[Abstract/Free Full Text]
  12. Foon KA, Lutzky J, Baral RN, et al. Clinical and immune responses in advanced melanoma patients immunized with an anti-idiotype antibody mimicking disialoganglioside GD2. J Clin Oncol 2000;18:376–84.[Abstract/Free Full Text]
  13. Reinartz S, Kohler S, Schlebusch H, et al. Vaccination of patients with advanced ovarian carcinoma with the anti-idiotype ACA125: immunological response and survival (phase Ib/II). Clin Cancer Res 2004;10:1580–7.[Abstract/Free Full Text]
  14. Wagner U, Kohler S, Reinartz S, et al. Immunological consolidation of ovarian carcinoma recurrences with monoclonal anti-idiotype antibody ACA125: immune responses and survival in palliative treatment. See The biology behind: K. A. Foon and M. Bhattacharya-Chatterjee, Are solid tumor anti-idiotype vaccines ready for prime time? Clin Cancer Res 7:1112–1115, 2001. Clin Cancer Res 2001;7:1154–62.[Abstract/Free Full Text]
  15. Gaida F-J, Fenger U, Wagener C, et al. A monoclonal anti-idiotypic antibody bearing the image of an epitope specific to the human carcinoembryonic antigen. Int J Cancer 1992;51:459–65.[Medline]
  16. Gaida FJ, Pieper D, Roder UW, et al. Molecular characterization of a cloned idiotypic cascade containing a network antigenic determinant specific for the human carcinoembryonic antigen. J Biol Chem 1993;268:14138–45.[Abstract/Free Full Text]
  17. Penichet ML, Morrison SL. Antibody-cytokine fusion proteins for the therapy of cancer. J Immunol Methods 2001;248:91–101.[CrossRef][Medline]
  18. Reinartz S, Hombach A, Kohler S, et al. Interleukin-6 fused to an anti-idiotype antibody in a vaccine increases the specific humoral immune response against CA125+ (MUC-16) ovarian cancer. Cancer Res 2003;63:3234–40.[Abstract/Free Full Text]
  19. Tao MH, Levy R Idiotype/granulocyte-macrophage colony-stimulating factor fusion protein as a vaccine for B-cell lymphoma. Nature 1993;362:755–8.[CrossRef][Medline]
  20. Tripathi PK, Qin H, Bhattacharya-Chatterjee M, et al. Construction and characterization of a chimeric fusion protein consisting of an anti-idiotype antibody mimicking a breast cancer-associated antigen and the cytokine GM-CSF. Hybridoma 1999;18:193–202.[Medline]
  21. Xu X, Clarke P, Szalai G, et al. Targeting and therapy of carcinoembryonic antigen-expressing tumors in transgenic mice with an antibody-interleukin 2 fusion protein. Cancer Res 2000;60:4475–84.[Abstract/Free Full Text]
  22. Fischer HG, Frosch S, Reske K, et al. Granulocyte-macrophage colony-stimulating factor activates macrophages derived from bone marrow cultures to synthesis of MHC class II molecules and to augmented antigen presentation function. J Immunol 1988;141:3882–8.[Abstract]
  23. Coleman DL, Chodakewitz JA, Bartiss AH, et al. Granulocyte-macrophage colony-stimulating factor enhances selective effector functions of tissue-derived macrophages. Blood 1988;72:573–8.[Abstract/Free Full Text]
  24. Inaba K, Inaba M, Romani N, et al. Generation of large numbers of dendritic cells from mouse bone marrow cultures supplemented with granulocyte/macrophage colony-stimulating factor. J Exp Med 1992;176:1693–702.[Abstract/Free Full Text]
  25. Steinman RM, Witmer-Pack M, Inaba K. Dendritic cells: antigen presentation, accessory function and clinical relevance. Adv Exp Med Biol 1993;329:1–9.[Medline]
  26. Batova A, Kamps A, Gillies SD, et al. The Ch14.18-GM-CSF fusion protein is effective at mediating antibody-dependent cellular cytotoxicity and complement-dependent cytotoxicity in vitro. Clin Cancer Res 1999;5:4259–63.[Abstract/Free Full Text]
  27. Neumaier M, Shively L, Chen FS, et al. Cloning of the genes for T84.66, an antibody that has a high specificity and affinity for carcinoembryonic antigen, and expression of chimeric human/mouse T84.66 genes in myeloma and Chinese hamster ovary cells. Cancer Res 1990;50:2128–34.[Abstract/Free Full Text]
  28. Dexter TM, Garland J, Scott D, et al. Growth of factor-dependent hemopoietic precursor cell lines. J Exp Med 1980;152:1036–47.[Abstract/Free Full Text]
  29. Eades-Perner AM, van der Putten H, Hirth A, et al. Mice transgenic for the human carcinoembryonic antigen gene maintain its spatiotemporal expression pattern. Cancer Res 1994;54:4169–76.[Abstract/Free Full Text]
  30. Kensil CR, Patel U, Lennick M, et al. Separation and characterization of saponins with adjuvant activity from Quillaja saponaria Molina cortex. J Immunol 1991;146:431–7.[Abstract]
  31. Rudolph R, Lilie H. In vitro folding of inclusion body proteins. FASEB J 1996;10:49–56.[Abstract]
  32. Stoffel T, Neumaier M, Gaida F-J, et al. Monoclonal, anti-domain and anti-peptides antibodies assign the Mr 160,000 antigen of the CD66 cluster to a mRNA encoded by the biliary glycoprotein (BGP) gene, a member of the carcinoembryonic antigen (CEA) gene family. J Immunol 1993;150:4978–84.[Abstract]
  33. Birebent B, Mitchell E, Akis N, et al. Monoclonal anti-idiotypic antibody mimicking the gastrointestinal carcinoma-associated epitope CO17-1A elicits antigen-specific humoral and cellular immune responses in colorectal cancer patients. Vaccine 2003;21:1601–12.[CrossRef][Medline]
  34. Gruber R, van Haarlem LJ, Warnaar SO, et al. The human antimouse immunoglobulin response and the anti-idiotypic network have no influence on clinical outcome in patients with minimal residual colorectal cancer treated with monoclonal antibody CO17-1A. Cancer Res 2000;60:1921–6.[Abstract/Free Full Text]
  35. Staib L, Birebent B, Somasundaram R, et al. Immunogenicity of recombinant GA733-2E antigen (CO17-1A, EGP, KS1-4, KSA, Ep-CAM) in gastro-intestinal carcinoma patients. Int J Cancer 2001;92:79–87.[CrossRef][Medline]
  36. Hoffmann P, Mueller N, Shively JE, et al. Fusion proteins of B7.1 and a carcinoembryonic antigen (CEA)-specific antibody fragment opsonize CEA-expressing tumor cells and coactivate T-cell immunity. Int J Cancer 2001;92:725–32.[CrossRef][Medline]
  37. Holliger P, Manzke O, Span M, et al. Carcinoembryonic antigen (CEA)-specific T-cell activation in colon carcinoma induced by anti-CD3 x anti-CEA bispecific diabodies and B7 x anti-CEA bispecific fusion proteins. Cancer Res 1999;59:2909–16.[Abstract/Free Full Text]
  38. Saha A, Chatterjee SK, Foon KA, et al. Dendritic cells pulsed with an anti-idiotype antibody mimicking carcinoembryonic antigen (CEA) can reverse immunological tolerance to CEA and induce antitumor immunity in CEA transgenic mice. Cancer Res 2004;64:4995–5003.[Abstract/Free Full Text]
  39. Hjelm Skog A, Ragnhammar P, Fagerberg J, et al. Clinical effects of monoclonal antibody 17-1A combined with granulocyte/macrophage-colony-stimulating factor and interleukin-2 for treatment of patients with advanced colorectal carcinoma. Cancer Immunol Immunother 1999;48:463–70.[CrossRef][Medline]
  40. Coelho M, Gauthier P, Pugniere M, et al. Isolation and characterisation of a human anti-idiotypic scFv used as a surrogate tumour antigen to elicit an anti-HER-2/neu humoral response in mice. Br J Cancer 2004;90:2032–41.[CrossRef][Medline]
  41. Kass E, Schlom J, Thompson J, et al. Induction of protective host immunity to carcinoembryonic antigen (CEA), a self-antigen in CEA transgenic mice, by immunizing with a recombinant vaccinia-CEA virus. Cancer Res 1999;59:676–83.[Abstract/Free Full Text]
  42. Kass E, Panicali DL, Mazzara G, et al. Granulocyte/macrophage-colony stimulating factor produced by recombinant avian poxviruses enriches the regional lymph nodes with antigen-presenting cells and acts as an immunoadjuvant. Cancer Res 2001;61:206–14.[Abstract/Free Full Text]
  43. Hodge JW, Grosenbach DW, Aarts WM, et al. Vaccine therapy of established tumors in the absence of autoimmunity. Clin Cancer Res 2003;9:1837–49.[Abstract/Free Full Text]
  44. Zeytin HE, Patel AC, Rogers CJ, et al. Combination of a poxvirus-based vaccine with a cyclooxygenase-2 inhibitor (celecoxib) elicits antitumor immunity and long-term survival in CEA.Tg/MIN mice. Cancer Res 2004;64:3668–78.[Abstract/Free Full Text]
  45. Mizobata S, Tompkins K, Simpson JF, et al. Induction of cytotoxic T cells and their antitumor activity in mice transgenic for carcinoembryonic antigen. Cancer Immunol Immunother 2000;49:285–95.[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schwegler, C.
Right arrow Articles by Neumaier, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schwegler, C.
Right arrow Articles by Neumaier, M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online