Cancer Research Cell Death Mechanisms and Cancer Therapy  Telomeres
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Furuya, M.
Right arrow Articles by Ishikura, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Furuya, M.
Right arrow Articles by Ishikura, H.
[Cancer Research 65, 2617-2625, April 1, 2005]
© 2005 American Association for Cancer Research


Molecular Biology, Pathobiology, and Genetics

Down-regulation of CD9 in Human Ovarian Carcinoma Cell Might Contribute to Peritoneal Dissemination: Morphologic Alteration and Reduced Expression of ß1 Integrin Subsets

Mitsuko Furuya1, Hiroaki Kato2, Norihiro Nishimura3, Isamu Ishiwata4, Hitoshi Ikeda2, Ryoko Ito2, Takashi Yoshiki2,3 and Hiroshi Ishikura1

1 Department of Molecular Pathology, Chiba University Graduate School of Medicine, Chiba, Japan; 2 Department of Pathophysiology, Hokkaido University Graduate School of Medicine, Sapporo, Japan; 3 Genetic Lab, Co., Ltd., Sapporo, Japan; and 4 Ishiwata Obstetrics and Gynecology Hospital, Mito, Japan

Requests for reprints: Mitsuko Furuya, Department of Molecular Pathology, Chiba University Graduate School of Medicine, Inohana 1-8-1, Chuo-ku, Chiba 260-8670, Japan. Phone: 81-43-226-2062; Fax: 81-43-226-2063; E-mail: furuya{at}faculty.chiba-u.jp.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Peritoneal dissemination is one of the main causes of death in cancer patients. Pathophysiology of metastasis has been well investigated, but the mechanism of diffuse spread of tumor colonies in the peritoneal cavity is not fully understood. CD9 is a member of tetraspanin and its down-regulation is known to be involved in poor prognosis. To investigate the significance of the down-regulation of CD9, HTOA, an ovarian carcinoma cell line that highly expressed CD9, was transiently transfected with small interfering RNA (siRNA) against CD9, and CD9-negative cells (HTOACD9–) were purified. HTOACD9– showed altered adhesion patterns on Matrigel, collagen, fibronectin, and laminin compared with those of control siRNA–transfected HTOA (control-HTOA). Flow cytometry and fluorescence cytostainings revealed that the expression levels of integrins ß1, {alpha}2, {alpha}3ß1, {alpha}5, and {alpha}6 were lower in HTOACD9– than those of control-HTOA. HTOACD9– showed altered expression of junctional and cytoskeletal molecules. By time-lapse video microscopy, control-HTOA showed solid adhesion to extracellular matrix and formed cobblestone pattern, whereas HTOACD9– showed weaker adhesion and were distributed as diffuse spots. To examine whether the expression level of CD9 change during tumor dissemination, HTOA-P, a highly disseminative subclone of HTOA, was established. HTOA-P showed distinctive down-regulation of CD9 at mRNA and protein levels, and showed similar morphologic alteration as HTOACD9– did. These findings indicate that the down-regulation of CD9 may be an acquired event in the process of tumor dissemination. Down-regulated CD9 may attenuate the expression of several integrins and rearrange junctional and cytoskeletal molecules that might contribute to dissemination of ovarian carcinomas.

Key Words: ovarian carcinoma • peritoneal dissemination • CD9 • tetraspanin • siRNA


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Aggressive tumors often disseminate in the peritoneal cavity, known as carcinomatous peritonitis. Studies on gene expression profiles by microarray analyses and high throughput differential screenings have expanded our understanding of the pathogenesis in various carcinomas. At present, many molecules are known to play important roles for tumor progression. For example, up-regulation of matrix remodeling enzymes, growth factors, and cell cycle regulatory molecules may explain, at least in part, some of the characteristic feature of advanced carcinomas, such that they are biologically aggressive in proliferation, invasion, and angiogenesis (1–5). With regard to tumor metastasis, detailed studies on interaction between tumor cells and extracellular matrix (ECM) have indicated that several transmembrane molecules such as CD44, cadherins, and integrins are important for tumor intravasation and migration into adjacent tissue (6–9). In addition to these transmembrane molecules, in vitro studies have clarified that intracellular signaling cascades such as Rho, Rac, and Cdc42 participate in the regulation of cell migration and adhesion (10). However, it has not been fully understood whether these molecules listed above also play key roles in peritoneal dissemination, or whether there are other important regulators that control the process of diffuse spread of tumor colonies in the peritoneal cavity.

Tetraspanins have been identified as a superfamily of transmembrane protein, and to date, >30 members have been reported (11). It is known that many types of cells simultaneously express more than one member of tetraspanins that form complex with other transmembrane proteins. The current view of the function of tetraspanins is that they organize the cell surface proteins such as heparin-binding epidermal growth factor (EGF)–like growth factor (HB-EGF) on epithelial cells (12), CD4 and CD8 on T cells (13), CD21-19 complex on B cells (14), and integrin family on different cell types (15), and they may regulate cell motility, signaling, and other unknown functions (11–15).

CD9 is a member of tetraspanins and is expressed in plasma membrane of various cell types, including hematopoietic cells, endothelial cells, normal epithelial cells, and several tumor cell lines (15–19). With regard to disease process, it was reported that the down-regulation of CD9 is correlated with poor prognosis in several human malignancies such as colon, lung, head and neck, breast, and ovarian carcinomas (20–25). On the other hand, in vitro experiments have shown that CD9 plays important roles for the process of invasion in some tumor cells (26), and up-regulation of CD9 in vivo was documented in aggressive gastric carcinomas (27) and high-grade astrocytic tumors (28).

We investigated the possible contribution of CD9 to the process of peritoneal dissemination in ovarian carcinomas. Peritoneal dissemination is the most common feature of advanced ovarian carcinomas that leads to poor prognosis. CD9 is highly expressed in HTOA, an ovarian carcinoma cell line. CD9-negative HTOA cells (HTOACD9–) were purified using small interfering RNA (siRNA) and magnetic cell sorting (MACS). Purified HTOACD9– cells showed morphologic alteration on ECM and attenuated expression of several ß1 integrin subsets. To investigate the possible association of the down-regulated CD9 with tumor dissemination, we established a highly disseminative subclone of HTOA, HTOA-P. HTOA-P showed distinctive down-regulation of CD9 and showed the similar morphologic patterns on ECM to those were shown in HTOACD9–.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals. Female nude mice (BALB/C nu/nu) of 4 to 6 weeks old were used in this study (Clea Co., Ltd., Tokyo, Japan). All mice were maintained under specific pathogen-free conditions at the Institute for Animal Experimentation, Hokkaido and Chiba University Graduate Schools of Medicine, in accordance with the Guide for the Care and Use of Laboratory Animals (Hokkaido and Chiba University Graduate Schools of Medicine, 1988 and 1991, respectively). The animals were provided with a gamma-irradiated diet and sterilized water.

Ovarian carcinoma, HTOA, cell culture. Human ovarian adenocarcinoma cell line HTOA (29) was obtained from Riken cell bank (Tsukuba, Japan). The cells were maintained in Ham F-12 medium, supplemented with 10% FCS, 1% penicillin, and streptomycin at 37°C in 5% CO2.

Small interfering RNA transfection. HTOA cells were trypsinized and replaced into 10-cm dishes, at density of 1 x 106 cells per dish. After 24 hours, the cells were transfected with siRNA using RNAiFect Reagent (Qiagen, Hilden, Germany) according to the manufacturer's instructions. The 21nt siRNA directed against CD9 was 5'-UUCUUGCUCGAAGAUGCUCTT-3'. The concentration of siRNA was 10 µg/5 mL per dish. Control siRNA (nonsilencing) was purchased from Qiagen. As another siRNA control, LaminA/C silencer (Qiagen) was used. LaminA/C has not been reported to interact with CD9 or other tetraspanins. Transient transfection assay was as recommended by the manufacturer. The efficiency of siRNA transfection was checked by fluorescence microscopy in each experiment using FITC-labeled siRNA. Transfected cells were harvested for analysis at 24, 48, and 72 hours, respectively, as described in detail in Results. To obtain higher purity of CD9-negative cells (HTOACD9–), transfected cells were harvested in 48 hours and CD9-positive cells were depleted by MACS LD column (Miltenyi Biotec, Bergisch Gladbach, Germany).

Establishment of a highly peritoneal metastatic subclone, HTOA-P. A highly peritoneal metastatic subclone was established thrice of peritoneal inoculation of HTOA in vivo, using the same method described before (30). HTOA (1 x 107) in 1 mL of PBS were inoculated into the peritoneal cavity of BALB/C nude mice (n = 14). The mice were sacrificed after 6, 10 to 12, and 24 to 26 weeks after tumor cell inoculation. Whereas no tumor nodules were observed in mice sacrificed at 6 and 10 to 12 weeks, tumor nodules were seen in mice sacrificed at 24 to 26 weeks after tumor cell inoculations. Tumor cells were cultivated from these nodules, dispersed and suspended in Ham F-12 medium, supplemented with 10% FCS and 1% penicillin and streptomycin at 37°C in 5% CO2. These cells, 1 x 107 in 1 mL of PBS, were then inoculated i.p., and a similar procedure was repeated thrice and the established subclone was named HTOA-P. HTOA-P showed highly disseminative phenotype in vivo, as described in Results.

Reverse transcription-PCR and real-time reverse transcription-PCR. Expression of tetraspanins CD9, CD63, CD82, and CD151 were examined by reverse transcription-PCR (RT-PCR) with the following primers: 84 (forward) TTCGGCCCAGGCTAAGTTAG and 184 (reverse) CGGCAA- GCCAGAAGATGAAG for human CD9, 544 (forward) TTGGGAGAAAATCCCTTCCA and 644 (reverse) GGATCGCCTTCTCGTTGAAA for human CD63, 590 (forward) CAGGAT- GCCTGGGACTACGT and 691 (reverse) GACCTCAGGGCGATTCATGA for human CD82, and 306 (forward) GCTGGAGATCATCGCTGGTATC and 406 (reverse) GGTGGTAG-CGCCTGGTCAT for human CD151, and 212 (forward) CCACCCATGGCAAATTCC and 280 (reverse) TGATGGGATTTCCATTGATGAC for human glyceraldehyde-3-phosphate dehydrogenase, 1065 (forward) CTCCTCCTGAGCGCAAGTACTC and 1155 (reverse) TCCTGCTTGCTGATCCAC-ATC for human ß-actin. RT-PCR amplification was done using AmpliTaq Gold PCR Master Mix (PE Applied Biosystems, Foster City, CA) and PCR thermocycler (PE 9700, Applied Biosystems). Conditions for PCR were as follows; at 95°C for 5 minutes, 28 cycles at 95°C for 15 seconds, 58°C for 15 seconds, 72°C for 1 minute, with an extension step of 7 minutes at 72°C at the end of the last cycle.

For real-time RT-PCR, QuantiTect SYBR Green PCR kit (Qiagen) and PCR amplifications in ABI-PE Prism 7000 sequence detection system (Applied Biosystems) were used according to the protocol provided by the manufacturer. Conditions for PCR included at 50°C for 2 minutes, at 95°C for 15 minutes, and 40 cycles of 95°C for 30 seconds and 60°C for 30 seconds. mRNA levels were expressed as the absolute number of copies normalized against ß-actin mRNA.

Fluorescence cytostaining. Cells (5 x 104) were placed onto four-chamber slides (Nunc Lab-Tek, Naperville, IL). After 24 hours, chamber slides were washed with PBS and stained with mouse monoclonal antibodies (mAb) CD9, integrins {alpha}3ß1, {alpha}6, ß1 (DakoCytomation, Carpinteria, CA), {alpha}2 and {alpha}5 (BD Biosciences, San Diego, CA), ZO-1 (Zymed, South San Francisco, CA), filamentous actin (F-actin), and {alpha}-tubulin (Invitrogen, San Diego, CA) using TSA kit (Invitrogen) according to the manufacturer's instructions. All the results were obtained from at least three independent experiments.

Flow cytometry. Cell suspensions were stained with CD9 and Integrins listed above, followed by FITC-conjugated goat anti-mouse Immunoglobrins (ICN Pharmaceuticals, Aurora, OH). The expression of other tetraspanins CD63 (Novocastra, Newcastle upon Tyne, United Kingdom), CD82 (Santa Cruz Biotechnology, Santa Cruz, CA), and CD151 (BD Biosciences), and an epithelial marker EMA (DakoCytomation) were also examined in control-HTOA and HTOACD9– to check the target specificity of siRNA. Cells were analyzed on a FACScan (Becton Dickinson, Mountain View, CA) and rates of positive cells were quantified using CELLQest software 2.1.1 (Becton Dickinson). All the results were obtained from at least three independent experiments.

Cell proliferation assay. Cells were cultured for 72 hours in 96-well flat-bottomed microtiter plates at 2.5 x 103 cells per well in 1% FCS medium. Viable cells were counted by absorbance measurements at 450 nm (A450 nm) at 6 to 72 hours using Cell Counting Kit-8 (Dojindo, Kumamoto, Japan). Relative growth was calculated as [A (72 hours) – A (6 hours) / A (6 hours)].

Western blot analysis. Fifty micrograms of proteins were electrophoresed on 12.5% SDS-PAGE and transferred to a polyvinylidene difluoride membrane (Nihon Eido, Tokyo, Japan). The blots were probed with mouse mAbs against CD9 (Santa Cruz Biotechnology, 1:200) and ß-actin (Sigma, St. Louis, MO, 1:5,000), and successively incubated with horseradish peroxidase- conjugated goat anti-mouse antibody (Santa Cruz Biotechnology, 1:2,500). Can Get Signal (Toyobo, Osaka, Japan) was used to obtain specific bands. Incubation protocol was as recommended by the manufacturer. Bands were detected using an enhanced chemiluminescence system, according to the Hybond enhanced chemiluminescence protocol (Amersham, Arlington Heights, IL).

In vitro morphogenesis assay. Matrigel (BD Biosciences) was placed on 24-well plates (300 µL per well) and allowed to solidify at 37°C for 30 minutes. Other wells were coated with 2 µg/cm2 of laminin, fibronectin (Sigma), or 10% type I collagen (Serva, Heidelberg, Germany). Cells (5 x 104) were cultured in each well at 37°C with 5% CO2 in Opti-MEM medium (Life Technologies, Gaithersburg, MD). Time-lapse morphologic analysis was done for 24 hours using CCD camera VB-7000 (Keyence, Osaka, Japan). Control-HTOA formed cellular network that connected each colony in 4 to 12 hours on all types of ECM but most distinctively on laminin. Therefore, after incubation on laminin for 8 hours, the number of cellular network was counted from 12 independent fields. In 24 hours, cells showed flat sheet distribution on laminin, fibronectin, and type I collagen. On Matrigel, cells were distributed as hemispherical or cobblestone-pattern colonies. After incubation on Matrigel for 24 hours, the number of colonies was counted from 12 independent fields. All the results were obtained from at least three independent experiments.

Histologic examination. Histology and immunohistochemistry of peritoneal implants of HTOA and HTOA-P were examined. The specimens were fixed in 10% formalin and paraffin embedded. H&E staining was done. Immunohistochemical stainings for CD9 and Ki-67 (DakoCytomation) were done using labeled streptoavidin-biotin-peroxidase and microwave antigen retrieval technique.

Statistical analysis. Values were expressed as the mean ± SE. Mann-Whitney U test was used for statistical evaluation. Statistical significance was assumed when P < 0.05 was obtained.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Purification of HTOACD9– by small interfering RNA and magnetic cell sorting. By fluorescence-activated cell sorting analysis (FACS), control-HTOA showed positive for CD9 and CD151 in 97% and 96% of counted cells, respectively (Fig. 1A and C) but negative for CD82 (Fig. 1B) and CD63 (data not shown). An epithelial marker EMA was positive in control-HTOA too (data not shown). Original HTOA and Lamin A/C siRNA-transfected cells showed similar results in the expression of these molecules (data not shown). To obtain CD9-negative cells, siRNA against CD9 was transfected into HTOA. In 24, 48, and 72 hours after transfection, FACS analysis showed that the yield of CD9-negative cells (HTOACD9–) was 15%, 42%, and 47%, respectively (data not shown). To improve the purity of HTOACD9–, CD9-positive cells were depleted by MACS 48 hours after transfection. The final yield of HTOACD9– was up to 85% (Fig. 1D). This HTOACD9– showed positive for another tetraspanin CD151 (Fig. 1F) and EMA (data not shown) and showed negative for CD82 (Fig. 1E) and CD63 (data not shown). Although a decrease of CD151 was observed in HTOACD9– (96-85%), it seemed not to severely affect the specificity of CD9 silencing (97-15%). By Western blot analysis, distinct bands of CD9 were detected both in control-HTOA and original HTOA lanes, whereas the band of CD9 was scarcely observed in the lane of HTOACD9– (Fig. 1G). By fluorescence microscope, it was confirmed that >80% of HTOA cells were transfected with siRNA (Fig. 1H). Control-HTOA cells showed ubiquitous stainings of CD9 at the membrane sites (Fig. 1I). CD9-positive small vesicles were also detected in the cytoplasm of some cells (data not shown). Original HTOA and Lamin A/C siRNA-transfected cells showed similar results (data not shown). On the other hand, in HTOACD9–, the majority of these cells were negative for CD9 and focally patchy stainings were detected in the membrane of limited number of cells (Fig. 1J).



View larger version (45K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Expression of CD9 and other tetraspanins in control-HTOA and purified HTOACD9– cells. A, majority of control-HTOA (97%) are positive for CD9 by FACS. B, control-HTOA are negative for CD82. C, majority of control-HTOA (96%) are positive for CD151. D, HTOACD9– cells are isolated by the combination of siRNA and MACS. The final yield of CD9-negative cells is 85%. E, HTOACD9– cells are negative for CD82. F, HTOACD9– cells are positive for CD151, although a decrease of positivity (96-85%) is observed. G, in Western blot, distinct bands of CD9 are detected at 24 to 27 kDa in HTOA and control-HTOA lanes, whereas the band is almost undetectable in HTOACD9– lanes. Homogenized renal tissue is used as a positive control. Bands of ß-actin. H, HTOA cells transfected with FITC-labeled control siRNA. More than 80% cells are transfected (x630). I, fluorescence cytostainings of CD9 in control-HTOA show that CD9 is detected in cell membranes (x1,000). Inset, merged image with 4',6-diamidino-2-phenylindole (DAPI). J, fluorescence cytostainings of CD9 in HTOACD9– show that the majority of HTOACD9– cells are scarcely stained for CD9 (x1,000). Inset, merged image with DAPI.

 
Morphologic alteration of HTOACD9– when cultured on Matrigel-, laminin-, fibronectin-, and collagen-coated plates. To investigate the morphologic alteration in vitro, both control-HTOA and HTOACD9– cells were cultured on Matrigel-coated plates and time-lapse video monitoring was done. Majority of control-HTOA attached firmly onto the Matrigel in 8 hours (Fig. 2A-D). On the other hand, majority of HTOACD9– showed less adhesive onto Matrigel, and many cells were distributed as single cells or groups of a few cells in 8 hours (Fig. 2E-H). In 24 hours, control-HTOA showed cobblestone-pattern structure (Fig. 3A, left), whereas HTOACD9– formed numerous hemispherical colonies (Fig. 3A, right). The number of colonies on Matrigel in 24 hours was 19.7 ± 2.0/x10 field in control-HTOA, whereas 40.1 ± 8.6/x10 field in HTOACD9– (P = 0.04; Fig. 3B).



View larger version (97K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Adhesion patterns of control-HTOA and HTOACD9– on Matrigel assessed by time-lapse video microscopy. Control-HTOA cells attach on Matrigel in 8 hours showing close cell-cell contact and forming cellular bridges (A-D). HTOACD9– cells demonstrate far less conspicuous adhesive pattern compared with control-HTOA (E-H).

 


View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Architectural patterns of control-HTOA and HTOACD9– on Matrigel and laminin. A, control-HTOA cells show cobblestone-pattern structure and are distributed as monolayer sheet on Matrigel in 24 hours (left), whereas HTOACD9– cells form hemispherical colonies and are spread as spots (right). B, numbers of colonies on Matrigel in 24 hours are 19.7 ± 2.0/x10 field in control-HTOA, whereas 40.1 ± 8.6/x10 field in HTOACD9– (P = 0.04). C, control-HTOA cells attach on laminin-coated plates in 8 hours and form prominent cellular networks (left, arrow). Attached HTOACD9– cells on laminin-coated plates are significantly low in number, and cellular contacts are indistinct (right). D, numbers of cellular networks formation in 8 hours on laminin are 14 ± 3.8/x10 field in control-HTOA, while 3.7 ± 3.1/x10 field in HTOACD9– (P = 0.0004).

 
Because ECM contains various components, cells were also cultured on laminin-, fibronectin-, and type I collagen–coated plates. On laminin-coated plates, control-HTOA colonies formed cellular network as shown in Fig. 3C (left, arrows) and connected each other in 8 hours. After incubation on laminin for 24 hours, control-HTOA showed monolayer distribution and kept close intercellular contact (data not shown). On the other hand, HTOACD9– showed markedly altered structure on laminin-coated plates. Both intercellular and cell-matrix adhesions were significantly reduced (Fig. 3C, right). After incubation on laminin-coated plates for 8 hours, the number of cellular network was 14 ± 3.8/x10 field in control-HTOA, whereas 3.7 ± 3.1/x10 field in HTOACD9– (P = 0.0004; Fig. 3D).

Cell adhesion patterns on fibronectin and type I collagen in control-HTOA were almost similar to that on laminin, and the cell showed close contact with each other and formed flat distribution (data not shown). HTOACD9– cells were less adhesive on type I collagen. HTOACD9– also showed attenuated adhesion pattern on fibronectin, but the pattern was less conspicuous than those on laminin and type I collagen (data not shown).

Reduced expression of integrins ß1, {alpha}2, {alpha}3ß1, {alpha}5, and {alpha}6 in HTOACD9–. Matrigel and laminin are major ligands for ß1 integrin superfamily; therefore, we examined whether the expression of integrins were altered in HTOACD9–. Fluorescence double stainings showed that integrins ß1, {alpha}2, {alpha}3ß1, {alpha}5, and {alpha}6 expressed at cell membrane of control-HTOA that were colocalized with CD9 (Fig 4A-C). Integrin ß1 was stained at both cell membrane and paranuclear cytoplasm. On the other hands, stainings of these integrins at cell membrane was less prominent in many HTOACD9–cells, and some HTOACD9– cells were not stained for these integrins (Fig. 4D-F). Integrin {alpha}4 was detected neither in HTOA nor HTOACD9–, and the absence of integrin {alpha}4 was confirmed by RT-PCR (data not shown).



View larger version (40K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. Expression of ß1 integrin subsets in control-HTOA and HTOACD9–. Representative case of integrin {alpha}3ß1. Other integrins are also colocalized with CD9 at cell membrane. A, fluorescence double stainings show that CD9 is positive at cell membrane of control-HTOA (stained in green with FITC-labeled tyramide; x630). B, integrin {alpha}3ß1 is localized at cell membrane as same pattern as CD9 (stained in red with cy3-labeled {alpha}3ß1 mAb; x630). C, integrin {alpha}3ß1 is colocalized with CD9 (merged image of A and B; x630). D, fluorescence double stainings in HTOACD9– shows CD9 is scarcely positive for CD9 (stained in green with FITC-labeled tyramide; x630). Inset, same field image stained with DAPI. E, integrin {alpha}3ß1 is localized at cell membrane in limited number of the cells (stained in red with cy3-labeled {alpha}3ß1 mAb; x630). F, CD9 is not expressed in the cells that are negative for integrin {alpha}3ß1 (merged image of D and E; x630). G, expression of integrins ß1, {alpha}2, {alpha}3ß1, {alpha}5, and {alpha}6 in control-HTOA by FACS. H, expression of integrin {alpha}3ß1 is significantly reduced followed by integrins ß1 and {alpha}6. Reduced expression of integrins {alpha}2 and {alpha}5 in HTOACD9– is less conspicuous. I, quantification of reduced rates of integrins in HTOACD9–. White column, positive rates of integrins in control-HTOA; black column, positive rates of integrins in HTOACD9–. Decreased rates as indicated.

 
FACS analysis supported the findings of fluorescence cytostainings that the expression of integrins ß1, {alpha}2, {alpha}3ß1, {alpha}5, and {alpha}6 on cell surface was decreased in HTOACD9– (Fig. 4G and H). By quantification of FACS data, the expression of integrin {alpha}3ß1 was most significantly reduced (41%), followed by those of integrins ß1 and {alpha}6 (28% and 29%, respectively), whereas the down-regulation of integrins {alpha}2 and {alpha}5 was less conspicuous (Fig. 4I).

HTOACD9– showed altered expression of junctional and cytoskeletal molecules. Because the morphologic differences between control-HTOA and HTOACD9– on ECM indicated that CD9 down-regulation might induce rearrangements of junctional and cytoskeletal molecules, stainings for tight junctional molecule ZO-1, and cytoskeletal molecules {alpha}-tubulin and F-actin (phalloidin) were done. In control-HTOA, ZO-1 accumulated at intercellular junction and showed membranous stainings (Fig. 5A). On the other hand, in HTOACD9–, intercellular localization of ZO-1 was significantly reduced and showed discontinuous stainings (Fig. 5B). {alpha}-Tubulin stainings in control-HTOA showed that this molecule was accumulated in perinuclear zone, and fine fibers of {alpha}-tubulin were also detected in the cytoplasm (Fig. 5C). In HTOACD9–, perinuclear stainings of {alpha}-tubulin were less conspicuous than those in HTOA, and the {alpha}-tubulin fibers were laid over the nuclei or accumulated unevenly in the cytoplasm (Fig. 5D). F-actin stainings in control-HTOA showed both intracellular stress fiber formation and fiber alignments at the membrane sites (Fig. 5E), whereas in HTOACD9–, stress fiber formation was markedly reduced and fiber alignments at the membrane sites were also inconspicuous (Fig. 5F).



View larger version (104K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Expression of ZO-1, {alpha}-tubulin, and F-actin in control-HTOA and HTOACD9– (stained in green with FITC-labeled tyramide; x1,000) A, in control-HTOA, ZO-1 accumulates at intercellular junction and shows membranous stainings. B, in HTOACD9–, intercellular localization of ZO-1 is significantly reduced and ZO-1 shows discontinuous stainings. C, control-HTOA shows the accumulation of {alpha}-tubulin in perinuclear zone, and fine fibers of {alpha}-tubulin are also detected in the cytoplasm. D, in HTOACD9–, perinuclear stainings of {alpha}-tubulin are inconspicuous, and the {alpha}-tubulin fibers are laid over nuclei or unevenly distributed in the cytoplasm. E, F-actin stainings in control-HTOA show both distinctive intracellular stress fibers and fiber alignments at the membrane sites. F, in HTOACD9–, stress fiber formation is markedly reduced and fiber alignments at the membrane sites are inconspicuous.

 
Establishment of highly peritoneal metastatic subclone HTOA-P. Down-regulation of CD9 has been reported as a poor prognostic factor in several types of human tumors including colon, lung, and ovarian carcinomas. Therefore, we established highly peritoneal metastatic subclone HTOA-P to investigate the possible involvement of CD9 in peritoneal dissemination. In vitro, the cell proliferation rate of HTOA-P was 1.48 ± 0.03, that was statistically higher than that of original HTOA, 0.44 ± 0.04 (P < 0.001; Fig. 6A). In vivo, HTOA-P generated multiple tumors (7.0 ± 1.2 tumors; range, 4-11 tumors per mouse) 1 to 3 mm in diameters in the peritoneal cavity within 10 to 12 weeks after inoculation (5 of 9 mice), whereas none of the mice inoculated HTOA (n = 6) formed tumors in 10 to 12 weeks. It took 24 to 26 weeks for three of eight mice inoculated with HTOA to form metastasis, 1 to 4 mm in diameter in the peritoneum (4.3 ± 0.9 tumors; range, 2-6 tumors per mouse). All mice inoculated with HTOA-P (n = 4) formed disseminative tumors (16 ± 5.8 tumors; range, 8-22 tumors per mouse), 2 to 17 mm in diameters (Fig. 6B). In H&E staining, HTOA nodules showed papillary structure (Fig. 6C) that resembled the original adenocarcinoma of the ovary (29). On the other hand, HTOA-P nodules showed in most parts medullary architecture surrounded by myxoid connective tissue (Fig. 6D). Mitosis was more frequently detected in HTOA-P, and the mitosis index was 16/10 high-power field (HPF) in HTOA-P, whereas 2/10 HPF in HTOA. Immunohistochemical stainings showed that Ki-67-positive cells were 4% in HTOA nodules, whereas 58% in HTOA-P nodules (Fig. 6A).



View larger version (61K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. Comparison between HTOA and highly disseminative subclone HTOA-P. A, proliferation assay in vitro shows that relative proliferation rate in HTOA-P is statistically higher than that in HTOA (**, P < 0.001). White column, HTOA; black column, HTOA-P. Immunohistochemical stainings in vivo for Ki-67 in HTOA (4% positivity) and HTOA-P (58% positivity). B, numbers of peritoneal tumors of sacrificed mice on 10 to 12 and 24 to 26 weeks. {circ}, average numbers of HTOA; and {bullet}, average numbers of HTOA-P. C, in H&E staining, HTOA nodule shows papillary structure that resembles human ovarian adenocarcinomas (x200). Inset, immunohistochemistry of CD9 in HTOA nodule. Tumor cells are positive for CD9 at cell membrane. D, HTOA-P nodule shows medullary architecture surrounded by myxoid connective tissue (x200). Inset, immunohistochemistry of CD9 in HTOA-P. Most of the tumor cells are negative for CD9. E, fluorescence cytostainings for CD9 in HTOA in vitro show strong membranous stainings (x400). Inset, merged image with DAPI. F, fluorescence cytostainings for CD9 in HTOA-P in vitro show weaker stainings than stainings in HTOA (x400). Inset, merged image with DAPI. G, HTOA cells are distributed as monolayer sheet on Matrigel in 24 hours. H, HTOA-P cells are scattered as small colonies on Matrigel resembling that of HTOACD9–.

 
Highly peritoneal metastatic subclone HTOA-P showed down-regulation of CD9. RT-PCR was done to compare the band intensity of CD9 between HTOA and HTOA-P. PCR products of CD9 were detected in both HTOA and HTOA-P, but the latter showed much weaker band than the former (data not shown). Real-time RT-PCR was done to confirm CD9 down-regulation in HTOA-P. The ratio of CD9 mRNA normalized by ß-actin between HTOA and HTOA-P was 1:0.06. Immunohistochemical stainings showed that CD9 protein was moderately to strongly stained at cell surface and cytoplasm in HTOA but very weak or negative in most of the HTOA-P nodules (Fig. 6C and D, insets). Fluorescence cytostainings in vitro supported the findings that CD9-positive cells in HTOA-P were significantly lower in number than those in HTOA (Fig. 6E and F). By time-lapse video monitoring, HTOA formed cobblestone structure in 24 hours on Matrigel (Fig. 6G), whereas HTOA-P formed diffuse spots that resembled those of HTOACD9– (Fig. 6H). The adhesion pattern of HTOA-P on laminin was also similar to that of HTOACD9– (data not shown), but on other types of matrix such as fibronectin and type I collagen, HTOA-P did not show significant difference from HTOA (data not shown).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Recent studies on tetraspanins have contributed to our understanding of the function of tetraspanins and the associated multimolecular complex in physiologic conditions (31–33). A fundamental role of tetraspanins is to organize other transmembrane proteins and form a network of microdomains, so called "tetraspanin web" (11, 15). Concerning down-regulation of CD9 in pathophysiologic conditions, a study using rodent models showed that lung metastasis was significantly suppressed in CD9-transfected melanoma cells (34). Antibody interference experiments in vitro showed that the antibodies against some tetraspanins including CD9 altered cell morphology and locomotion (26, 35, 36). In addition to the correlation between CD9 silencing and poor prognosis in various carcinomas (20–25), these experiments indicated that CD9 might work as a suppressor of tumor metastasis (34). However, the actual pathophysiologic effects induced by the down-regulation of CD9 in tumor cells and its significance in tumor progression have not been documented yet.

In the present study, it was shown that the down-regulation of CD9 altered adhesion pattern of tumor cells on ECM and attenuated the expression of several ß1 integrin subsets on tumor cell surface in vitro. Because CD9 forms complex with certain member of integrins depending on cell types, for example, with integrins {alpha}2ß1, {alpha}3ß1, and {alpha}6ß4 in keratinocytes (37), {alpha}3ß1 in colonic epithelium (21), and {alpha}6ß1 in endometrial cells (38), CD9 might be implicated in various pathophysiology that several integrins participate in. In this ovarian carcinoma cell, integrins {alpha}2, {alpha}3, {alpha}5, and {alpha}6 but not integrin {alpha}4 coexpressed with CD9 on cell surface simultaneously, and their expression was attenuated from 6% to 41% by CD9 silencing (Fig. 4G-I). The results indicate that CD9 may synchronize with these integrins either directly or indirectly in HTOA.

Each member of integrins is known to play important roles for the interaction with different types of ECM (17, 35). For example, laminin shows binding specificity to integrin {alpha}3ß1 and {alpha}6ß1 (39), whereas fibronectin works as a major ligand for integrin {alpha}5ß1. The cytoskeletal alteration and the attenuated adhesion to Matrigel, laminin, collagen, and to some extent to fibronectin observed in HTOACD9– might be consistent with the results of FACS and cytostainings that more than one integrins were affected by the down-regulation of CD9. In addition, HTOACD9– tended to form numerous colonies on Matrigel (Fig. 3A). Such diffuse spread of tumor colonies might resemble peritoneal dissemination in some respects. The process of tumor metastasis usually consists of several steps such as invasion into adjacent tissue, intravasation into circulation, and extravasation through capillary at distal organ. On the other hand, the process of peritoneal dissemination is still poorly understood. Some unique biological features other than invasion and intravasation might be required in terms of locomotion and architecture. Further investigation is necessary to understand the significance of such disseminative distribution of tumor cells induced by CD9 down-regulation.

Aggressive tumors generally show highly proliferative and invasive features compared with the tumors of low malignant potential. Contrary to the down-regulation of CD9 in several types of carcinomas in vivo, functional studies on CD9 in vitro have shown some other important roles of CD9. For example, CD9 was shown to increase the ability of HB-EGF/EGF receptor and contributed to the growth of myeloma cells (40). CD9 transfected fibrosarcoma cells induced significantly higher amounts of matrix metalloproteinase-2 secretion than original cells (26). These results suggest that CD9 might positively contribute to tumor proliferation and invasion under certain conditions. Indeed, in our preliminary experiments using transwell chamber, EGF-inducible cell migration was attenuated in HTOACD9– (data not shown). A recent study reported that CD9 was down-regulated in progressive cervical carcinomas but reexpressed at the sites of vascular space invasion, indicating tumor cells might use CD9 for cell migration and invasion into vasculature (41). Therefore, the down-regulation of CD9 might not necessarily work in favor of certain process of tumor progression such as invasion and proliferation but might contribute to the other feature of advanced tumors such as spread and dissemination in the peritoneal cavity. Because the interaction between tumor and ECM depends on microenvironments of both tumor and tissue sides in vivo, the paradoxical results that up-regulation of CD9 was detected in some types of malignancies and down-regulation of CD9 in the others could be explained, at least in part, by the specific process of tumor progression in different types of malignancies and in different sites of metastasis.

Highly metastatic subclone HTOA-P formed peritoneal metastasis faster and in much higher number than HTOA. Such disseminative feature of HTOA-P may be associated with several genetic alterations, in addition to the down-regulation of CD9. In our preliminary experiments using cDNA array, up-regulation and down-regulation of several genes were observed in HTOA-P that seem to be involved in proliferation, proteolysis, and antigen presentation. It was confirmed by proliferation assay and Ki-67 stainings that HTOA-P is more proliferative than HTOA (Fig. 6A), but possible contribution of CD9 to cell cycle remains unclear and there should be other important molecules than CD9 that facilitate tumor proliferation in vivo. At least, the down-regulation of CD9 in this highly metastatic subclone was consistent with the previous report that CD9 expression was inversely correlated with tumor stage in ovarian carcinomas (25). Histologically, the architecture in the majority of HTOA-P nodules in vivo showed medullary pattern (Fig. 6D). CD9 stainings were negative in these parts (Fig. 6D, inset), but some CD9-positive cells were seen in HTOA-P in the minority parts of papillary architecture (data not shown). CD9-positive cells were also detected in cultured HTOA-P in vitro, although the number of positive cells was lower than that of HTOA (Fig. 6F). Thus, the down-regulation of CD9 in HTOA-P might be due to the increased number of CD9-negative population that form medullary architecture with less adhesion to ECM. Further investigation is necessary to clarify whether CD9-negative tumor cells reexpress CD9 at the sites of invasion when they establish metastasis.

The present study indicated that the down-regulation of CD9 might contribute to tumor progression in terms of tumor spread and dissemination, and that the morphologic alteration induced by CD9 silencing may probably affect several ß1 integrin subsets. It is known that some tetraspanins other than CD9 also interact with these integrin members (21, 36). Among several tetraspanins, CD151 was shown to form more stable complex with integrin {alpha}3ß1 than CD63 or CD81 does in fibrosarcoma cells (42). In the present study, control-HTOA expressed CD151 but not CD63 and CD82. HTOACD9– also expressed CD151 in 85%, but not so highly as control-HTOA (96%). This decrease may be consistent with the previous findings that CD151 is associated with various integrins and other tetraspanins (15, 43). It is very likely that some of ß1 integrin subsets may also interact with CD151 and possibly with other tetraspanin members in HTOA, in addition to CD9. At present, it remains poorly understood whether the multiplex combinations of tetraspanins and integrins can induce different pathophysiologic effects, or whether certain tetraspanin web plays more important roles than others for similar effects. It is necessary to extend the studies on CD9 roles using stable CD9 knock down cells or CD9-low clones in vivo, which will contribute to our understanding on the significance of down-regulated CD9 in poor prognostic tumors. In addition to studies on CD9, similar studies on other members of tetraspanins in different types of tumors may provide us some important information. Further investigation should be required to clarify the contribution of tetraspanins to the entire course of tumor progression including peritoneal dissemination.


    Acknowledgments
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Dr. Y. Kasuya for expert help with the fluorescence microscopy and K. Nakase, T. Matsui, M. Tateyama, and C. Sudo for excellent technical assistance.

Received 8/30/04. Revised 1/ 4/05. Accepted 1/21/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Nakaguchi H, Fujimaki T, Matsuno A, et al. Postoperative residual tumor growth of meningioma can be predicted by MIB-1 immunohistochemistry. Cancer 1999;85:2249–54.[CrossRef][Medline]
  2. Kabashima A, Maehara Y, Kakeji Y, et al. Clinicopathological features and overexpression of matrix metalloproteinases in intramucosal gastric carcinoma with lymph node metastasis. Clin Cancer Res 2000;6:3581–4.[Abstract/Free Full Text]
  3. Rofstad EK, Halsor EF. Vascular endothelial growth factor, interleukin 8, platelet-derived endothelial cell growth factor, and basic fibroblast growth factor promote angiogenesis and metastasis in human melanoma xenografts. Cancer Res 2000;60:4932–8.[Abstract/Free Full Text]
  4. Takano Y, Kato Y, vanDiest PJ, et al. Cyclin D2 overexpression and lack of p27 correlate positively and cyclin E inversely with a poor prognosis in gastric cancer cases. Am J Pathol 2000;156:585–94.[Abstract/Free Full Text]
  5. Hanahan D, Folkman J. Patterns and emerging mechanisms of the angiogenic switch during tumorigenesis. Cell 1996;86:353–64.[CrossRef][Medline]
  6. Montgomery E, Abraham SC, Fisher C, et al. CD44 loss in gastric stromal tumors as a prognostic marker. Am J Surg Pathol 2004;28:168–77.[CrossRef][Medline]
  7. Bukholm IK, Nesland JM, Borresen Dale AL. Re-expression of E-cadherin, {alpha}-catenin and ß-catenin, but not of {gamma}-catenin, in metastatic tissue from breast cancer patients. J Pathol 2000;190:15–9.[CrossRef][Medline]
  8. Endo K, Ueda T, Ueyama J, et al. Immunoreactive E-cadherin, {alpha}-catenin, ß-catenin, {gamma}-catenin proteins in hepatocellular carcinoma. Hum Pathol 2000;31:558–65.[CrossRef][Medline]
  9. Schuppan D, Ocker M. Integrin-mediated control of cell growth. Hepatology 2003;38:289–91.[Medline]
  10. Malliri A, Collard JG. Role of Rho-family proteins in cell adhesion and cancer. Curr Opin Cell Biol 2003;15:583–9.[CrossRef][Medline]
  11. Stipp CS, Kolesnikova TV, Hemler ME. Functional domains in tetraspanin proteins. Trends Biochem Sci 2003;28:106–12.[CrossRef][Medline]
  12. Iwamoto R, Higashiyama S, Mitamura T, et al. Heparin-binding EGF-like growth factor, which acts as the diphtheria toxin receptor, forms a complex with membrane protein DRAP27/CD9, which up-regulates functional receptors and diphtheria toxin sensitivity. EMBO J 1994;13:2322–30.[Medline]
  13. Imai T, Kakizaki M, Nishimura M, et al. Molecular analyses of the association of CD4 with two members of the transmembrane 4 superfamily, CD81 and CD82. J Immunol 1995;155:1229–39.[Abstract]
  14. Matsumoto AK, Martin DR, Carter RH, et al. Functional dissection of the CD21/CD19/TAPA-1/Leu-13 complex of B lymphocytes. J Exp Med 1993;178:1407–17.[Abstract/Free Full Text]
  15. Berditchevski F. Complexes of tetraspanins with integrins: more than meets the eye. J Cell Sci 2001;114:4143–51.[Abstract/Free Full Text]
  16. Berditchevski F, Odintsova E. Characterization of integrin-tetraspanin adhesion complexes: role of tetraspanins in integrin signaling. J Cell Biol 1999;146:477–92.[Abstract/Free Full Text]
  17. Gutierrez-Lopez MD, Ovalle S, Yanez-Mo M, et al. A functionally relevant conformational epitope on the CD9 tetraspanin depends on the association with activated ß1 integrin. J Biol Chem 2003;278:208–18.[Abstract/Free Full Text]
  18. Longo N, Yanez-Mo M, Mittelbrunn M, et al. Regulatory role of tetraspanin CD9 in tumor-endothelial cell interaction during transendothelial invasion of melanoma cells. Blood 2001;98:3717–26.[Abstract/Free Full Text]
  19. Penas PF, Garcia-Diez A, Sanchez-Madrid F, et al. Tetraspanins are localized at motility-related structures and involved in normal human keratinocyte wound healing migration. J Invest Dermatol 2000;114:1126–35.[CrossRef][Medline]
  20. Miyake M, Nakano K, Ieki Y, et al. Motility-related protein 1 (MRP-1/CD9) expression: inverse correlation with metastases in breast cancer. Cancer Res 1995;55:4127–31.[Abstract/Free Full Text]
  21. Hashida H, Takabayashi A, Tokuhara T, et al. Integrin {alpha}3 expression as a prognostic factor in colon cancer: association with MRP-1/CD9 and KAI1/CD82. Int J Cancer 2002;97:518–25.[CrossRef][Medline]
  22. Higashiyama M, Doi O, Kodama K, et al. Immunohistochemically detected expression of motility-related protein-1 (MRP-1/CD9) in lung adenocarcinoma and its relation to prognosis. Int J Cancer 1997;74:205–11.[CrossRef][Medline]
  23. Funakoshi T, Tachibana I, Hoshida Y, et al. Expression of tetraspanins in human lung cancer cells: frequent downregulation of CD9 and its contribution to cell motility in small cell lung cancer. Oncogene 2003;22:674–87.[CrossRef][Medline]
  24. Uchida S, Shimada Y, Watanabe G, et al. Motility-related protein 1 (MRP-1/CD9) and KAI1/CD82 expression inversely correlate with lymph node metastases in esophageal squamous cell carcinoma. Br J Cancer 1999;79:1168–73.[CrossRef][Medline]
  25. Houle CD, Ding XY, Foley JF, et al. Loss of expression and altered localization of KAI1 and CD9 protein are associated with epithelial ovarian cancer progression. Gynecol Oncol 2002;86:69–78.[CrossRef][Medline]
  26. Sugiura T, Berditchevski F. Function of {alpha}3ß1-tetraspanin protein complexes in tumor cell invasion. Evidence for the role of the complexes in production of matrix metalloproteinase 2 (MMP-2). J Cell Biol 1999;146:1375–89.[Abstract/Free Full Text]
  27. Hori H, Yano S, Koufuji K, et al. CD9 expression in gastric cancer and its significance. J Surg Res 2004;117:208–15.[CrossRef][Medline]
  28. Kawashima M, Doh-ura K, Mekada E, et al. CD9 expression in solid non-neuroepithelial tumors and infiltrative astrocytic tumors. J Histochem Cytochem 2002;50:1195–203.[Abstract/Free Full Text]
  29. Ishiwata I, Ishiwata C, Soma M, et al. Characterization of newly established human ovarian carcinoma cell line. Gynecol Oncol 1987;26:340–54.[CrossRef][Medline]
  30. Kato H, Ishikura H, Kawarada Y, et al. Anti-angiogenic treatment for peritoneal dissemination of pancreas adenocarcinoma: a study using TNP-470. Jpn J Cancer Res 2001;92:67–73.[Medline]
  31. Hemler ME. Specific tetraspanin functions. J Cell Biol 2001;155:1103–7.[Abstract/Free Full Text]
  32. Maecker HT, Todd SC, Levy S. The tetraspanin superfamily: molecular facilitators. FASEB J 1997;11:428–42.[Abstract]
  33. Boucheix C, Rubinstein E. Tetraspanins. Cell Mol Life Sci 2001;58:1189–205.[CrossRef][Medline]
  34. Ikeyama S, Koyama M, Yamaoko M, et al. Suppression of cell motility and metastasis by transfection with human motility-related protein (MRP-1/CD9) DNA. J Exp Med 1993;177:1231–7.[Abstract/Free Full Text]
  35. Zhang XA, Kazarov AR, Yang X, et al. Function of the tetraspanin CD151-{alpha}6ß1 integrin complex during cellular morphogenesis. Mol Biol Cell 2002;13:1–11.
  36. Sordat I, Decraene C, Silvestre T, et al. Complementary DNA arrays identify CD63 tetraspanin and {alpha}3 integrin chain as differentially expressed in low and high metastatic human colon carcinoma cells. Lab Invest 2002;82:1715–24.[Medline]
  37. Jones PH, Bishop LA, Watt FM. Functional significance of CD9 association with ß1 integrins in human epidermal keratinocytes. Cell Adhes Commun 1996;4:297–305.[Medline]
  38. Park KR, Inoue T, Ueda M, et al. CD9 is expressed on human endometrial epithelial cells in association with integrins {alpha}(6), {alpha}(3) and ß(1). Mol Hum Reprod 2000;6:252–7.[Abstract/Free Full Text]
  39. Kikkawa Y, Sanzen N, Fujiwara H, et al. Integrin binding specificity of laminin-10/11: laminin-10/11 are recognized by {alpha}3ß1, {alpha}6ß1 and {alpha}6ß 4 integrins. J Cell Sci 2000;113:869–76.[Abstract]
  40. Wang YD, De Vos J, Jourdan M, et al. Cooperation between heparin-binding EGF-like growth factor and interleukin-6 in promoting the growth of human myeloma cells. Oncogene 2002;21:2584–92.[CrossRef][Medline]
  41. Sauer G, Windisch J, Kurzeder C, et al. Progression of cervical carcinomas is associated with down-regulation of CD9 but strong local re-expression at sites of transendothelial invasion. Clin Cancer Res 2003;9:6426–31.[Abstract/Free Full Text]
  42. Yauch RL, Berditchevski F, Harler MB, et al. Highly stoichiometric, stable, and specific association of integrin {alpha}3ß1 with CD151 provides a major link to phosphatidylinositol 4-kinase, and may regulate cell migration. Mol Biol Cell 1998;9:2751–65.[Abstract/Free Full Text]
  43. Sawada S, Yoshimoto M, Odintsova E, et al. The tetraspanin CD151 functions as a negative regulator in the adhesion-dependent activation of Ras. J Biol Chem 2003;278:26323–6.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
Y. Kikuchi, T. Takai, T. Kuhara, M. Ota, T. Kato, H. Hatanaka, S. Ichikawa, T. Tokura, H. Akiba, K. Mitsuishi, et al.
Crucial Commitment of Proteolytic Activity of a Purified Recombinant Major House Dust Mite Allergen Der p1 to Sensitization toward IgE and IgG Responses
J. Immunol., August 1, 2006; 177(3): 1609 - 1617.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Gesierich, I. Berezovskiy, E. Ryschich, and M. Zoller
Systemic Induction of the Angiogenesis Switch by the Tetraspanin D6.1A/CO-029.
Cancer Res., July 15, 2006; 66(14): 7083 - 7094.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Furuya, M.
Right arrow Articles by Ishikura, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Furuya, M.
Right arrow Articles by Ishikura, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online