Cancer Research Annual Meeting 2010  Genetics and Biology of Brain Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamochi, T.
Right arrow Articles by Dang, N. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamochi, T.
Right arrow Articles by Dang, N. H.
[Cancer Research 65, 1973-1983, March 1, 2005]
© 2005 American Association for Cancer Research


Experimental Therapeutics, Molecular Targets and Chemical Biology

Regulation of p38 Phosphorylation and Topoisomerase II{alpha} Expression in the B-Cell Lymphoma Line Jiyoye by CD26/Dipeptidyl Peptidase IV Is Associated with Enhanced In vitro and In vivo Sensitivity to Doxorubicin

Toshiko Yamochi1, Tadanori Yamochi1, Ugur Aytac1, Tsutomu Sato1, Kazuya Sato1, Kei Ohnuma2, Kathryn S. McKee1, Chikao Morimoto1,2 and Nam H. Dang1

1 Department of Lymphoma/Myeloma, University of Texas M.D. Anderson Cancer Center, Houston, Texas and 2 Department of Clinical Immunology, Institute of Medical Science, University of Tokyo, Tokyo, Japan

Requests for reprints: Nam H. Dang, Department of Lymphoma/Myeloma, University of Texas M.D. Anderson Cancer Center, 1515 Holcombe Boulevard, Box 429, Houston, TX 77030. Phone: 713-792-2860; Fax: 713-794-5656. E-mail: nhdang{at}mail.mdanderson.org.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CD26 is a Mr 110,000 surface-bound glycoprotein with diverse functional properties, including having a key role in normal T-cell physiology and the development of certain cancers. In this article, we show that surface expression of CD26, especially its intrinsic dipeptidyl peptidase IV (DPPIV) enzyme activity, results in enhanced topoisomerase II{alpha} level in the B-cell line Jiyoye and subsequent in vitro sensitivity to doxorubicin-induced apoptosis. In addition, we show that expression of CD26/DPPIV is associated with increased phosphorylation of p38 and its upstream regulators mitogen-activated protein kinase kinase 3/6 and apoptosis signal-regulating kinase 1 and that p38 signaling pathway plays a role in the regulation of topoisomerase II{alpha} expression. Besides demonstrating that CD26 effect on topoisomerase II{alpha} and doxorubicin sensitivity is applicable to cell lines of both B-cell and T-cell lineages, the potential clinical implication of our work lies with the fact that we now show for the first time that our in vitro results can be extended to a severe combined immunodeficient mouse model. Our findings that CD26 expression can be an in vivo marker of tumor sensitivity to doxorubicin treatment may lead to future treatment strategies targeting CD26/DPPIV for selected human cancers in the clinical setting. Our article thus characterizes the biochemical linkage among CD26, p38, and topoisomerase II{alpha} while providing evidence that CD26-associated topoisomerase II{alpha} expression results in greater in vitro and in vivo tumor sensitivity to the antineoplastic agent doxorubicin.

Key Words: CD26/DPPIV • p38 • topoisomerase II{alpha} • doxorubicin • Jiyoye


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CD26 is a Mr 110,000 type II cell surface glycoprotein with diverse functional properties, which is widely expressed on various tissues, including lymphocytes, with its extracellular domain encoding a membrane-associated dipeptidyl peptidase IV (DPPIV) activity that cleaves selected biological factors to alter their functions (1). It plays an important role in T-cell biology through its physical and functional association with molecules involved in T-cell signal transduction processes (1–6). Recent findings suggest that CD26/DPPIV has a role in the development of certain neoplasms, being overexpressed in certain aggressive T-cell malignancies (7, 8), B-chronic lymphocytic leukemia (9), and thyroid carcinoma (10). On the other hand, loss or decreased surface expression of CD26/DPPIV is found in prostate cancer (11), colorectal carcinoma (12), and melanomas (13). Meanwhile, investigators have shown that DPPIV expression in melanoma and non–small cell lung carcinoma leads to inhibition of tumorigenicity, whereas DPPIV expression in ovarian carcinoma cells reduces i.p. dissemination of carcinoma cells and prolongs survival time (14–16). Topoisomerase II{alpha} is an intracellular protein with a key role in proliferation and is a target for various antineoplastic agents (17). We found recently that CD26/DPPIV expression on the T-cell line Jurkat is associated with increased topoisomerase II{alpha} level, leading to a concomitant enhancement in in vitro sensitivity to topoisomerase II inhibitors (18–20).

The family of mitogen-activated protein kinases (MAPK) plays a very important role in the signal pathways of cell proliferation, differentiation, survival, and apoptosis (21). Three major molecules belong to this family: extracellular signal-regulated kinase (ERK) 1/2 (p44/p42), c-Jun NH2-terminal kinase (JNK/stress-activated protein kinase), and p38 MAPKs. In general, the ERK pathway mediates primarily cell growth and survival signals and promotes induction of cell differentiation under certain circumstances. On the other hand, both JNK and p38 pathways, which comprise the stress-activated protein kinase family, generally mediate proapoptotic, growth inhibitory signals and proinflammatory responses. However, p38 also induces antiapoptotic, proliferative, and cell survival signals under certain conditions (22, 23). Of note is the fact that certain antineoplastic agents, such as doxorubicin and cisplatin, induce p38-mediated apoptosis (23, 24). CD26/DPPIV is also associated with p38 signaling in certain instances. Inhibition of DPPIV enzyme activity resulted in p38 activation, leading subsequently to transforming growth factor-ß1 expression and secretion (25). Meanwhile, ERK was phosphorylated and activated in CD26 Jurkat transfectant following treatment with anti-CD26 antibody (26).

Extending our previous findings in this study, we use the Burkitt B-cell lymphoma line Jiyoye to characterize the effect of CD26 expression on topoisomerase II{alpha} and p38. We show that CD26 expression on CD26 Jiyoye transfectants is associated with enhanced topoisomerase II{alpha} level and increased sensitivity to the antineoplastic agent doxorubicin. We also show that CD26 expression results in increased p38 phosphorylation, associated with increased phosphorylation of the upstream regulators MAPK kinase (MKK) 3/6 and apoptosis signal-regulating kinase 1 (ASK1). Inhibition of p38 phosphorylation decreases topoisomerase II{alpha} expression, suggesting a role for p38 in the regulation of topoisomerase II{alpha}. Finally, studies using a severe combined immunodeficient (SCID) mouse xenograft model with CD26 Jiyoye transfectants show that CD26 expression is associated with enhanced survival following treatment with low doses of doxorubicin. Our data thus characterize the biochemical linkage among CD26, p38, and topoisomerase II{alpha} while suggesting a potential role for CD26 in the clinical setting in the treatment of selected malignancies.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals, Cells, and Reagents. Human Burkitt B-cell lymphoma cell line Jiyoye and human anaplastic large T-cell lymphoma cell line Karpas-299 were obtained from American Type Culture Collection (Rockville, MD). Jiyoye cells were maintained in culture medium, which consisted of RPMI 1640 supplemented with 20% FCS, 100 units/mL penicillin, and 100 µg/mL streptomycin at 37°C and 5% CO2. Karpas-299 cells were maintained in RPMI 1640 supplemented with 10% FCS and penicillin-streptomycin at 37°C and 5% CO2. Female CB-17 SCID mice were obtained from Taconic Farms, Inc. (Germantown, NY) at 3 weeks of age and were housed in microisolator cages, and all food, water and bedding were autoclaved before use. Annexin V-FITC, anti-poly(ADP-ribose) polymerase, phycoerythrin-conjugated anti-CD19, and phycoerythrin-conjugated anti-CD8 were from BD PharMingen (San Diego, CA); FITC-conjugated anti-CD26 was from Caltag (Burlingame, CA); anti-actin was from Sigma Chemical Co. (St. Louis, MO); anti-topoisomerase II{alpha} was from Roche (Indianapolis, IN); antibodies against p38, phospho-p38, ERK1/2 (p44/p42 MAPK), phospho-ERK1/2, JNK, phospho-JNK, MKK3, phospho-MKK3/MKK6, ASK1, and phospho-ASK1 (Ser83 and Ser967) were purchased from Cell Signaling Technology, Inc. (Beverly, MA). The p38 inhibitor SKF86002was from Calbiochem (La Jolla, CA). Substrate for DPPIV, Gly-Pro-p-nitroanilide-tosylate, was purchased from WAKO (Osaka, Japan). Doxorubicin was purchased from Calbiochem and was dissolved in sterile PBS. All oligonucleotides were synthesized with Invitrogen (Carlsbad, CA).

Establishment of CD26 Transfectants. The CD26 cDNA insert was prepared from the plasmid pSRa-26 as described previously (27). 5' Flanking region of CD26 (28) was extended and amplified by the PCR used with primers Ad1 (CCCGGGTCTGCCTGCGCTCCTTCTCTGAACGCTCACTTCCGAGGAGACGCCGACGATGAAGACACC) and R3 (GCGCGGTACCCTAAGGTAAAGAGAAACATTG). Through site-directed gene mutagenesis method (29), mutant CD26 containing an alanine at the putative catalytic Ser630 was prepared with primers Ad1, R3, and SA (AATTTGGGGCTGGGCATATGGAGGGTACGT), resulting in a mutant CD26 positive-DPPIV negative (S630A; ref. 30). After the sequences were confirmed, CD26 or CD26S630A fragment was inserted into retroviral vector pLNCX2 containing a neomycin-selection marker, which was obtained from Clontech Laboratories, Inc. (Palo Alto, CA). To generate the recombinant, the dualtropic retroviral packaging cell line GP2-293 was transfected by Plus Reagent (Invitrogen) and LipofectAMINE reagent (Invitrogen) with p10A1 (Clontech Laboratories) and recombinant vectors as per manufacturer's protocol. Seventy-two hours after transfection, the supernatants containing retrovirus expressing CD26 or CD26S630A were collected, filtered through a 0.45 µm syringe filter, and used to transduce target cells. To transduce Jiyoye cells, viral supernatant was added with polybrene (final concentration 8 µg/mL, Sigma Chemical) and the cells were incubated at 37°C for 24 hours; then, the medium was replaced with fresh medium containing G418 (1.5 mg/mL, Life Technologies, Grand Island, NY).

Small Interfering RNA Studies. To design target-specific small interfering RNA (siRNA) duplexes, we selected sequences of the type AA (N19; N, any nucleotide) from the open reading frame of CD26 mRNA (accession no. NM 001935) by Dharmacon siDESIGN Center (Lafayette, CO). We selected the target sequence from 1,768 to 1,786 downstream of the start codon of CD26 mRNA. Inserted siRNA oligonucleotide of pSilencerRetroQ vector (Clontech Laboratories) was designed according to manufacturer's protocol. The inserted sequence was as follows: sense GATCCGATCATGCATGCAATCAACTTCAAGAGAGTTGATTGCATGCATGATCTTTTTTGGAAG [sense siRNA (CD26-siRNA)] and antisense AATTCTTCCAAAAAAGATCATGCATGCAATCAACTCTCTTGAAGTTGATTGCATGCATGATCG. Moreover, missense siRNA [mis-siRNA (mis-CD26-siRNA)] at 3 nt was prepared to examine nonspecific effects of siRNA duplexes. Inserted sequence was as follows: sense GATCCGATCTTGCAAGCAAACAACTTCAAGAGAGTTGTTTGCTTGCAAGATCTTTTTTGGAAG and antisense AATTCTTCCAAAAAAGATCTTGCAAGCAAACAACTCTCTTGAAGTTGTTTGCTTGCAAGATCG. These sense and antisense primers were hybridized and then inserted into pSilencerRetroQ vector. After all sequences were confirmed, CD26-siRNA retrovirus was produced by the same method as above, and Karpas-299 cells were transduced and selected with puromycin (0.4 µg/mL, Clontech Laboratories).

3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide Assay. Cell growth assay was done as described previously (31). Cells were incubated in 96-well plates in the presence of culture medium alone or culture medium with doxorubicin at the indicated concentrations for a total volume of 100 µL (50,000 cells per well). After 72 hours of incubation at 37°C, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (25 µL) was added to the wells at a final concentration of 1 mg/mL. The 96-well plates were then incubated for 2 hours at 37°C followed by the addition of 100 µL extraction buffer. After overnight incubation at 37°C, absorbance measurements at 570 nm were done, with SE of the triplicate well being <15%.

Cytotoxicity index was calculated as follows:

Immunofluorescence. All procedures were carried out at 4°C and flow cytometric analyses were done (FACScan, Becton Dickinson, San Jose, CA) as described previously (32). Cells were stained with FITC-conjugated anti-CD26 antibody and washed twice with PBS and then with goat anti-mouse IgG FITC (Coulter, Fullerton, CA). Cells were then washed twice with PBS before flow cytometric analysis. Negative control samples were stained with second antibody alone.

Annexin V/Propidium Iodide Assays. Exposure of phosphatidylserine residues was quantified by surface Annexin V staining as described previously (33). Briefly, cells were washed in binding buffer [10 mmol/L HEPES (pH 7.4), 2.5 mmol/L CaCl2, 140 mmol/L NaCl], resuspended in 100 µL, and incubated with 0.5 µL/mL Annexin V-FITC and 2.5 µg/mL propidium iodide (PI) for 15 minutes in the dark. Cells were then washed again and resuspended in 400 µL binding buffer; then, flow cytometric analysis was done. A total of 10,000 cells were acquired per sample and data were analyzed using CellQuest software (BD PharMingen). Cells in early stages of apoptosis were Annexin V positive, whereas cells that were Annexin V and PI positive were in late stages of apoptosis (34).

SDS-PAGE and Immunoblotting. After incubation at 37°C in culture medium, Jiyoye-vector control, Jiyoye-wild-type (wt) CD26 transfectant, and Jiyoye-SACD26 transfectant were harvested, washed with PBS, and lysed in lysis buffer consisting of 1% NP40, 0.5% deoxycholate, 0.1% SDS, 1 mmol/L phenylmethylsulfonyl fluoride, 1 mmol/L benzamidine, 10 µg/mL aprotinin, 50 µg/mL leupeptin, 10 µg/mL soybean trypsin inhibitor, and 1 µg/mL pepstatin. After incubating on ice for 5 minutes, nuclei were removed by centrifugation and supernatants were collected as whole cell lysates. Sample buffer (4x) consisting of 20% glycerol, 4.6% SDS, 0.5 mol/L Tris (pH 6.8), 4% ß-mercaptoethanol, and 0.2% bromophenol blue was added to the appropriate aliquots of supernatants. After boiling, protein samples were submitted to SDS-PAGE analysis on appropriate gel under standard conditions using mini-Protein II system (Bio-Rad, Richmond, CA). For each experiment, each lane was loaded with equal amount of protein. For immunoblotting, the proteins were transferred onto nitrocellulose (Immobilon-P, Millipore, Billerica, MA). After blocking for 1 hour at room temperature or overnight at 4°C in blocking solution consisting of 5% bovine serum albumin or 5% dry milk in 0.1% Tween 20-TBS, membranes were blotted with the appropriate primary antibodies diluted in blocking solution for 1 hour at room temperature or overnight at 4°C. Membranes were then washed with Tween 20-TBS, and appropriate secondary antibodies diluted in Tween 20-TBS were then applied for 1 hour at room temperature. Secondary antibody was goat anti-rabbit or goat anti-mouse horseradish peroxidase conjugates (DAKO, Kyoto, Japan). Membranes were then washed with Tween 20-TBS, and proteins were detected using an enhanced chemiluminescence system according to the manufacturer's instructions (Pierce, Rockford, IL). Membranes were exposed to Hyperfilm (Amersham Pharmacia Biotech, Piscataway, NJ).

DPPIV Enzyme Activity Assay. As described previously (16), DPPIV enzyme activity was measured spectrophotometrically using Gly-Pro-p-nitroanilide-tosylate, a substrate for DPPIV. A 1x PBS-washed whole cell suspension was prepared, and 5 x 105 cells were resuspended in 200 µL PBS into 96-well plate; then, Gly-Pro-p-nitroanilide-tosylate was added at a final concentration of 0.24 mmol/L. The absorption was measured at 405 nm using microplate spectrophotometer (BIO-TEK Instruments, Inc., Winooski, VE) twice just before the addition of the substrate and after 60-minute incubation at 37°C. DPPIV enzyme activity was calculated from the increase of absorption between 0 and 60 minutes.

Preparation of Nuclear Extracts for Detection of Topoisomerase II{alpha} Protein Level. For detection of topoisomerase II{alpha} by immunoblotting, isolation of nuclear fractions from Jiyoye-CD26 transfectants was prepared as follows. In brief, 10 x 106 cells were harvested and allowed to swell for 15 minutes on ice in cytoplasmic extraction buffer (10 mmol/L HEPES, 10 mmol/L KCl, 0.1 mmol/L EDTA, 0.1 mmol/L EGTA, 1 mmol/L DTT, 1 mmol/L phenylmethylsulfonyl fluoride, 2 µg/mL leupeptin, 2 µg/mL aprotinin, and 0.5 mg/mL benzamidine). Then, NP40 (final concentration 0.3%) was added to the cell suspension and vortexed for 10 seconds. After 2 minutes of centrifugation at 16,000 x g, the supernatant was removed. The pellet was then incubated with nuclear extraction buffer (20 mmol/L HEPES, 400 mmol/L KCl, 1 mmol/L EDTA, 1 mmol/L EGTA, 1 mmol/L DTT, 0.5 mmol/L phenylmethylsulfonyl fluoride, 2 µg/mL leupeptin, 2 µg/mL aprotinin, and 0.5 mg/mL benzamidine) for 30 minutes on ice with intermittent vortexing. The suspension was centrifuged at 16,000 x g for 5 minutes, and the supernatant was saved as the nuclear extract. SDS-PAGE and immunoblotting were then done on the nuclear extracts. Each lane was equally loaded with 10 µg protein.

In vivo Experiments. All mice were pretreated by i.p. route with 0.2 mL anti-asialo-GM1 polyclonal antisera 25% (v/v, WAKO) 1 day before tumor transplant to eliminate host natural killer cell activity and facilitate tumor engraftment (35). On day 0, 7 x 106 Jiyoye-wtCD26 transfectant cells or Jiyoye-vector control cells were then inoculated by i.p. injection. Following tumor cell inoculation, SCID mice then received saline or doxorubicin in saline by i.p. injection at 0.5 mg/kg on days 1 and 15. Tumor bearing mice were monitored for tumor development and progression, and moribund mice were euthanized, with necropsies being done for evidence of tumors. In addition, mice with visible or palpable tumors measuring 15 mm at its smallest dimension were euthanized, with necropsies done to minimize suffering to the mice.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of CD26/DPPIV and Topoisomerase II{alpha} in Jiyoye-CD26 Transfectants. Following transfection of the human Burkitt B-cell lymphoma cell line Jiyoye with the retroviral vector pLNCX2 as described in Materials and Methods, CD26/DPPIV status is evaluated. Parental Jiyoye cells and pLNCX2-only Jiyoye transfectants (Jerome-vector control) do not express detectable amount of CD26 as determined by cell surface staining. Meanwhile, Jiyoye-wtCD26 transfectants have high level of CD26 surface expression, and Jiyoye-S630A (SACD26) transfectants express the catalytically inactive variant of CD26 (Fig. 1A). On the other hand, only the Jiyoye-wtCD26 transfectants express DPPIV enzyme activity, with Jiyoye-vector control and Jiyoye-SACD26 transfectants having no detectable DPPIV activity (Fig. 1B). Consistent with our previous findings that CD26 expression is associated with increased topoisomerase II{alpha} level in CD26 transfectants of the T-cell leukemia line Jurkat (19, 20), Jiyoye-wtCD26 transfectants also express higher level of topoisomerase II{alpha} than Jiyoye-vector control or Jiyoye-SACD26 transfectants (Fig. 1C). By demonstrating that CD26 expression, particularly its DPPIV enzyme activity, is associated with enhanced topoisomerase II{alpha} expression in the B-cell line Jiyoye, our findings indicate that a relationship between these key proteins is potentially found in a wide variety of tumor types. Furthermore, our data suggest a potential role for CD26/DPPIV in the treatment of malignancies of both B-cell and T-cell lineages.



View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. CD26 expression and DPPIV activity on Jiyoye-CD26 transfectants. A, CD26 expression on Jiyoye-CD26 transfectants. Jiyoye cells were evaluated for CD26 expression by flow cytometry as described in Materials and Methods. 1), Jiyoye-vector control; 2), Jiyoye-wtCD26-1; 3), Jiyoye-wtCD26-2; 4), Jiyoye-SACD26 transfectant (A, negative control; B, anti-CD26 antibody). Representative of three different experiments. B, DPPIV activity on Jiyoye-CD26 transfectants. Jiyoye cells were evaluated for DPPIV activity as described in Materials and Methods. 1), Jiyoye-vector control; 2), Jiyoye-wtCD26-1; 3), Jiyoye-wtCD26-2; 4), Jiyoye-wtCD26-3; 5), Jiyoye-SACD26 transfectant. Columns, means of three separate experiments. C, topoisomerase II{alpha} expression on Jiyoye-CD26 transfectants Jiyoye cells were incubated in culture medium, and nuclear extracts were collected for immunoblotting studies to evaluate topoisomerase II{alpha} protein levels, with ß-actin as controls, as described in Materials and Methods. Each lane was equally loaded with 10 µg protein. Lane 1, Jiyoye-SACD26; lane 2, Jiyoye-wtCD26-1; lane 3, Jiyoye-wtCD26-2; lane 4, Jiyoye-vector. Representative of three different experiments.

 
Enhancement of Doxorubicin-Mediated Apoptosis in Jiyoye-CD26 Transfectants. To elucidate the potential consequence of the CD26-topoisomerase II{alpha} association, we investigated the effect of CD26/DPPIV surface expression on doxorubicin sensitivity of Jiyoye-CD26 stable transfectants. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide uptake assays show that Jiyoye-wtCD26 transfectants display significantly increased sensitivity to doxorubicin compared with Jiyoye-vector control. In addition, Jiyoye-SACD26 transfectant, with CD26 mutated at the DPPIV catalytic site (S630A), is less sensitive to doxorubicin than Jiyoye-wtCD26 transfectants, consistent with the key role played by the DPPIV enzyme activity in increasing topoisomerase II{alpha} level and subsequent drug sensitivity (Fig. 2A). Meanwhile, Annexin V-PI assays show greater doxorubicin-induced apoptosis for Jiyoye-wtCD26 transfectants than Jiyoye-vector control cells or Jiyoye-SACD26 transfectants (Fig. 2B). Furthermore, Western blot analyses show that Jiyoye-wtCD26 transfectants exhibit greater poly(ADP-ribose) polymerase cleavage with doxorubicin treatment than Jiyoye-vector cells (Fig. 2C) Taken together, these data show that surface expression of CD26/DPPIV on the B-cell lymphoma line Jiyoye directly enhances cellular sensitivity to doxorubicin and drug-induced apoptosis.



View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Effect of CD26 expression on doxorubicin-mediated growth inhibition and apoptosis. A, Jiyoye-CD26 transfectants were incubated at 37°C in culture medium alone or culture medium containing doxorubicin at the indicated concentrations, and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide uptake assay was done as described in Materials and Methods. Points, means of three separate experiments. B, Jiyoye-vector, Jiyoye-wtCD26 transfectants, and Jiyoye-SACD26 transfectants were incubated at 37C in culture medium alone or culture medium containing doxorubicin for 48 hours at the concentrations indicated. Cells were then harvested, and Annexin V-PI assays were done as described in Materials and Methods. Cells in early stages of apoptosis were Annexin V positive, whereas Annexin V– and PI-positive cells were in late-stage apoptosis. Representative of three independent experiments. Y axis, % of control was calculated as follows: % of control = treated cells / nontreated cells x 100. Group 1, Jiyoye-vector control; group 2, Jiyoye-wtCD26-1; group 3, Jioye-wtCD26-2; group 4, Jiyoye-wtCD26-3; group 5, Jiyoye-SACD26. C, Jiyoye-CD26 transfectants were incubated at 37°C with medium containing doxorubicin (Dox) for 48 hours at the indicated doses. Cells were then harvested and whole cell lysates were obtained. Following SDS-PAGE of lysates, immunoblotting studies for poly(ADP-ribose) polymerase (PARP) and ß-actin were done as described in Materials and Methods. The cleaved product of poly(ADP-ribose) polymerase was detected at 85 kDa. Each lane was loaded with 30 µg protein. Group 1, Jiyoye-vector control; group 2, Jiyoye-wtCD26-1; group 3, Jiyoye-wtCD26-2; group 4, Jiyoye-wtCD26-3. Representative of three different experiments.

 
Effect of CD26/DPPIV Surface Expression on the p38 Signaling Pathway. Because CD26 signaling involves MAPK in certain experimental conditions (25, 26), we evaluated the status of p38, ERK, and JNK in Jiyoye-CD26 transfectants. Figure 3 shows that Jiyoye-wtCD26 transfectants exhibit greater phosphorylation of p38 compared with Jiyoye-vector or Jiyoye-SACD26 transfectant in the absence of any extrinsic stimulation. In contrast to p38, there is no difference in the phosphorylation status of ERK and JNK among the cells incubated in culture medium, confirming that p38 is selectively phosphorylated in the presence of CD26, particularly its DPPIV enzyme activity.



View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Increased phosphorylation of p38 on Jiyoye-CD26 transfectants. After 24 hours of incubation with culture medium, Jiyoye-vector control, Jiyoye-wtCD26 transfectants, and Jiyoye-SACD26 transfectant were harvested and whole cell lysates were obtained as described in Materials and Methods. Phosphorylation of p38, ERK, and JNK was determined with the use of phosphospecific antibodies. As positive control of phospho-ERK, parental Jiyoye cells were incubated in culture medium containing 100 nmol/L PMA for 30 minutes. As positive control of phospho-JNK, parental Jiyoye cells were washed by PBS and irradiated with UVC (254 nm: UVG-54, UVP inc. CA) for 5 minutes. After irradiation, culture media were immediately added to the cells followed by incubation for 30 minutes. Cells were then harvested and whole cell lysates were obtained with the same method as above. Each lane was loaded with 100 µg protein. A, p38 phosphorylation. Lane 1, Jiyoye-vector control; lane 2, Jiyoye-wtCD26-1; lane 3, Jiyoye-wtCD26-2; lane 4, Jiyoye-wtCD26-3; lane 5, Jiyoye-SACD26. B, ERK and JNK phosphorylation. Lane 1, Jiyoye-vector control; lane 2, Jiyoye-wtCD26-1; lane 3, Jiyoye-wtCD26-2; lane 4, Jiyoye-wtCD26-3; lane 5, positive control (top, ERK: PMA stimulation; bottom, JNK: UVC irradiation). Representative of three different experiments.

 
To further confirm our findings with the Jiyoye-CD26 transfectants that CD26 presence enhances p38 phosphorylation, we established Karpas-299-CD26-siRNA as described in Materials and Methods. Whereas parental Karpas-299 cells have high level of CD26 surface expression, as shown previously (35), Karpas-299-CD26-siRNA cells exhibit low level of CD26 and a concomitant decrease in DPPIV enzyme activity (Fig. 4A and B). Importantly, Karpas-299-CD26-siRNA transfectants display decreased p38 phosphorylation level compared with parental Karpas-299 and missense Karpas-299-CD26-siRNA (Karpas-299-mis-CD26-siRNA) transfectants with unaltered CD26/DPPIV levels (Fig. 4C). Together, our findings show a clear association between CD26/DPPIV expression and increased p38 phosphorylation.



View larger version (18K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. CD26 expression, DPPIV activity, and p38 status on Karpas-299-CD26-siRNA cells. A, CD26 expression on parental Karpas-299, Karpas-299-CD26-siRNA, and Karpas-299-mis-CD26-siRNA cells. Karpas-299 cells were evaluated for CD26 expression by flow cytometry as described in Materials and Methods. Amount of CD26-positive cells is presented as percentage of total cells. A, negative control; B, parental Karpas-299; C-E, Karpas-299-CD26-siRNA cells 1-3, respectively; F and G, Karpas-299-mis-CD26-siRNA cells 1 and 2, respectively. Representative of three different experiments. B, DPPIV enzyme activity on parental Karpas-299, Karpas-299-CD26-siRNA, and Karpas-299-mis-CD26-siRNA cells. Various Karpas-299 cells were evaluated for DPPIV enzyme activity as described in Materials and Methods. Lane 1, parental Karpas-299; lanes 2-4, Karpas-299-CD26-siRNA cells 1-3, respectively; lanes 5 and 6, Karpas-299-mis-CD26-siRNA cells 1 and 2, respectively. Representative of three different experiments. C, phosphorylation status of p38 on parental Karpas-299, Karpas-299-CD26-siRNA, and Karpas-299-mis-CD26-siRNA cells. After 24 hours of incubation with culture medium, parental Karpas-299 cells, Karpas-299-CD26-siRNA cells, and Karpas-299-mis-CD26-siRNA cells were harvested and whole cell lysates were obtained as described in Materials and Methods. Phosphorylation status of p38 was determined by Western blot analysis. Each lane was loaded with 100 µg protein. Lane 1, parental Karpas-299; lanes 2-4, Karpas-299-CD26-siRNA cells 1-3, respectively; lanes 5 and 6, Karpas-299-mis-CD26-siRNA cells 1 and 2, respectively. Representative of three different experiments.

 
The p38 signaling pathway is activated by various stress agents. To further characterize the effect of CD26/DPPIV on p38-mediated signaling, we stimulated Jiyoye-CD26 transfectants with UVC irradiation and phorbol 12-myristate 13-acetate (PMA). As shown in Fig. 5A, whereas Jiyoye-wtCD26 transfectants have greater level of baseline p38 phosphorylation than Jiyoye-vector control or Jiyoye-SACD26 transfectant, as shown above, Jiyoye-wtCD26 transfectants and Jiyoye-vector control exhibit enhanced p38 phosphorylation when stimulated with both UVC irradiation and PMA. Interestingly, Jiyoye-SACD26 transfectant displays enhanced p38 phosphorylation only when stimulated with UVC irradiation but not PMA, suggesting that different signaling events are involved for CD26/DPPIV-associated p38 phosphorylation by different stimuli. Time course studies show that PMA does not induce p38 phosphorylation in Jiyoye-SACD26 cells across the range of times tested, indicating that there is a true attenuation of phosphorylation and not merely a temporal shift in phosphorylation (Fig. 5B).



View larger version (38K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Effect of UVC irradiation and PMA stimulation on p38 phosphorylation in CD26 Jiyoye transfectants. A, After 24 hours of incubation with culture medium, Jiyoye-vector, Jiyoye-wtCD26 transfectants, and Jiyoye-SACD26 transfectant were stimulated with UVC irradiation (254 nm, 5 minutes) or PMA stimulation (100 nmol/L, 30 minutes). Cells were then harvested and whole cell lysates were obtained as described in Materials and Methods. Each lane was loaded with 100 µg protein. (-), nontreatment; U, UVC irradiation; P, PMA stimulation. Group 1, Jiyoye-vector control; group 2, Jiyoye-wtCD26-1; group 3, Jiyoye-wtCD26-2; group 4, Jiyoye-wtCD26-3; group 5, Jiyoye-SACD26. Representative of three different experiments. B, cells were treated with PMA (100 nmol/L) at the indicated times, and p38 phosphorylation was detected as described above. Group 1, Jiyoye-SACD26; group 2, Jiyoye-wtCD26-1. Representative of three different experiments.

 
CD26/DPPIV Effect on Upstream Regulators of p38 in Jiyoye-CD26 Transfectants. Phosphorylation of p38 is regulated by several upstream proteins, including MKK3/MKK6. To further delineate the effect of CD26/DPPIV on p38 signaling pathway, we investigated the status of upstream regulators of p38 in Jiyoye-CD26 transfectants. Specifically, Western blot analyses with anti-phospho-MKK3/MKK6 antibody show that Jiyoye-wtCD26 transfectants have higher level of MKK3/MMK6 phosphorylation compared with Jiyoye-vector control and Jiyoye-SACD26 transfectants (Fig. 6). However, there is no detectable difference in phosphorylation of MKK4 in these cells (data not shown), which has been described previously to contribute to p38 phosphorylation (36). We also evaluated the status of ASK1, which has a role in stress-induced apoptosis and has been found to be an upstream regulator of MKK3/MKK6 (37). Figure 6 shows that ASK1 is overexpressed in Jiyoye-wtCD26 transfectants compared with Jiyoye-vector control and Jiyoye-SACD26 cells. Interestingly, there is a higher level of phospho-ASK1 (Ser83) in Jiyoye-wtCD26 cells, whereas no significant level of phospho-ASK1 (Ser967) is detected. Taken together, our findings suggest that there is an increase in the absolute number of ASK1 molecules phosphorylated at Ser83 in Jiyoye-wtCD26 transfectants. Meanwhile, the elevated phospho-ASK1 (Ser83) level seen in conjunction with a similar increase in overall ASK1 level, along with the lack of change in phospho-ASK1 (Ser967), indicates that the specific phosphate content of each ASK1 molecule is likely unchanged following CD26/DPPIV expression. Our data suggest that ASK1 and its specific phosphorylation at Ser83 serve as an up-regulator of CD26/DPPIV-associated p38 phosphorylation in these Jiyoye-wtCD26 transfectants.



View larger version (23K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. Constitutive p38 phosphorylation and its correlation with MKK3/MKK6 and ASK1 phosphorylation in CD26 Jiyoye transfectants. After 24 hours of incubation with culture medium, Jiyoye-Vector, Jiyoye-wtCD26 transfectants, and Jiyoye-SACD26 transfectant were harvested and whole cell lysates were obtained as described in Materials and Methods. Each lane was loaded with 100 µg protein. MKK3/MKK6 and ASK1 phosphorylation status was determined with the use of phosphospecific antibodies. For ASK1, specific antibodies can detect phosphorylation at Ser83 and Ser967. Lane 1, Jiyoye-vector; lane 2, Jiyoye-wtCD26-1; lane 3, Jiyoye-wtCD26-2; lane 4, Jiyoye-wtCD26-3; lane 5, Jiyoye-SACD26; lane 6, UVC irradiation 5 minutes (for positive control). Representative of three different experiments.

 
Effect of p38 Inhibition on Topoisomerase II{alpha} Expression. To determine the relationship between p38 phosphorylation and topoisomerase II{alpha} expression, we evaluated topoisomerase II{alpha} level following inhibition of p38 phosphorylation by its specific inhibitor SKF86002 (23, 38) in Jiyoye-vector controls and Jiyoye-wtCD26 transfectants. Of note is the fact that treatment with the p38 inhibitor at the indicated concentration and time course did not affect cell viability or cell cycle status (data not shown). As shown in Fig. 7, treatment with the p38 inhibitor decreases p38 phosphorylation, associated with markedly decreased topoisomerase II{alpha} expression in both Jiyoye-vector cells and Jiyoye-wtCD26 transfectants. We found that inhibition of topoisomerase II{alpha} expression consistently lags behind the inhibitory effect of SKF86002on p38 phosphorylation. Whereas p38 phosphorylation is decreased from 6 to 24 hours after SKF86002treatment, with recovery seen by 48 hours post-treatment, decreased topoisomerase II{alpha} expression is clearly detected 48 hours post-treatment. Similar results were obtained with the p38 inhibitor SB203580 (data not shown). The fact that inhibition of p38 phosphorylation leads temporally to decreased topoisomerase II{alpha} expression strongly suggests that p38 signaling pathway is involved in the regulation of topoisomerase II{alpha}. Furthermore, our data show that p38-mediated regulation of topoisomerase II{alpha} is independent of CD26 presence.



View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 7. Effect of inhibition of p38 phosphorylation on topoisomerase II{alpha} expression. Jiyoye-wtCD26 transfectants and Jiyoye-vector controls were incubated in culture medium alone or culture medium containing SKF86002(20 µmol/L) for either 24 or 48 hours. Cells were then harvested and nuclear extracts were obtained. Following SDS-PAGE of lysates, immunoblotting studies for topoisomerase II{alpha} (Topo II) or ß-actin were done as described in Materials and Methods. Each lane was loaded with 20 µg protein. D, DMSO control. Group 1, Jiyoye-wtCD26-1; group 2, Jiyoye-wtCD26-2; group 3, Jiyoye-vector controls. At various times, an aliquot was removed and stained with trypan blue dye to evaluate cell viability with a hemocytometer. All experiments had >95% cell viability. Representative of three different experiments.

 
Increased Survival of Doxorubicin-Treated SCID Mice Bearing Jiyoye-wtCD26 Cells. Extending our in vitro findings, we investigated the effect of CD26 expression on overall survival in doxorubicin-treated SCID mice inoculated with Jiyoye-vector control or Jiyoye-wtCD26 transfectants. Jiyoye-wtCD26 transfectants or Jiyoye-vector control cells (7 x 106 cells per mouse) were implanted by i.p. injection into the SCID mice on day 0; then, once per day on days 1 and 15, animals were treated by i.p. injection with saline alone or doxorubicin at a dose of 0.5 mg/kg of body weight per injection. As shown in Fig. 8, most of the SCID mice inoculated with Jiyoye-vector control cells and treated with saline (line 1) developed tumors and then were subsequently euthanized with large tumor burden as per protocol requirements. Mice injected with Jiyoye-vector cells and treated with low-dose doxorubicin (line 2) had similar survival as those treated with saline control (P = 0.50325), indicating that the low-dose doxorubicin treatment did not have a statistically significant effect on tumor growth. Meanwhile, mice inoculated with Jiyoye-wtCD26 cells and treated with saline alone (line 3) exhibited in general the same survival rate as those injected with Jiyoye-vector cells and treated with saline or doxorubicin. Although there seemed to be a trend for a slight enhancement in survival among saline-treated mice inoculated with Jiyoye-wtCD26 cells (line 3) compared with Jiyoye-vector cells (line 1), the difference was not statistically significant (P = 0.10576). Importantly, mice inoculated with Jiyoye-wtCD26 cells and treated with doxorubicin (line 4) had a marked survival advantage compared with saline-treated mice injected with the same transfectants (line 3), which is statistically significant (P = 0.00612). In summary, our data show that SCID mice inoculated with Jiyoye-vector cells did not exhibit survival difference when treated with either saline or low-dose doxorubicin. However, for SCID mice inoculated with Jiyoye-wtCD26 transfectants, those treated with low-dose doxorubicin showed statistically significant difference in survival compared with those treated with saline alone. These in vivo results therefore extend our in vitro findings by demonstrating that the presence of CD26 renders tumor cells more sensitive to the antineoplastic agent doxorubicin, leading to enhanced survival of treated animals. Our findings also suggest that treatment strategies regulating CD26 expression may be considered in the future for selected neoplasms in the clinical setting.



View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 8. Enhanced survival of Jiyoye-CD26 transfectant-bearing SCID mice after doxorubicin treatment. SCID mice were injected with Jiyoye-vector control cells or Jiyoye-wtCD26-1 cells (7 x 106 cells per mouse) on day 0 and treated with saline or doxorubicin (0.5 mg/kg) on days 1 and 15 as described in Materials and Methods. Each treatment group consisted of 15 mice. Group 1, Jiyoye-vector control treated with saline alone; group 2, Jiyoye-vector control treated with doxorubicin; group 3, Jiyoye-wtCD26 transfectant treated with saline alone; group 4, Jiyoye-wtCD26 transfectant treated with doxorubicin. Analysis for statistically significant differences in survival was done using a log-rank test (Ps: 1 versus 2 = 0.50325, 1 versus 3 = 0.10576, 1 versus 4 = 0.00009, 2 versus 3 = 0.25056, 2 versus 4 = 0.00070, and 3 versus 4 = 0.00612).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, we show that surface expression of CD26, especially its intrinsic DPPIV enzyme activity, results in enhanced topoisomerase II{alpha} level in the B-cell line Jiyoye and subsequent sensitivity to doxorubicin-induced apoptosis, thus expanding our previous published work with the T-cell line Jurkat. In addition, our article is the first to show that expression of CD26/DPPIV is associated with increased p38 phosphorylation and that p38 signaling pathway plays a role in the regulation of topoisomerase II{alpha} expression. The connection between CD26 and the p38 signaling pathway is shown in two experimental systems, one in which CD26 is overexpressed in Jiyoye transfectants and another in which CD26 expression is decreased by target-specific siRNAs in the T-cell line Karpas-299. Besides demonstrating that CD26 effect on topoisomerase II{alpha} and doxorubicin sensitivity is applicable to cell lines of both B-cell and T-cell lineages, the potential clinical implication of our work lies with the fact that we now show for the first time that our in vitro findings can be extended to animal studies. Our findings that CD26 expression can be an in vivo marker of tumor sensitivity to doxorubicin treatment may lead to future treatment strategies targeting CD26/DPPIV for selected human cancers in the clinical setting.

MAPKs include three subfamilies: ERK, JNK/stress-activated protein kinase, and p38. Activation of the MAPK signaling pathways regulates various cellular processes, including apoptosis, proliferation, or differentiation, with the p38 signaling pathway being activated by various stress agents. In this article, we show that the presence of CD26/DPPIV results in enhanced phosphorylation of p38 in two experimental systems: the B-cell line Jiyoye in which CD26 is overexpressed and the T-cell line Karpas-299 in which CD26 expression is reduced. Previous work has shown that antibody binding to CD26 molecules expressed on the surface of CD26-Jurkat transfectants results in tyrosine phosphorylation and activation of such signaling molecules as ERK, p56lck, p59fyn, ZAP-70, c-Cbl, and PLC. In addition, anti-CD26 antibody-induced phosphorylation of ERK leads to expression of p21Cip1 (26, 39). Our work is the first to clearly show that surface expression of the CD26 molecule itself is linked to increased p38 phosphorylation. Furthermore, our data suggest that upstream regulators of p38, including MKK3/MKK6 and ASK1, particularly when phosphorylated at residue Ser83, is linked to the CD26/DPPIV-associated p38 signaling pathway in these Jiyoye-wtCD26 transfectants. ASK1 plays a important role in cell death induced by several stimuli, including genotoxic stress (40) and tumor necrosis factor-{alpha} (41). Meanwhile, data from Mabuchi et al. suggested that ASK1 may have a key role in determining the balance between tumor survival and apoptosis in cancer treatment (42). By affecting ASK1 phosphorylation status, CD26/DPPIV may therefore play a potential role in key aspects of tumor biology.

Earlier work has linked constitutive p38 phosphorylation and activation to apoptosis as well as changes in cell growth status under certain experimental conditions. For example, constitutive p38 activation is associated with spontaneous apoptosis of human neutrophils; however, inhibition of p38 by its specific inhibitor and antisense RNA delays spontaneous apoptosis (43). Meanwhile, constitutive activation of p38 in B-cell tumors, including chronic lymphocytic lymphoma, diffuse large B-cell lymphoma, and follicular lymphoma, contributes to B-cell tumor growth (44). Our study links expression of CD26, particularly its DPPIV enzyme activity, to constitutive p38 phosphorylation. However, we did not detect appreciable difference in cell viability as assayed by trypan blue uptake or Annexin V-PI studies among cells differing in CD26 expression (data not shown). Whereas the presence of an intact CD26/DPPIV results in the greatest levels of p38 phosphorylation and topoisomerase II{alpha} expression, we consistently find that Jiyoye transfectants expressing the catalytically inactive variant of CD26 still have slightly higher levels of p38 phosphorylation and topoisomerase II{alpha} expression than Jiyoye-vector control (Figs. 1C and 3A). These findings suggest that CD26 is linked to signaling pathways independent of its peptidase activity.

Our data also show that Jiyoye cells transfected with a mutant CD26 missing the DPPIV enzyme activity (Jiyoye-SACD26 transfectant) have enhanced p38 phosphorylation only when stimulated with UVC irradiation but not when stimulated with PMA. Although the mechanisms behind this observation remain to be elucidated, several potential explanations may be considered. DPPIV activity may be associated with signaling pathways that play a role in p38 phosphorylation mediated by PMA but not by UV irradiation, and the absence of DPPIV enzyme activity may lead to the lack of engagement of these signaling pathways necessary for PMA-induced p38 phosphorylation. Regarding this point, previous work has shown that the inhibition of DPPIV enzymatic activity in T cells induces an inhibitory signaling process mainly transmitted by tyrosine kinases, resulting in the inhibition of PMA-induced p56lck hyperphosphorylation (45). It is also possible that phorbol esters and UV irradiation engage different downstream signals to phosphorylate p38 that are differentially associated with CD26 and its intrinsic DPIPV enzyme activity. Previous work has shown that p38 activation is differentially regulated by PMA and UV irradiation in other experimental conditions (46). Furthermore, UV irradiation induces the activation of all p38 isoforms, whereas PMA stimulation activates only the p38 {gamma} and {delta} isoforms (38). Our results also show a connection between p38 and topoisomerase II{alpha}, as inhibition of p38 phosphorylation by a specific p38 inhibitor reduces topoisomerase II{alpha} expression. The fact that decreased topoisomerase II{alpha} level is seen 48 hours after treatment with the p38 inhibitor, whereas inhibition of p38 phosphorylation is seen earlier at 6 hours post-treatment, also suggests that p38 signaling pathway has a role in regulating topoisomerase II{alpha} expression. The fact that p38 regulates topoisomerase II{alpha} expression in both Jiyoye-vector controls and Jiyoye-wtCD26 transfectants indicates that this is a CD26-independent process. Furthermore, our data show that the increase in topoisomerase II{alpha} associated with the ectopic expression of CD26 is controlled by existing p38-linked pathways regulating topoisomerase II{alpha} expression. To our knowledge, our work is the first to show a potential connection between these two intracellular proteins, including the potential regulation of topoisomerase II{alpha} level by p38.

Meanwhile, our data showing that the expression of CD26, especially its intrinsic DPPIV enzyme activity, is associated with enhanced topoisomerase II{alpha} level and increased doxorubicin sensitivity in the B-cell lymphoma line Jiyoye extend our previous findings with the T-cell line Jurkat (19, 20). Whereas CD26 role in normal T-lymphocyte physiology is well established and its involvement in selected T-cell tumors is being elucidated (1, 7, 8, 47), CD26 function in B cells has not been well studied. Our work therefore suggested that CD26/DPPIV effect on topoisomerase II{alpha} and subsequent doxorubicin sensitivity is not restricted only to tumors of T-cell lineage but is also applicable potentially to other lymphoid malignancies. Recently, topoisomerase II{alpha} expression on malignant tumors has been found to correlate response to treatment of malignant tumors and longer patient survival, including breast cancer and Hodgkin's disease (48, 49). In addition, Walker and Nitiss show that an increase in topoisomerase II{alpha} gene copy number is associated with cancers that have increased sensitivity to topoisomerase II inhibitors, such as doxorubicin (50). Importantly, we show for the first time that our in vitro results can be extended to and confirmed in animal studies. Specifically, the presence of CD26 renders tumor cells more sensitive to doxorubicin, resulting in statistically significant survival advantage. SCID mice injected with Jiyoye control cells treated with low-dose doxorubicin did not show any significant difference in survival compared with those treated with saline, whereas SCID mice inoculated with Jiyoye-wtCD26 transfectants showed significantly greater survival when treated with low-dose doxorubicin than with saline alone. Interestingly, our in vivo studies also suggested that the presence of CD26 itself enhances survival, although the difference in survival between the Jiyoye-wtCD26 group treated with saline alone and the Jiyoye-vector control group treated with saline alone did not reach statistical significance in our experiments. Although our studies may have been underpowered to detect this difference, this potential effect resulting from CD26 expression may indicate that CD26 presence itself can modulate tumor engraftment or tumorigenicity of the transplanted cells. Regarding this point, other groups have shown that CD26/DPPIV expression in melanoma, lung carcinoma, and ovarian carcinoma inhibits tumorigenicity and prolongs survival time (14–16). Taken together, our findings thus have potential implications in the clinical setting, suggesting that future treatment strategies that involve CD26/DPIV may be effective for selective neoplasms of both B-cell and T-cell lineages.


    Acknowledgments
 
Grant support: M.D. Anderson Cancer Center Physician-Scientist Award, Gillson Longenbaugh Foundation, and Goodwin Funds (N.H. Dang).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 7/21/04. Revised 11/ 8/04. Accepted 12/20/04.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Dang NH, Morimoto C. CD26: an expanding role in immune regulation and cancer. Histol Histopathol 2002;17:1213–26.[Medline]
  2. Morimoto C, Torimoto Y, Levinson G, et al. 1F7, a novel cell surface molecule, involved in helper function of CD4 cells. J Immunol 1989;143:3430–9.[Abstract]
  3. Ishii T, Ohnuma K, Murakami A, et al. CD26-mediated signaling for T cell activation occurs in lipid rafts through its association with CD45RO. Proc Natl Acad Sci U S A 2001;98:12138–43.[Abstract/Free Full Text]
  4. Ikushima H, Munakata Y, Ishii T, et al. Internalization of CD26 by mannose 6-phosphate/insulin-like growth factor II receptor contributes to T cell activation. Proc Natl Acad Sci U S A 2000;97:8439–44.[Abstract/Free Full Text]
  5. Kameoka J, Tanaka T, Nojima Y, Schlossman SF, Morimoto C. Direct association of adenosine deaminase with a T cell activation antigen, CD26. Science 1993;261:466–9.[Abstract/Free Full Text]
  6. Ohnuma K, Yamochi T, Uchiyama M, et al. CD26 upregulates expression of CD86 on antigen-presenting cells by means of caveolin-1. Proc Natl Acad Sci U S A 2004;101:14186–91.[Abstract/Free Full Text]
  7. Carbone A, Gloghini A, Zagonel V, et al. The expression of CD26 and CD40L is mutually exclusive in human T-cell non-Hodgkin's lymphomas/leukemia. Blood 1995;86:4617–26.[Abstract/Free Full Text]
  8. Dang NH, Aytac U, Sato K, et al. T-large granular lymphocyte lymphoproliferative disorder: expression of CD26 as a marker of clinically aggressive disease and characterization of marrow inhibition. Br J Haematol 2003;121:857–65.[CrossRef][Medline]
  9. Bauvois B, De Meester I, Dumont J, Rouillard D, Zhao HX, Bosmans E. Constitutive expression of CD26/dipeptidase IV on peripheral blood B lymphocytes of patients with B chronic lymphocytic leukemia. Br J Cancer 1999;79:1042–8.[CrossRef][Medline]
  10. Aratake Y, Kotani T, Tamura K, et al. Dipeptidyl aminopeptidase IV staining of cytologic preparations to distinguish benign and malignant thyroid diseases. Am J Clin Pathol 1991;96:306–10.[Medline]
  11. Bogenrieder T, Finstad CL, Freeman RH, et al. Expression and localization of aminopeptidase A, aminopeptidase N, and dipeptidyl peptidase IV in benign and malignant human prostate tissue. Prostate 1997;33:225–32.[CrossRef][Medline]
  12. Ten Kate J, van den Ingh HF, Khan PM, Bosman FT. Adenosine deaminase complexing protein (ADCP) immunoreactivity in colorectal adenocarcinoma. Int J Cancer 1986;37:479–85.[Medline]
  13. Morrison ME, Vijayasaradhi S, Engelstein D, Albino AP, Houghton AN. A marker for neoplastic progression of human melanocytes is a cell surface ectopeptidase. J Exp Med 1993;177:1135–43.[Abstract/Free Full Text]
  14. Wesley UV, Albino AP, Tiwari S, Houghton AN. A role for dipeptidyl peptidase IV in suppressing the malignant phenotype of melanocytic cells. J Exp Med 1999;190:311–22.[Abstract/Free Full Text]
  15. Wesley UV, Tiwari S, Houghton AN. Role for dipeptidyl peptidase IV in tumor suppression of human non small cell lung carcinoma cells. Int J Cancer 2004;109:855–66.[CrossRef][Medline]
  16. Kajiyama H, Kikkawa F, Suzuki T, Shibata K, Ino K, Mizutani S. Prolonged survival and decreased invasive activity attitude to dipeptidyl peptidase IV overexpression in ovarian carcinoma. Cancer Res 2002;62:2753–7.[Abstract/Free Full Text]
  17. Kellner U, Sehested M, Jensen PB, Gieseler F, Rudolph P. Culprit and victim—DNA topoisomerase II. Lancet Oncol 2002;3:235–43.[CrossRef][Medline]
  18. Aytac U, Claret FX, Ho L, et al. Expression of CD26 and its associated dipeptidyl peptidase IV enzyme activity enhances sensitivity to doxorubicin-induced cell cycle arrest at the G2-M checkpoint. Cancer Res 2001;61:7204–10.[Abstract/Free Full Text]
  19. Aytac U, Sato K, Yamochi T, et al. Effect of CD26/dipeptidyl peptidase IV on Jurkat sensitivity to G2-M arrest induced by topoisomerase II inhibitors. Br J Cancer 2003;88:455–62.[CrossRef][Medline]
  20. Sato K, Aytac U, Yamochi T, et al. CD26/dipeptidyl peptidase IV enhances expression of topoisomerase II{alpha} and sensitivity to apoptosis induced by topoisomerase II inhibitors. Br J Cancer 2003;89:1366–74.[CrossRef][Medline]
  21. Su B, Karin M. Mitogen-activated protein kinase cascades and regulation of gene expression. Curr Opin Immunol 1996;8:402–11.[CrossRef][Medline]
  22. Platanias LC. Map kinase signaling pathways and hematologic malignancies. Blood 2003;101:4667–79.[Abstract/Free Full Text]
  23. Losa JH, Cobo CP, Viniegra JG, et al. Role of the p38 MAPK pathway in cisplatin-based therapy. Oncogene 2003;22:3998–4006.[CrossRef][Medline]
  24. Zhao Y, You H, Yang Y, et al. Distinctive regulation and function of PI3K/Akt and MAPKs in doxorubicin-i1nduced apoptosis of human lung adenocarcinoma cells. J Cell Biochem 2004;91:621–32.[CrossRef][Medline]
  25. Kahne T, Reinhold D, Neubert K, Born I, Faust J, Ansorge S. Signal transduction events induced or affected by inhibition of the catalytic activity of dipeptidyl peptidase IV (DPIV, CD26). Adv Exp Med Biol 2000;477:131–7.[Medline]
  26. Ohnuma K, Ishii T, Iwata S, et al. G1-S cycle arrest provoked in human T cells by antibody to CD26. Immunology 2002;107:325–33.[CrossRef][Medline]
  27. Tanaka T, Camerini D, Seed B, et al. Cloning and functional expression of the T cell activation antigen CD26. J Immunol 1992;149:481–6.[Abstract]
  28. Gum JR, Erickson RH, Hicks JW, Rius JL, Kim YS. Analysis of dipeptidyl peptidase IV gene regulation in transgenic mice: DNA elements sufficient for promoter activity in the kidney, but not the intestine, reside on the proximal portion of the gene 5'-flanking region. FEBS Lett 2000;482:49–53.[CrossRef][Medline]
  29. Reikofski J, Tao BY. Polymerase chain reaction (PCR) techniques for site-directed mutagenesis. Biotechnol Adv 1992;10:535–47.[CrossRef][Medline]
  30. Tanaka T, Kameoka J, Yaron A, Schlossman SF, Morimoto C. The costimulatory activity of the CD26 antigen requires dipeptidyl peptidase IV enzyme activity. Proc Natl Acad Sci U S A 1993;90:4586–90.[Abstract/Free Full Text]
  31. Hansen MB, Nielsen SE, Berg K. Re-examination and further development of a precise and rapid dye method for measuring cell growth/cell kill. J Immunol Methods 1989;119:203–10.[CrossRef][Medline]
  32. Dang NH, Torimoto Y, Sugita K, et al. Cell surface modulation of CD26 by anti-1F7 monoclonal antibody; analysis of surface expression and human T cell activation. J Immunol 1990;145:3963–71.[Abstract]
  33. Raynal P, Pollard HB. Annexins: the problem of assessing the biological role for a gene family of multifunctional calcium- and phospholipids-binding proteins. Biochem Biophys Acta 1994;1197:63–93.[Medline]
  34. Roulston A, Reinhard C, Amiri P, Williams LT. Early activation of c-Jun N-terminal kinase and p38 kinase regulate cell survival in response to tumor necrosis factor {alpha}. J Biol Chem 1998;273:10232–9.[Abstract/Free Full Text]
  35. Ho L, Aytac U, Stephens C, et al. In vitro and In vivo antitumor effect of the anti-CD26 monoclonal antibody 1F7 on human CD30+ anaplastic large cell T-cell lymphoma Karpas 299. Clin Cancer Res 2001;7:2031–40.[Abstract/Free Full Text]
  36. Derijard B, Raingeaud J, Barrett T, et al. Independent human MAP-kinase signal transduction pathways defined by MEK and MKK isoforms. Science 1995;267:682–5.[Abstract/Free Full Text]
  37. Ichijo H, Nishida E, Irie K, et al. Induction of Apoptosis by ASK1, a Mammalian MAPKKK that activates SAPK/JNK and p38 signaling pathways. Science 1997;275:90–4.[Abstract/Free Full Text]
  38. Kumar S, McDonnell PC, Gum RJ, Hand AT, Lee JC, Young PR. Novel homologues of CSBP/p38 MAP kinase: activation, substrate specificity and sensitivity to inhibition by pyridinyl imidazoles. Biochem Biophys Res Commun 1997;235:533–8.[CrossRef][Medline]
  39. Hegen M, Kameoka J, Dong RP, Schlossman SF, Morimoto C. Cross-linking of CD26 by antibody induces tyrosine phosphorylation and activation of mitogen-activated protein kinase. Immunology 1997;90:257–64.[CrossRef][Medline]
  40. Wang TH, Wang HS, Ichijo H, et al. Microtubule-interfering agents active c-Jun N-terminal kinase/stress-activated protein kinase through both Ras and apoptosis signal-regulating kinase pathways. J Biol Chem 1998;273:4928–36.[Abstract/Free Full Text]
  41. Chen Z, Seimiya H, Naito M, et al. ASK1 mediates apoptotic cell death induced by genotoxic stress. Oncogene 1999;18:173–80.[CrossRef][Medline]
  42. Mabuchi S, Ohmichi M, Kimura A, et al. Estrogen inhibits paclitaxel-induced apoptosis via the phosphorylation of apoptosis signal-regulating kinase 1 in human ovarian cancer cell lines. Endocrinology 2004;145:49–58.[Abstract/Free Full Text]
  43. Aoshiba K, Yasui S, Hayashi M, Tamaoki J, Nagai A. Role of p38-mitogen-activated protein kinase in spontaneous apoptosis of human neutrophils. J Immunol 1999;162:1692–700.[Abstract/Free Full Text]
  44. Ogasawara T, Yasuyama M, Kawauchi K. Constitutive activation of extracellular signal-regulated kinase and p38 mitogen-activated protein kinase in B-cell lymphoproliferative disorders. Int J Hematol 2003;77:364–70.[Medline]
  45. Kahne T, Neubert K, Faust J, Ansorge S. Early phosphorylation events induced by DPIV/CD26-specific inhibitors. Cell Immunol 1998;189:60–6.[CrossRef][Medline]
  46. Raingeaud J, Gupta S, Rogers JS, et al. Pro-inflammatory cytokines and environmental stress cause p38 mitogen-activated protein kinase activation by dual phosphorylation on tyrosine and threonine. J Biol Chem 1995;270:7420–6.[Abstract/Free Full Text]
  47. Sato K, Dang NH. CD26: a novel treatment target for T-cell lymphoid malignancies? Int J Oncol 2003;22:481–97.[Medline]
  48. Jarvinen TA, Liu ET. HER-2/neu and topoisomerase II{alpha} in breast cancer. Breast Cancer Res Treat 2003;78:299–311.[CrossRef][Medline]
  49. Provencio M, Corbacho C, Salas C, et al. The topoisomerase IIa expression correlates with survival in patients with advanced Hodgkin's lymphoma. Clin Cancer Res 2003;9:1406–11.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
T. Inamoto, T. Yamada, K. Ohnuma, S. Kina, N. Takahashi, T. Yamochi, S. Inamoto, Y. Katsuoka, O. Hosono, H. Tanaka, et al.
Humanized Anti-CD26 Monoclonal Antibody as a Treatment for Malignant Mesothelioma Tumors
Clin. Cancer Res., July 15, 2007; 13(14): 4191 - 4200.
[Abstract] [Full Text] [PDF]


Home page
Diabetes CareHome page
D. J. Drucker
Dipeptidyl Peptidase-4 Inhibition and the Treatment of Type 2 Diabetes: Preclinical biology and mechanisms of action
Diabetes Care, June 1, 2007; 30(6): 1335 - 1343.
[Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
T. Inamoto, T. Yamochi, K. Ohnuma, S. Iwata, S. Kina, S. Inamoto, M. Tachibana, Y. Katsuoka, N. H. Dang, and C. Morimoto
Anti-CD26 Monoclonal Antibody-Mediated G1-S Arrest of Human Renal Clear Cell Carcinoma Caki-2 Is Associated with Retinoblastoma Substrate Dephosphorylation, Cyclin-Dependent Kinase 2 Reduction, p27kip1 Enhancement, and Disruption of Binding to the Extracellular Matrix.
Clin. Cancer Res., June 1, 2006; 12(11): 3470 - 3477.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Sato, T. Yamochi, T. Yamochi, U. Aytac, K. Ohnuma, K. S. McKee, C. Morimoto, and N. H. Dang
CD26 Regulates p38 Mitogen-Activated Protein Kinase-Dependent Phosphorylation of Integrin {beta}1, Adhesion to Extracellular Matrix, and Tumorigenicity of T-Anaplastic Large Cell Lymphoma Karpas 299
Cancer Res., August 1, 2005; 65(15): 6950 - 6956.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamochi, T.
Right arrow Articles by Dang, N. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamochi, T.
Right arrow Articles by Dang, N. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online