| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology, Pathobiology, and Genetics |
1 Department of Molecular Pathology, Chiba University Graduate School of Medicine, Chiba, Japan; 2 Department of Pathophysiology, Hokkaido University Graduate School of Medicine, Sapporo, Japan; 3 Genetic Lab, Co., Ltd., Sapporo, Japan; and 4 Ishiwata Obstetrics and Gynecology Hospital, Mito, Japan
Requests for reprints: Mitsuko Furuya, Department of Molecular Pathology, Chiba University Graduate School of Medicine, Inohana 1-8-1, Chuo-ku, Chiba 260-8670, Japan. Phone: 81-43-226-2062; Fax: 81-43-226-2063; E-mail: furuya{at}faculty.chiba-u.jp.
| Abstract |
|---|
|
|
|---|
2,
3ß1,
5, and
6 were lower in HTOACD9 than those of control-HTOA. HTOACD9 showed altered expression of junctional and cytoskeletal molecules. By time-lapse video microscopy, control-HTOA showed solid adhesion to extracellular matrix and formed cobblestone pattern, whereas HTOACD9 showed weaker adhesion and were distributed as diffuse spots. To examine whether the expression level of CD9 change during tumor dissemination, HTOA-P, a highly disseminative subclone of HTOA, was established. HTOA-P showed distinctive down-regulation of CD9 at mRNA and protein levels, and showed similar morphologic alteration as HTOACD9 did. These findings indicate that the down-regulation of CD9 may be an acquired event in the process of tumor dissemination. Down-regulated CD9 may attenuate the expression of several integrins and rearrange junctional and cytoskeletal molecules that might contribute to dissemination of ovarian carcinomas.
Key Words: ovarian carcinoma peritoneal dissemination CD9 tetraspanin siRNA
| Introduction |
|---|
|
|
|---|
Tetraspanins have been identified as a superfamily of transmembrane protein, and to date, >30 members have been reported (11). It is known that many types of cells simultaneously express more than one member of tetraspanins that form complex with other transmembrane proteins. The current view of the function of tetraspanins is that they organize the cell surface proteins such as heparin-binding epidermal growth factor (EGF)like growth factor (HB-EGF) on epithelial cells (12), CD4 and CD8 on T cells (13), CD21-19 complex on B cells (14), and integrin family on different cell types (15), and they may regulate cell motility, signaling, and other unknown functions (1115).
CD9 is a member of tetraspanins and is expressed in plasma membrane of various cell types, including hematopoietic cells, endothelial cells, normal epithelial cells, and several tumor cell lines (1519). With regard to disease process, it was reported that the down-regulation of CD9 is correlated with poor prognosis in several human malignancies such as colon, lung, head and neck, breast, and ovarian carcinomas (2025). On the other hand, in vitro experiments have shown that CD9 plays important roles for the process of invasion in some tumor cells (26), and up-regulation of CD9 in vivo was documented in aggressive gastric carcinomas (27) and high-grade astrocytic tumors (28).
We investigated the possible contribution of CD9 to the process of peritoneal dissemination in ovarian carcinomas. Peritoneal dissemination is the most common feature of advanced ovarian carcinomas that leads to poor prognosis. CD9 is highly expressed in HTOA, an ovarian carcinoma cell line. CD9-negative HTOA cells (HTOACD9) were purified using small interfering RNA (siRNA) and magnetic cell sorting (MACS). Purified HTOACD9 cells showed morphologic alteration on ECM and attenuated expression of several ß1 integrin subsets. To investigate the possible association of the down-regulated CD9 with tumor dissemination, we established a highly disseminative subclone of HTOA, HTOA-P. HTOA-P showed distinctive down-regulation of CD9 and showed the similar morphologic patterns on ECM to those were shown in HTOACD9.
| Materials and Methods |
|---|
|
|
|---|
Ovarian carcinoma, HTOA, cell culture. Human ovarian adenocarcinoma cell line HTOA (29) was obtained from Riken cell bank (Tsukuba, Japan). The cells were maintained in Ham F-12 medium, supplemented with 10% FCS, 1% penicillin, and streptomycin at 37°C in 5% CO2.
Small interfering RNA transfection. HTOA cells were trypsinized and replaced into 10-cm dishes, at density of 1 x 106 cells per dish. After 24 hours, the cells were transfected with siRNA using RNAiFect Reagent (Qiagen, Hilden, Germany) according to the manufacturer's instructions. The 21nt siRNA directed against CD9 was 5'-UUCUUGCUCGAAGAUGCUCTT-3'. The concentration of siRNA was 10 µg/5 mL per dish. Control siRNA (nonsilencing) was purchased from Qiagen. As another siRNA control, LaminA/C silencer (Qiagen) was used. LaminA/C has not been reported to interact with CD9 or other tetraspanins. Transient transfection assay was as recommended by the manufacturer. The efficiency of siRNA transfection was checked by fluorescence microscopy in each experiment using FITC-labeled siRNA. Transfected cells were harvested for analysis at 24, 48, and 72 hours, respectively, as described in detail in Results. To obtain higher purity of CD9-negative cells (HTOACD9), transfected cells were harvested in 48 hours and CD9-positive cells were depleted by MACS LD column (Miltenyi Biotec, Bergisch Gladbach, Germany).
Establishment of a highly peritoneal metastatic subclone, HTOA-P. A highly peritoneal metastatic subclone was established thrice of peritoneal inoculation of HTOA in vivo, using the same method described before (30). HTOA (1 x 107) in 1 mL of PBS were inoculated into the peritoneal cavity of BALB/C nude mice (n = 14). The mice were sacrificed after 6, 10 to 12, and 24 to 26 weeks after tumor cell inoculation. Whereas no tumor nodules were observed in mice sacrificed at 6 and 10 to 12 weeks, tumor nodules were seen in mice sacrificed at 24 to 26 weeks after tumor cell inoculations. Tumor cells were cultivated from these nodules, dispersed and suspended in Ham F-12 medium, supplemented with 10% FCS and 1% penicillin and streptomycin at 37°C in 5% CO2. These cells, 1 x 107 in 1 mL of PBS, were then inoculated i.p., and a similar procedure was repeated thrice and the established subclone was named HTOA-P. HTOA-P showed highly disseminative phenotype in vivo, as described in Results.
Reverse transcription-PCR and real-time reverse transcription-PCR. Expression of tetraspanins CD9, CD63, CD82, and CD151 were examined by reverse transcription-PCR (RT-PCR) with the following primers: 84 (forward) TTCGGCCCAGGCTAAGTTAG and 184 (reverse) CGGCAA- GCCAGAAGATGAAG for human CD9, 544 (forward) TTGGGAGAAAATCCCTTCCA and 644 (reverse) GGATCGCCTTCTCGTTGAAA for human CD63, 590 (forward) CAGGAT- GCCTGGGACTACGT and 691 (reverse) GACCTCAGGGCGATTCATGA for human CD82, and 306 (forward) GCTGGAGATCATCGCTGGTATC and 406 (reverse) GGTGGTAG-CGCCTGGTCAT for human CD151, and 212 (forward) CCACCCATGGCAAATTCC and 280 (reverse) TGATGGGATTTCCATTGATGAC for human glyceraldehyde-3-phosphate dehydrogenase, 1065 (forward) CTCCTCCTGAGCGCAAGTACTC and 1155 (reverse) TCCTGCTTGCTGATCCAC-ATC for human ß-actin. RT-PCR amplification was done using AmpliTaq Gold PCR Master Mix (PE Applied Biosystems, Foster City, CA) and PCR thermocycler (PE 9700, Applied Biosystems). Conditions for PCR were as follows; at 95°C for 5 minutes, 28 cycles at 95°C for 15 seconds, 58°C for 15 seconds, 72°C for 1 minute, with an extension step of 7 minutes at 72°C at the end of the last cycle.
For real-time RT-PCR, QuantiTect SYBR Green PCR kit (Qiagen) and PCR amplifications in ABI-PE Prism 7000 sequence detection system (Applied Biosystems) were used according to the protocol provided by the manufacturer. Conditions for PCR included at 50°C for 2 minutes, at 95°C for 15 minutes, and 40 cycles of 95°C for 30 seconds and 60°C for 30 seconds. mRNA levels were expressed as the absolute number of copies normalized against ß-actin mRNA.
Fluorescence cytostaining. Cells (5 x 104) were placed onto four-chamber slides (Nunc Lab-Tek, Naperville, IL). After 24 hours, chamber slides were washed with PBS and stained with mouse monoclonal antibodies (mAb) CD9, integrins
3ß1,
6, ß1 (DakoCytomation, Carpinteria, CA),
2 and
5 (BD Biosciences, San Diego, CA), ZO-1 (Zymed, South San Francisco, CA), filamentous actin (F-actin), and
-tubulin (Invitrogen, San Diego, CA) using TSA kit (Invitrogen) according to the manufacturer's instructions. All the results were obtained from at least three independent experiments.
Flow cytometry. Cell suspensions were stained with CD9 and Integrins listed above, followed by FITC-conjugated goat anti-mouse Immunoglobrins (ICN Pharmaceuticals, Aurora, OH). The expression of other tetraspanins CD63 (Novocastra, Newcastle upon Tyne, United Kingdom), CD82 (Santa Cruz Biotechnology, Santa Cruz, CA), and CD151 (BD Biosciences), and an epithelial marker EMA (DakoCytomation) were also examined in control-HTOA and HTOACD9 to check the target specificity of siRNA. Cells were analyzed on a FACScan (Becton Dickinson, Mountain View, CA) and rates of positive cells were quantified using CELLQest software 2.1.1 (Becton Dickinson). All the results were obtained from at least three independent experiments.
Cell proliferation assay. Cells were cultured for 72 hours in 96-well flat-bottomed microtiter plates at 2.5 x 103 cells per well in 1% FCS medium. Viable cells were counted by absorbance measurements at 450 nm (A450 nm) at 6 to 72 hours using Cell Counting Kit-8 (Dojindo, Kumamoto, Japan). Relative growth was calculated as [A (72 hours) A (6 hours) / A (6 hours)].
Western blot analysis. Fifty micrograms of proteins were electrophoresed on 12.5% SDS-PAGE and transferred to a polyvinylidene difluoride membrane (Nihon Eido, Tokyo, Japan). The blots were probed with mouse mAbs against CD9 (Santa Cruz Biotechnology, 1:200) and ß-actin (Sigma, St. Louis, MO, 1:5,000), and successively incubated with horseradish peroxidase- conjugated goat anti-mouse antibody (Santa Cruz Biotechnology, 1:2,500). Can Get Signal (Toyobo, Osaka, Japan) was used to obtain specific bands. Incubation protocol was as recommended by the manufacturer. Bands were detected using an enhanced chemiluminescence system, according to the Hybond enhanced chemiluminescence protocol (Amersham, Arlington Heights, IL).
In vitro morphogenesis assay. Matrigel (BD Biosciences) was placed on 24-well plates (300 µL per well) and allowed to solidify at 37°C for 30 minutes. Other wells were coated with 2 µg/cm2 of laminin, fibronectin (Sigma), or 10% type I collagen (Serva, Heidelberg, Germany). Cells (5 x 104) were cultured in each well at 37°C with 5% CO2 in Opti-MEM medium (Life Technologies, Gaithersburg, MD). Time-lapse morphologic analysis was done for 24 hours using CCD camera VB-7000 (Keyence, Osaka, Japan). Control-HTOA formed cellular network that connected each colony in 4 to 12 hours on all types of ECM but most distinctively on laminin. Therefore, after incubation on laminin for 8 hours, the number of cellular network was counted from 12 independent fields. In 24 hours, cells showed flat sheet distribution on laminin, fibronectin, and type I collagen. On Matrigel, cells were distributed as hemispherical or cobblestone-pattern colonies. After incubation on Matrigel for 24 hours, the number of colonies was counted from 12 independent fields. All the results were obtained from at least three independent experiments.
Histologic examination. Histology and immunohistochemistry of peritoneal implants of HTOA and HTOA-P were examined. The specimens were fixed in 10% formalin and paraffin embedded. H&E staining was done. Immunohistochemical stainings for CD9 and Ki-67 (DakoCytomation) were done using labeled streptoavidin-biotin-peroxidase and microwave antigen retrieval technique.
Statistical analysis. Values were expressed as the mean ± SE. Mann-Whitney U test was used for statistical evaluation. Statistical significance was assumed when P < 0.05 was obtained.
| Results |
|---|
|
|
|---|
|
|
|
Cell adhesion patterns on fibronectin and type I collagen in control-HTOA were almost similar to that on laminin, and the cell showed close contact with each other and formed flat distribution (data not shown). HTOACD9 cells were less adhesive on type I collagen. HTOACD9 also showed attenuated adhesion pattern on fibronectin, but the pattern was less conspicuous than those on laminin and type I collagen (data not shown).
Reduced expression of integrins ß1,
2,
3ß1,
5, and
6 in HTOACD9. Matrigel and laminin are major ligands for ß1 integrin superfamily; therefore, we examined whether the expression of integrins were altered in HTOACD9. Fluorescence double stainings showed that integrins ß1,
2,
3ß1,
5, and
6 expressed at cell membrane of control-HTOA that were colocalized with CD9 (Fig 4A-C). Integrin ß1 was stained at both cell membrane and paranuclear cytoplasm. On the other hands, stainings of these integrins at cell membrane was less prominent in many HTOACD9cells, and some HTOACD9 cells were not stained for these integrins (Fig. 4D-F). Integrin
4 was detected neither in HTOA nor HTOACD9, and the absence of integrin
4 was confirmed by RT-PCR (data not shown).
|
2,
3ß1,
5, and
6 on cell surface was decreased in HTOACD9 (Fig. 4G and H). By quantification of FACS data, the expression of integrin
3ß1 was most significantly reduced (41%), followed by those of integrins ß1 and
6 (28% and 29%, respectively), whereas the down-regulation of integrins
2 and
5 was less conspicuous (Fig. 4I).
HTOACD9 showed altered expression of junctional and cytoskeletal molecules. Because the morphologic differences between control-HTOA and HTOACD9 on ECM indicated that CD9 down-regulation might induce rearrangements of junctional and cytoskeletal molecules, stainings for tight junctional molecule ZO-1, and cytoskeletal molecules
-tubulin and F-actin (phalloidin) were done. In control-HTOA, ZO-1 accumulated at intercellular junction and showed membranous stainings (Fig. 5A). On the other hand, in HTOACD9, intercellular localization of ZO-1 was significantly reduced and showed discontinuous stainings (Fig. 5B).
-Tubulin stainings in control-HTOA showed that this molecule was accumulated in perinuclear zone, and fine fibers of
-tubulin were also detected in the cytoplasm (Fig. 5C). In HTOACD9, perinuclear stainings of
-tubulin were less conspicuous than those in HTOA, and the
-tubulin fibers were laid over the nuclei or accumulated unevenly in the cytoplasm (Fig. 5D). F-actin stainings in control-HTOA showed both intracellular stress fiber formation and fiber alignments at the membrane sites (Fig. 5E), whereas in HTOACD9, stress fiber formation was markedly reduced and fiber alignments at the membrane sites were also inconspicuous (Fig. 5F).
|
|
| Discussion |
|---|
|
|
|---|
In the present study, it was shown that the down-regulation of CD9 altered adhesion pattern of tumor cells on ECM and attenuated the expression of several ß1 integrin subsets on tumor cell surface in vitro. Because CD9 forms complex with certain member of integrins depending on cell types, for example, with integrins
2ß1,
3ß1, and
6ß4 in keratinocytes (37),
3ß1 in colonic epithelium (21), and
6ß1 in endometrial cells (38), CD9 might be implicated in various pathophysiology that several integrins participate in. In this ovarian carcinoma cell, integrins
2,
3,
5, and
6 but not integrin
4 coexpressed with CD9 on cell surface simultaneously, and their expression was attenuated from 6% to 41% by CD9 silencing (Fig. 4G-I). The results indicate that CD9 may synchronize with these integrins either directly or indirectly in HTOA.
Each member of integrins is known to play important roles for the interaction with different types of ECM (17, 35). For example, laminin shows binding specificity to integrin
3ß1 and
6ß1 (39), whereas fibronectin works as a major ligand for integrin
5ß1. The cytoskeletal alteration and the attenuated adhesion to Matrigel, laminin, collagen, and to some extent to fibronectin observed in HTOACD9 might be consistent with the results of FACS and cytostainings that more than one integrins were affected by the down-regulation of CD9. In addition, HTOACD9 tended to form numerous colonies on Matrigel (Fig. 3A). Such diffuse spread of tumor colonies might resemble peritoneal dissemination in some respects. The process of tumor metastasis usually consists of several steps such as invasion into adjacent tissue, intravasation into circulation, and extravasation through capillary at distal organ. On the other hand, the process of peritoneal dissemination is still poorly understood. Some unique biological features other than invasion and intravasation might be required in terms of locomotion and architecture. Further investigation is necessary to understand the significance of such disseminative distribution of tumor cells induced by CD9 down-regulation.
Aggressive tumors generally show highly proliferative and invasive features compared with the tumors of low malignant potential. Contrary to the down-regulation of CD9 in several types of carcinomas in vivo, functional studies on CD9 in vitro have shown some other important roles of CD9. For example, CD9 was shown to increase the ability of HB-EGF/EGF receptor and contributed to the growth of myeloma cells (40). CD9 transfected fibrosarcoma cells induced significantly higher amounts of matrix metalloproteinase-2 secretion than original cells (26). These results suggest that CD9 might positively contribute to tumor proliferation and invasion under certain conditions. Indeed, in our preliminary experiments using transwell chamber, EGF-inducible cell migration was attenuated in HTOACD9 (data not shown). A recent study reported that CD9 was down-regulated in progressive cervical carcinomas but reexpressed at the sites of vascular space invasion, indicating tumor cells might use CD9 for cell migration and invasion into vasculature (41). Therefore, the down-regulation of CD9 might not necessarily work in favor of certain process of tumor progression such as invasion and proliferation but might contribute to the other feature of advanced tumors such as spread and dissemination in the peritoneal cavity. Because the interaction between tumor and ECM depends on microenvironments of both tumor and tissue sides in vivo, the paradoxical results that up-regulation of CD9 was detected in some types of malignancies and down-regulation of CD9 in the others could be explained, at least in part, by the specific process of tumor progression in different types of malignancies and in different sites of metastasis.
Highly metastatic subclone HTOA-P formed peritoneal metastasis faster and in much higher number than HTOA. Such disseminative feature of HTOA-P may be associated with several genetic alterations, in addition to the down-regulation of CD9. In our preliminary experiments using cDNA array, up-regulation and down-regulation of several genes were observed in HTOA-P that seem to be involved in proliferation, proteolysis, and antigen presentation. It was confirmed by proliferation assay and Ki-67 stainings that HTOA-P is more proliferative than HTOA (Fig. 6A), but possible contribution of CD9 to cell cycle remains unclear and there should be other important molecules than CD9 that facilitate tumor proliferation in vivo. At least, the down-regulation of CD9 in this highly metastatic subclone was consistent with the previous report that CD9 expression was inversely correlated with tumor stage in ovarian carcinomas (25). Histologically, the architecture in the majority of HTOA-P nodules in vivo showed medullary pattern (Fig. 6D). CD9 stainings were negative in these parts (Fig. 6D, inset), but some CD9-positive cells were seen in HTOA-P in the minority parts of papillary architecture (data not shown). CD9-positive cells were also detected in cultured HTOA-P in vitro, although the number of positive cells was lower than that of HTOA (Fig. 6F). Thus, the down-regulation of CD9 in HTOA-P might be due to the increased number of CD9-negative population that form medullary architecture with less adhesion to ECM. Further investigation is necessary to clarify whether CD9-negative tumor cells reexpress CD9 at the sites of invasion when they establish metastasis.
The present study indicated that the down-regulation of CD9 might contribute to tumor progression in terms of tumor spread and dissemination, and that the morphologic alteration induced by CD9 silencing may probably affect several ß1 integrin subsets. It is known that some tetraspanins other than CD9 also interact with these integrin members (21, 36). Among several tetraspanins, CD151 was shown to form more stable complex with integrin
3ß1 than CD63 or CD81 does in fibrosarcoma cells (42). In the present study, control-HTOA expressed CD151 but not CD63 and CD82. HTOACD9 also expressed CD151 in 85%, but not so highly as control-HTOA (96%). This decrease may be consistent with the previous findings that CD151 is associated with various integrins and other tetraspanins (15, 43). It is very likely that some of ß1 integrin subsets may also interact with CD151 and possibly with other tetraspanin members in HTOA, in addition to CD9. At present, it remains poorly understood whether the multiplex combinations of tetraspanins and integrins can induce different pathophysiologic effects, or whether certain tetraspanin web plays more important roles than others for similar effects. It is necessary to extend the studies on CD9 roles using stable CD9 knock down cells or CD9-low clones in vivo, which will contribute to our understanding on the significance of down-regulated CD9 in poor prognostic tumors. In addition to studies on CD9, similar studies on other members of tetraspanins in different types of tumors may provide us some important information. Further investigation should be required to clarify the contribution of tetraspanins to the entire course of tumor progression including peritoneal dissemination.
| Acknowledgments |
|---|
We thank Dr. Y. Kasuya for expert help with the fluorescence microscopy and K. Nakase, T. Matsui, M. Tateyama, and C. Sudo for excellent technical assistance.
Received 8/30/04. Revised 1/ 4/05. Accepted 1/21/05.
| References |
|---|
|
|
|---|
-catenin and ß-catenin, but not of
-catenin, in metastatic tissue from breast cancer patients. J Pathol 2000;190:159.[CrossRef][Medline]
-catenin, ß-catenin,
-catenin proteins in hepatocellular carcinoma. Hum Pathol 2000;31:55865.[CrossRef][Medline]
3 expression as a prognostic factor in colon cancer: association with MRP-1/CD9 and KAI1/CD82. Int J Cancer 2002;97:51825.[CrossRef][Medline]
3ß1-tetraspanin protein complexes in tumor cell invasion. Evidence for the role of the complexes in production of matrix metalloproteinase 2 (MMP-2). J Cell Biol 1999;146:137589.
6ß1 integrin complex during cellular morphogenesis. Mol Biol Cell 2002;13:111.
3 integrin chain as differentially expressed in low and high metastatic human colon carcinoma cells. Lab Invest 2002;82:171524.[Medline]
(6),
(3) and ß(1). Mol Hum Reprod 2000;6:2527.
3ß1,
6ß1 and
6ß 4 integrins. J Cell Sci 2000;113:86976.[Abstract]
3ß1 with CD151 provides a major link to phosphatidylinositol 4-kinase, and may regulate cell migration. Mol Biol Cell 1998;9:275165.This article has been cited by other articles:
![]() |
Y. Kikuchi, T. Takai, T. Kuhara, M. Ota, T. Kato, H. Hatanaka, S. Ichikawa, T. Tokura, H. Akiba, K. Mitsuishi, et al. Crucial Commitment of Proteolytic Activity of a Purified Recombinant Major House Dust Mite Allergen Der p1 to Sensitization toward IgE and IgG Responses J. Immunol., August 1, 2006; 177(3): 1609 - 1617. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Gesierich, I. Berezovskiy, E. Ryschich, and M. Zoller Systemic Induction of the Angiogenesis Switch by the Tetraspanin D6.1A/CO-029. Cancer Res., July 15, 2006; 66(14): 7083 - 7094. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |