| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Experimental Therapeutics, Molecular Targets and Chemical Biology |
Expression in the B-Cell Lymphoma Line Jiyoye by CD26/Dipeptidyl Peptidase IV Is Associated with Enhanced In vitro and In vivo Sensitivity to Doxorubicin
1 Department of Lymphoma/Myeloma, University of Texas M.D. Anderson Cancer Center, Houston, Texas and 2 Department of Clinical Immunology, Institute of Medical Science, University of Tokyo, Tokyo, Japan
Requests for reprints: Nam H. Dang, Department of Lymphoma/Myeloma, University of Texas M.D. Anderson Cancer Center, 1515 Holcombe Boulevard, Box 429, Houston, TX 77030. Phone: 713-792-2860; Fax: 713-794-5656. E-mail: nhdang{at}mail.mdanderson.org.
| Abstract |
|---|
|
|
|---|
level in the B-cell line Jiyoye and subsequent in vitro sensitivity to doxorubicin-induced apoptosis. In addition, we show that expression of CD26/DPPIV is associated with increased phosphorylation of p38 and its upstream regulators mitogen-activated protein kinase kinase 3/6 and apoptosis signal-regulating kinase 1 and that p38 signaling pathway plays a role in the regulation of topoisomerase II
expression. Besides demonstrating that CD26 effect on topoisomerase II
and doxorubicin sensitivity is applicable to cell lines of both B-cell and T-cell lineages, the potential clinical implication of our work lies with the fact that we now show for the first time that our in vitro results can be extended to a severe combined immunodeficient mouse model. Our findings that CD26 expression can be an in vivo marker of tumor sensitivity to doxorubicin treatment may lead to future treatment strategies targeting CD26/DPPIV for selected human cancers in the clinical setting. Our article thus characterizes the biochemical linkage among CD26, p38, and topoisomerase II
while providing evidence that CD26-associated topoisomerase II
expression results in greater in vitro and in vivo tumor sensitivity to the antineoplastic agent doxorubicin.
Key Words: CD26/DPPIV p38 topoisomerase II
doxorubicin Jiyoye
| Introduction |
|---|
|
|
|---|
is an intracellular protein with a key role in proliferation and is a target for various antineoplastic agents (17). We found recently that CD26/DPPIV expression on the T-cell line Jurkat is associated with increased topoisomerase II
level, leading to a concomitant enhancement in in vitro sensitivity to topoisomerase II inhibitors (1820). The family of mitogen-activated protein kinases (MAPK) plays a very important role in the signal pathways of cell proliferation, differentiation, survival, and apoptosis (21). Three major molecules belong to this family: extracellular signal-regulated kinase (ERK) 1/2 (p44/p42), c-Jun NH2-terminal kinase (JNK/stress-activated protein kinase), and p38 MAPKs. In general, the ERK pathway mediates primarily cell growth and survival signals and promotes induction of cell differentiation under certain circumstances. On the other hand, both JNK and p38 pathways, which comprise the stress-activated protein kinase family, generally mediate proapoptotic, growth inhibitory signals and proinflammatory responses. However, p38 also induces antiapoptotic, proliferative, and cell survival signals under certain conditions (22, 23). Of note is the fact that certain antineoplastic agents, such as doxorubicin and cisplatin, induce p38-mediated apoptosis (23, 24). CD26/DPPIV is also associated with p38 signaling in certain instances. Inhibition of DPPIV enzyme activity resulted in p38 activation, leading subsequently to transforming growth factor-ß1 expression and secretion (25). Meanwhile, ERK was phosphorylated and activated in CD26 Jurkat transfectant following treatment with anti-CD26 antibody (26).
Extending our previous findings in this study, we use the Burkitt B-cell lymphoma line Jiyoye to characterize the effect of CD26 expression on topoisomerase II
and p38. We show that CD26 expression on CD26 Jiyoye transfectants is associated with enhanced topoisomerase II
level and increased sensitivity to the antineoplastic agent doxorubicin. We also show that CD26 expression results in increased p38 phosphorylation, associated with increased phosphorylation of the upstream regulators MAPK kinase (MKK) 3/6 and apoptosis signal-regulating kinase 1 (ASK1). Inhibition of p38 phosphorylation decreases topoisomerase II
expression, suggesting a role for p38 in the regulation of topoisomerase II
. Finally, studies using a severe combined immunodeficient (SCID) mouse xenograft model with CD26 Jiyoye transfectants show that CD26 expression is associated with enhanced survival following treatment with low doses of doxorubicin. Our data thus characterize the biochemical linkage among CD26, p38, and topoisomerase II
while suggesting a potential role for CD26 in the clinical setting in the treatment of selected malignancies.
| Materials and Methods |
|---|
|
|
|---|
was from Roche (Indianapolis, IN); antibodies against p38, phospho-p38, ERK1/2 (p44/p42 MAPK), phospho-ERK1/2, JNK, phospho-JNK, MKK3, phospho-MKK3/MKK6, ASK1, and phospho-ASK1 (Ser83 and Ser967) were purchased from Cell Signaling Technology, Inc. (Beverly, MA). The p38 inhibitor SKF86002was from Calbiochem (La Jolla, CA). Substrate for DPPIV, Gly-Pro-p-nitroanilide-tosylate, was purchased from WAKO (Osaka, Japan). Doxorubicin was purchased from Calbiochem and was dissolved in sterile PBS. All oligonucleotides were synthesized with Invitrogen (Carlsbad, CA). Establishment of CD26 Transfectants. The CD26 cDNA insert was prepared from the plasmid pSRa-26 as described previously (27). 5' Flanking region of CD26 (28) was extended and amplified by the PCR used with primers Ad1 (CCCGGGTCTGCCTGCGCTCCTTCTCTGAACGCTCACTTCCGAGGAGACGCCGACGATGAAGACACC) and R3 (GCGCGGTACCCTAAGGTAAAGAGAAACATTG). Through site-directed gene mutagenesis method (29), mutant CD26 containing an alanine at the putative catalytic Ser630 was prepared with primers Ad1, R3, and SA (AATTTGGGGCTGGGCATATGGAGGGTACGT), resulting in a mutant CD26 positive-DPPIV negative (S630A; ref. 30). After the sequences were confirmed, CD26 or CD26S630A fragment was inserted into retroviral vector pLNCX2 containing a neomycin-selection marker, which was obtained from Clontech Laboratories, Inc. (Palo Alto, CA). To generate the recombinant, the dualtropic retroviral packaging cell line GP2-293 was transfected by Plus Reagent (Invitrogen) and LipofectAMINE reagent (Invitrogen) with p10A1 (Clontech Laboratories) and recombinant vectors as per manufacturer's protocol. Seventy-two hours after transfection, the supernatants containing retrovirus expressing CD26 or CD26S630A were collected, filtered through a 0.45 µm syringe filter, and used to transduce target cells. To transduce Jiyoye cells, viral supernatant was added with polybrene (final concentration 8 µg/mL, Sigma Chemical) and the cells were incubated at 37°C for 24 hours; then, the medium was replaced with fresh medium containing G418 (1.5 mg/mL, Life Technologies, Grand Island, NY).
Small Interfering RNA Studies. To design target-specific small interfering RNA (siRNA) duplexes, we selected sequences of the type AA (N19; N, any nucleotide) from the open reading frame of CD26 mRNA (accession no. NM 001935) by Dharmacon siDESIGN Center (Lafayette, CO). We selected the target sequence from 1,768 to 1,786 downstream of the start codon of CD26 mRNA. Inserted siRNA oligonucleotide of pSilencerRetroQ vector (Clontech Laboratories) was designed according to manufacturer's protocol. The inserted sequence was as follows: sense GATCCGATCATGCATGCAATCAACTTCAAGAGAGTTGATTGCATGCATGATCTTTTTTGGAAG [sense siRNA (CD26-siRNA)] and antisense AATTCTTCCAAAAAAGATCATGCATGCAATCAACTCTCTTGAAGTTGATTGCATGCATGATCG. Moreover, missense siRNA [mis-siRNA (mis-CD26-siRNA)] at 3 nt was prepared to examine nonspecific effects of siRNA duplexes. Inserted sequence was as follows: sense GATCCGATCTTGCAAGCAAACAACTTCAAGAGAGTTGTTTGCTTGCAAGATCTTTTTTGGAAG and antisense AATTCTTCCAAAAAAGATCTTGCAAGCAAACAACTCTCTTGAAGTTGTTTGCTTGCAAGATCG. These sense and antisense primers were hybridized and then inserted into pSilencerRetroQ vector. After all sequences were confirmed, CD26-siRNA retrovirus was produced by the same method as above, and Karpas-299 cells were transduced and selected with puromycin (0.4 µg/mL, Clontech Laboratories).
3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide Assay. Cell growth assay was done as described previously (31). Cells were incubated in 96-well plates in the presence of culture medium alone or culture medium with doxorubicin at the indicated concentrations for a total volume of 100 µL (50,000 cells per well). After 72 hours of incubation at 37°C, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (25 µL) was added to the wells at a final concentration of 1 mg/mL. The 96-well plates were then incubated for 2 hours at 37°C followed by the addition of 100 µL extraction buffer. After overnight incubation at 37°C, absorbance measurements at 570 nm were done, with SE of the triplicate well being <15%.
Cytotoxicity index was calculated as follows:
![]() |
Immunofluorescence. All procedures were carried out at 4°C and flow cytometric analyses were done (FACScan, Becton Dickinson, San Jose, CA) as described previously (32). Cells were stained with FITC-conjugated anti-CD26 antibody and washed twice with PBS and then with goat anti-mouse IgG FITC (Coulter, Fullerton, CA). Cells were then washed twice with PBS before flow cytometric analysis. Negative control samples were stained with second antibody alone.
Annexin V/Propidium Iodide Assays. Exposure of phosphatidylserine residues was quantified by surface Annexin V staining as described previously (33). Briefly, cells were washed in binding buffer [10 mmol/L HEPES (pH 7.4), 2.5 mmol/L CaCl2, 140 mmol/L NaCl], resuspended in 100 µL, and incubated with 0.5 µL/mL Annexin V-FITC and 2.5 µg/mL propidium iodide (PI) for 15 minutes in the dark. Cells were then washed again and resuspended in 400 µL binding buffer; then, flow cytometric analysis was done. A total of 10,000 cells were acquired per sample and data were analyzed using CellQuest software (BD PharMingen). Cells in early stages of apoptosis were Annexin V positive, whereas cells that were Annexin V and PI positive were in late stages of apoptosis (34).
SDS-PAGE and Immunoblotting. After incubation at 37°C in culture medium, Jiyoye-vector control, Jiyoye-wild-type (wt) CD26 transfectant, and Jiyoye-SACD26 transfectant were harvested, washed with PBS, and lysed in lysis buffer consisting of 1% NP40, 0.5% deoxycholate, 0.1% SDS, 1 mmol/L phenylmethylsulfonyl fluoride, 1 mmol/L benzamidine, 10 µg/mL aprotinin, 50 µg/mL leupeptin, 10 µg/mL soybean trypsin inhibitor, and 1 µg/mL pepstatin. After incubating on ice for 5 minutes, nuclei were removed by centrifugation and supernatants were collected as whole cell lysates. Sample buffer (4x) consisting of 20% glycerol, 4.6% SDS, 0.5 mol/L Tris (pH 6.8), 4% ß-mercaptoethanol, and 0.2% bromophenol blue was added to the appropriate aliquots of supernatants. After boiling, protein samples were submitted to SDS-PAGE analysis on appropriate gel under standard conditions using mini-Protein II system (Bio-Rad, Richmond, CA). For each experiment, each lane was loaded with equal amount of protein. For immunoblotting, the proteins were transferred onto nitrocellulose (Immobilon-P, Millipore, Billerica, MA). After blocking for 1 hour at room temperature or overnight at 4°C in blocking solution consisting of 5% bovine serum albumin or 5% dry milk in 0.1% Tween 20-TBS, membranes were blotted with the appropriate primary antibodies diluted in blocking solution for 1 hour at room temperature or overnight at 4°C. Membranes were then washed with Tween 20-TBS, and appropriate secondary antibodies diluted in Tween 20-TBS were then applied for 1 hour at room temperature. Secondary antibody was goat anti-rabbit or goat anti-mouse horseradish peroxidase conjugates (DAKO, Kyoto, Japan). Membranes were then washed with Tween 20-TBS, and proteins were detected using an enhanced chemiluminescence system according to the manufacturer's instructions (Pierce, Rockford, IL). Membranes were exposed to Hyperfilm (Amersham Pharmacia Biotech, Piscataway, NJ).
DPPIV Enzyme Activity Assay. As described previously (16), DPPIV enzyme activity was measured spectrophotometrically using Gly-Pro-p-nitroanilide-tosylate, a substrate for DPPIV. A 1x PBS-washed whole cell suspension was prepared, and 5 x 105 cells were resuspended in 200 µL PBS into 96-well plate; then, Gly-Pro-p-nitroanilide-tosylate was added at a final concentration of 0.24 mmol/L. The absorption was measured at 405 nm using microplate spectrophotometer (BIO-TEK Instruments, Inc., Winooski, VE) twice just before the addition of the substrate and after 60-minute incubation at 37°C. DPPIV enzyme activity was calculated from the increase of absorption between 0 and 60 minutes.
Preparation of Nuclear Extracts for Detection of Topoisomerase II
Protein Level. For detection of topoisomerase II
by immunoblotting, isolation of nuclear fractions from Jiyoye-CD26 transfectants was prepared as follows. In brief, 10 x 106 cells were harvested and allowed to swell for 15 minutes on ice in cytoplasmic extraction buffer (10 mmol/L HEPES, 10 mmol/L KCl, 0.1 mmol/L EDTA, 0.1 mmol/L EGTA, 1 mmol/L DTT, 1 mmol/L phenylmethylsulfonyl fluoride, 2 µg/mL leupeptin, 2 µg/mL aprotinin, and 0.5 mg/mL benzamidine). Then, NP40 (final concentration 0.3%) was added to the cell suspension and vortexed for 10 seconds. After 2 minutes of centrifugation at 16,000 x g, the supernatant was removed. The pellet was then incubated with nuclear extraction buffer (20 mmol/L HEPES, 400 mmol/L KCl, 1 mmol/L EDTA, 1 mmol/L EGTA, 1 mmol/L DTT, 0.5 mmol/L phenylmethylsulfonyl fluoride, 2 µg/mL leupeptin, 2 µg/mL aprotinin, and 0.5 mg/mL benzamidine) for 30 minutes on ice with intermittent vortexing. The suspension was centrifuged at 16,000 x g for 5 minutes, and the supernatant was saved as the nuclear extract. SDS-PAGE and immunoblotting were then done on the nuclear extracts. Each lane was equally loaded with 10 µg protein.
In vivo Experiments. All mice were pretreated by i.p. route with 0.2 mL anti-asialo-GM1 polyclonal antisera 25% (v/v, WAKO) 1 day before tumor transplant to eliminate host natural killer cell activity and facilitate tumor engraftment (35). On day 0, 7 x 106 Jiyoye-wtCD26 transfectant cells or Jiyoye-vector control cells were then inoculated by i.p. injection. Following tumor cell inoculation, SCID mice then received saline or doxorubicin in saline by i.p. injection at 0.5 mg/kg on days 1 and 15. Tumor bearing mice were monitored for tumor development and progression, and moribund mice were euthanized, with necropsies being done for evidence of tumors. In addition, mice with visible or palpable tumors measuring 15 mm at its smallest dimension were euthanized, with necropsies done to minimize suffering to the mice.
| Results |
|---|
|
|
|---|
in Jiyoye-CD26 Transfectants. Following transfection of the human Burkitt B-cell lymphoma cell line Jiyoye with the retroviral vector pLNCX2 as described in Materials and Methods, CD26/DPPIV status is evaluated. Parental Jiyoye cells and pLNCX2-only Jiyoye transfectants (Jerome-vector control) do not express detectable amount of CD26 as determined by cell surface staining. Meanwhile, Jiyoye-wtCD26 transfectants have high level of CD26 surface expression, and Jiyoye-S630A (SACD26) transfectants express the catalytically inactive variant of CD26 (Fig. 1A). On the other hand, only the Jiyoye-wtCD26 transfectants express DPPIV enzyme activity, with Jiyoye-vector control and Jiyoye-SACD26 transfectants having no detectable DPPIV activity (Fig. 1B). Consistent with our previous findings that CD26 expression is associated with increased topoisomerase II
level in CD26 transfectants of the T-cell leukemia line Jurkat (19, 20), Jiyoye-wtCD26 transfectants also express higher level of topoisomerase II
than Jiyoye-vector control or Jiyoye-SACD26 transfectants (Fig. 1C). By demonstrating that CD26 expression, particularly its DPPIV enzyme activity, is associated with enhanced topoisomerase II
expression in the B-cell line Jiyoye, our findings indicate that a relationship between these key proteins is potentially found in a wide variety of tumor types. Furthermore, our data suggest a potential role for CD26/DPPIV in the treatment of malignancies of both B-cell and T-cell lineages.
|
association, we investigated the effect of CD26/DPPIV surface expression on doxorubicin sensitivity of Jiyoye-CD26 stable transfectants. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide uptake assays show that Jiyoye-wtCD26 transfectants display significantly increased sensitivity to doxorubicin compared with Jiyoye-vector control. In addition, Jiyoye-SACD26 transfectant, with CD26 mutated at the DPPIV catalytic site (S630A), is less sensitive to doxorubicin than Jiyoye-wtCD26 transfectants, consistent with the key role played by the DPPIV enzyme activity in increasing topoisomerase II
level and subsequent drug sensitivity (Fig. 2A). Meanwhile, Annexin V-PI assays show greater doxorubicin-induced apoptosis for Jiyoye-wtCD26 transfectants than Jiyoye-vector control cells or Jiyoye-SACD26 transfectants (Fig. 2B). Furthermore, Western blot analyses show that Jiyoye-wtCD26 transfectants exhibit greater poly(ADP-ribose) polymerase cleavage with doxorubicin treatment than Jiyoye-vector cells (Fig. 2C) Taken together, these data show that surface expression of CD26/DPPIV on the B-cell lymphoma line Jiyoye directly enhances cellular sensitivity to doxorubicin and drug-induced apoptosis.
|
|
|
|
|
Expression. To determine the relationship between p38 phosphorylation and topoisomerase II
expression, we evaluated topoisomerase II
level following inhibition of p38 phosphorylation by its specific inhibitor SKF86002 (23, 38) in Jiyoye-vector controls and Jiyoye-wtCD26 transfectants. Of note is the fact that treatment with the p38 inhibitor at the indicated concentration and time course did not affect cell viability or cell cycle status (data not shown). As shown in Fig. 7, treatment with the p38 inhibitor decreases p38 phosphorylation, associated with markedly decreased topoisomerase II
expression in both Jiyoye-vector cells and Jiyoye-wtCD26 transfectants. We found that inhibition of topoisomerase II
expression consistently lags behind the inhibitory effect of SKF86002on p38 phosphorylation. Whereas p38 phosphorylation is decreased from 6 to 24 hours after SKF86002treatment, with recovery seen by 48 hours post-treatment, decreased topoisomerase II
expression is clearly detected 48 hours post-treatment. Similar results were obtained with the p38 inhibitor SB203580 (data not shown). The fact that inhibition of p38 phosphorylation leads temporally to decreased topoisomerase II
expression strongly suggests that p38 signaling pathway is involved in the regulation of topoisomerase II
. Furthermore, our data show that p38-mediated regulation of topoisomerase II
is independent of CD26 presence.
|
|
| Discussion |
|---|
|
|
|---|
level in the B-cell line Jiyoye and subsequent sensitivity to doxorubicin-induced apoptosis, thus expanding our previous published work with the T-cell line Jurkat. In addition, our article is the first to show that expression of CD26/DPPIV is associated with increased p38 phosphorylation and that p38 signaling pathway plays a role in the regulation of topoisomerase II
expression. The connection between CD26 and the p38 signaling pathway is shown in two experimental systems, one in which CD26 is overexpressed in Jiyoye transfectants and another in which CD26 expression is decreased by target-specific siRNAs in the T-cell line Karpas-299. Besides demonstrating that CD26 effect on topoisomerase II
and doxorubicin sensitivity is applicable to cell lines of both B-cell and T-cell lineages, the potential clinical implication of our work lies with the fact that we now show for the first time that our in vitro findings can be extended to animal studies. Our findings that CD26 expression can be an in vivo marker of tumor sensitivity to doxorubicin treatment may lead to future treatment strategies targeting CD26/DPPIV for selected human cancers in the clinical setting.
MAPKs include three subfamilies: ERK, JNK/stress-activated protein kinase, and p38. Activation of the MAPK signaling pathways regulates various cellular processes, including apoptosis, proliferation, or differentiation, with the p38 signaling pathway being activated by various stress agents. In this article, we show that the presence of CD26/DPPIV results in enhanced phosphorylation of p38 in two experimental systems: the B-cell line Jiyoye in which CD26 is overexpressed and the T-cell line Karpas-299 in which CD26 expression is reduced. Previous work has shown that antibody binding to CD26 molecules expressed on the surface of CD26-Jurkat transfectants results in tyrosine phosphorylation and activation of such signaling molecules as ERK, p56lck, p59fyn, ZAP-70, c-Cbl, and PLC. In addition, anti-CD26 antibody-induced phosphorylation of ERK leads to expression of p21Cip1 (26, 39). Our work is the first to clearly show that surface expression of the CD26 molecule itself is linked to increased p38 phosphorylation. Furthermore, our data suggest that upstream regulators of p38, including MKK3/MKK6 and ASK1, particularly when phosphorylated at residue Ser83, is linked to the CD26/DPPIV-associated p38 signaling pathway in these Jiyoye-wtCD26 transfectants. ASK1 plays a important role in cell death induced by several stimuli, including genotoxic stress (40) and tumor necrosis factor-
(41). Meanwhile, data from Mabuchi et al. suggested that ASK1 may have a key role in determining the balance between tumor survival and apoptosis in cancer treatment (42). By affecting ASK1 phosphorylation status, CD26/DPPIV may therefore play a potential role in key aspects of tumor biology.
Earlier work has linked constitutive p38 phosphorylation and activation to apoptosis as well as changes in cell growth status under certain experimental conditions. For example, constitutive p38 activation is associated with spontaneous apoptosis of human neutrophils; however, inhibition of p38 by its specific inhibitor and antisense RNA delays spontaneous apoptosis (43). Meanwhile, constitutive activation of p38 in B-cell tumors, including chronic lymphocytic lymphoma, diffuse large B-cell lymphoma, and follicular lymphoma, contributes to B-cell tumor growth (44). Our study links expression of CD26, particularly its DPPIV enzyme activity, to constitutive p38 phosphorylation. However, we did not detect appreciable difference in cell viability as assayed by trypan blue uptake or Annexin V-PI studies among cells differing in CD26 expression (data not shown). Whereas the presence of an intact CD26/DPPIV results in the greatest levels of p38 phosphorylation and topoisomerase II
expression, we consistently find that Jiyoye transfectants expressing the catalytically inactive variant of CD26 still have slightly higher levels of p38 phosphorylation and topoisomerase II
expression than Jiyoye-vector control (Figs. 1C and 3A). These findings suggest that CD26 is linked to signaling pathways independent of its peptidase activity.
Our data also show that Jiyoye cells transfected with a mutant CD26 missing the DPPIV enzyme activity (Jiyoye-SACD26 transfectant) have enhanced p38 phosphorylation only when stimulated with UVC irradiation but not when stimulated with PMA. Although the mechanisms behind this observation remain to be elucidated, several potential explanations may be considered. DPPIV activity may be associated with signaling pathways that play a role in p38 phosphorylation mediated by PMA but not by UV irradiation, and the absence of DPPIV enzyme activity may lead to the lack of engagement of these signaling pathways necessary for PMA-induced p38 phosphorylation. Regarding this point, previous work has shown that the inhibition of DPPIV enzymatic activity in T cells induces an inhibitory signaling process mainly transmitted by tyrosine kinases, resulting in the inhibition of PMA-induced p56lck hyperphosphorylation (45). It is also possible that phorbol esters and UV irradiation engage different downstream signals to phosphorylate p38 that are differentially associated with CD26 and its intrinsic DPIPV enzyme activity. Previous work has shown that p38 activation is differentially regulated by PMA and UV irradiation in other experimental conditions (46). Furthermore, UV irradiation induces the activation of all p38 isoforms, whereas PMA stimulation activates only the p38
and
isoforms (38). Our results also show a connection between p38 and topoisomerase II
, as inhibition of p38 phosphorylation by a specific p38 inhibitor reduces topoisomerase II
expression. The fact that decreased topoisomerase II
level is seen 48 hours after treatment with the p38 inhibitor, whereas inhibition of p38 phosphorylation is seen earlier at 6 hours post-treatment, also suggests that p38 signaling pathway has a role in regulating topoisomerase II
expression. The fact that p38 regulates topoisomerase II
expression in both Jiyoye-vector controls and Jiyoye-wtCD26 transfectants indicates that this is a CD26-independent process. Furthermore, our data show that the increase in topoisomerase II
associated with the ectopic expression of CD26 is controlled by existing p38-linked pathways regulating topoisomerase II
expression. To our knowledge, our work is the first to show a potential connection between these two intracellular proteins, including the potential regulation of topoisomerase II
level by p38.
Meanwhile, our data showing that the expression of CD26, especially its intrinsic DPPIV enzyme activity, is associated with enhanced topoisomerase II
level and increased doxorubicin sensitivity in the B-cell lymphoma line Jiyoye extend our previous findings with the T-cell line Jurkat (19, 20). Whereas CD26 role in normal T-lymphocyte physiology is well established and its involvement in selected T-cell tumors is being elucidated (1, 7, 8, 47), CD26 function in B cells has not been well studied. Our work therefore suggested that CD26/DPPIV effect on topoisomerase II
and subsequent doxorubicin sensitivity is not restricted only to tumors of T-cell lineage but is also applicable potentially to other lymphoid malignancies. Recently, topoisomerase II
expression on malignant tumors has been found to correlate response to treatment of malignant tumors and longer patient survival, including breast cancer and Hodgkin's disease (48, 49). In addition, Walker and Nitiss show that an increase in topoisomerase II
gene copy number is associated with cancers that have increased sensitivity to topoisomerase II inhibitors, such as doxorubicin (50). Importantly, we show for the first time that our in vitro results can be extended to and confirmed in animal studies. Specifically, the presence of CD26 renders tumor cells more sensitive to doxorubicin, resulting in statistically significant survival advantage. SCID mice injected with Jiyoye control cells treated with low-dose doxorubicin did not show any significant difference in survival compared with those treated with saline, whereas SCID mice inoculated with Jiyoye-wtCD26 transfectants showed significantly greater survival when treated with low-dose doxorubicin than with saline alone. Interestingly, our in vivo studies also suggested that the presence of CD26 itself enhances survival, although the difference in survival between the Jiyoye-wtCD26 group treated with saline alone and the Jiyoye-vector control group treated with saline alone did not reach statistical significance in our experiments. Although our studies may have been underpowered to detect this difference, this potential effect resulting from CD26 expression may indicate that CD26 presence itself can modulate tumor engraftment or tumorigenicity of the transplanted cells. Regarding this point, other groups have shown that CD26/DPPIV expression in melanoma, lung carcinoma, and ovarian carcinoma inhibits tumorigenicity and prolongs survival time (1416). Taken together, our findings thus have potential implications in the clinical setting, suggesting that future treatment strategies that involve CD26/DPIV may be effective for selective neoplasms of both B-cell and T-cell lineages.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 7/21/04. Revised 11/ 8/04. Accepted 12/20/04.
| References |
|---|
|
|
|---|
and sensitivity to apoptosis induced by topoisomerase II inhibitors. Br J Cancer 2003;89:136674.[CrossRef][Medline]
. J Biol Chem 1998;273:102329.
in breast cancer. Breast Cancer Res Treat 2003;78:299311.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
T. Inamoto, T. Yamada, K. Ohnuma, S. Kina, N. Takahashi, T. Yamochi, S. Inamoto, Y. Katsuoka, O. Hosono, H. Tanaka, et al. Humanized Anti-CD26 Monoclonal Antibody as a Treatment for Malignant Mesothelioma Tumors Clin. Cancer Res., July 15, 2007; 13(14): 4191 - 4200. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Drucker Dipeptidyl Peptidase-4 Inhibition and the Treatment of Type 2 Diabetes: Preclinical biology and mechanisms of action Diabetes Care, June 1, 2007; 30(6): 1335 - 1343. [Full Text] [PDF] |
||||
![]() |
T. Inamoto, T. Yamochi, K. Ohnuma, S. Iwata, S. Kina, S. Inamoto, M. Tachibana, Y. Katsuoka, N. H. Dang, and C. Morimoto Anti-CD26 Monoclonal Antibody-Mediated G1-S Arrest of Human Renal Clear Cell Carcinoma Caki-2 Is Associated with Retinoblastoma Substrate Dephosphorylation, Cyclin-Dependent Kinase 2 Reduction, p27kip1 Enhancement, and Disruption of Binding to the Extracellular Matrix. Clin. Cancer Res., June 1, 2006; 12(11): 3470 - 3477. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sato, T. Yamochi, T. Yamochi, U. Aytac, K. Ohnuma, K. S. McKee, C. Morimoto, and N. H. Dang CD26 Regulates p38 Mitogen-Activated Protein Kinase-Dependent Phosphorylation of Integrin {beta}1, Adhesion to Extracellular Matrix, and Tumorigenicity of T-Anaplastic Large Cell Lymphoma Karpas 299 Cancer Res., August 1, 2005; 65(15): 6950 - 6956. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |