This Article Abstract Full Text (PDF) Supplementary Data Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Guan, R. Articles by Luo, Y. Search for Related Content PubMed PubMed Citation Articles by Guan, R. Articles by Luo, Y.

Small Interfering RNA–Mediated Polo-Like Kinase 1 Depletion Preferentially Reduces the Survival of p53-Defective, Oncogenic Transformed Cells and Inhibits Tumor Growth in Animals

Departments ¹ R47S and ² R47J, Cancer Research, Abbott Laboratories, Abbott Park, Illinois

Requests for reprints: Yan Luo, Department R47S, Cancer Research, Abbott Laboratories, 100 Abbott Park Road, AP9A, Abbott Park, IL 60064. Phone: 847-935-6811; Fax: 847-938-2365; E-mail: yan.luo{at}abbott.com.

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Polo-like kinase 1 (Plk1) is required for multiple stages of mitosis and is up-regulated in many human malignancies. We depleted Plk1 expression using small interfering RNA (siRNA) and showed defects in bipolar spindle formation and cytokinesis, growth inhibition, and apoptosis induction in human cancer cell lines. To our surprise, depletion of Plk1 in normal human cells did not result in obvious cell cycle defects, and did not induce significant inhibition of cell growth for at least two cell cycles. In addition, Plk1 siRNA inhibited colony formation in soft agar and tumorigenesis in a HT1080 xenograft model in a dose-dependent manner. Analysis with isogenic pairs of cell lines, differing in p53 status, revealed that Plk1 depletion preferentially induced mitotic arrest, aneuploidy, and reduced cell survival in the p53-defective cell lines. No obvious defects were observed in most p53 wild-type cells during the first few cell cycles. In addition, long-term survival studies revealed that p53 facilitates survival upon Plk1 depletion. Therefore, short-term inhibition of Plk1 can kill tumor cells while allowing normal cells to survive. These data validate the episodic inhibition of Plk1 as a very useful approach for cancer treatment.

Key Words: Plk1 • siRNA • mitosis • p53 • cancer

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Polo-like kinase 1 (Plk1) is a serine/threonine kinase that functions to regulate many stages of mitosis (1). Activation of the cyclin B/Cdc2 complex triggers entry into mitosis. Plk1 phosphorylates and activates the Cdc25C phosphatase (2–4), which reverses the inhibitory phosphorylation of Cdc2. Additionally, Plk1 phosphorylates cyclin B during prophase (5, 6) and, later in mitosis, facilitates its degradation and progression into cytokinesis. Plk1 is required for centrosome maturation, bipolar spindle formation, and chromosomal segregation, and is associated with microtubules and centrosomes at various stages of mitosis (1, 7–10). Microinjection of Plk1-neutralizing antibody results in monoastral arrays, leading to chromosome missegregation (8). Plk1 also regulates cytokinesis (11–14) and has been shown to localize to the midbody of the cleavage furrow (15). Furthermore, Plk1 responds to DNA damage checkpoints (16–21).

Plk1 is overexpressed in a variety of human malignancies (22–26), and its expression levels are often a prognostic factor for disease progression (27–30). In addition, the overexpression of Plk1 in NIH3T3 cells can transform cells and induce tumors in nude mice (31). Blocking Plk1 expression or function has been shown to induce cytotoxicity in cancer cells (32–37). However, potential toxicity in normal tissues poses a significant risk for Plk1 inhibitors as cancer therapeutics. Overexpression of Plk1 in human malignancies indicates that tumor cells may depend on higher Plk1 levels for their growth and survival. Therefore, it is conceivable that Plk1 inhibition could confer specific cytotoxicity to tumor cells. By depleting Plk1 with small interfering RNA (siRNA) in human tumor cells, we have shown a critical role for Plk1 in tumor cell survival. Plk1 siRNA also dramatically delayed tumor growth in severe combined immunodeficient (SCID) mice. In contrast, normal human cells survived Plk1 depletion very well without apparent defects during the first few cycles. In addition, we identified p53 as one factor contributing to the differential cytotoxicity. These data provide critical evidence that episodic Plk1 inhibition could confer specific cytotoxicity toward tumor cells.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Cell lines. All cell lines, except 184B5-E6, were purchased from the American Type Culture Collection (Manassas, VA). 184B5-E6 was a generous gift from Dr. J. Gudas (National Cancer Institute).

Small interfering RNA sequences. Plk1 siRNAs were purchased from Dharmacon Research, Inc. (Lafayette, CO): Plk1-Si1 (AACCAGUGGUUCGAGAGACAG) and Plk1 Si1C (AACCAGUUUGGCGAGAGACAG). The selection of these sequences was based on the sequence of the best Plk1 AS oligo isis121969 (GAACCAGUGGUUCGAGAGACA) obtained from ISIS Pharmaceuticals (Carlsbad, CA; data not shown).

Transfection. siRNA was transfected using LipofectAMINE 2000 (LF2000) from Invitrogen (Carlsbad, CA) according to the manufacturer's instructions.

Western blotting. Transfected cells were harvested and lysed in insect cell lysis buffer [10 mmol/L Tris (pH 7.5), 130 mmol/L NaCl, 1% Triton X-100, 10 mmol/L NaF, 10 mmol/L NaPi, 10 mmol/L NaPPi] supplemented with 50x protease inhibitor cocktail (BD PharMingen, Bedford, MA) and 1 µmol/L microcystin LR (Sigma Chemical Co., St. Louis, MO). Immunoblotting was done with anti-Plk1 antibody from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). A nonspecific band recognized by Plk1 antibody or actin was used as the loading control.

Bipolar spindle morphology assay. Cells were washed with PBS and fixed with 50% methanol/50% acetone for 2 minutes at room temperature. After washing with PBS, the cells were blocked with PBS containing 3% bovine serum albumin at room temperature for 20 minutes. The cells were then stained with FITC-labeled anti--tubulin antibody (Sigma) and mounted on slides with Cytofluor containing 4',6-diamidino-2-phenylindole (Ted Pella, Inc., Redding, CA).

AlamarBlue assay. AlamarBlue assays were carried out as per the manufacturer's instructions (Biosource International, Inc., Camarillo, CA). Analysis was done using a fmax Fluorescence Microplate Reader (Molecular Devices, Sunnyvale, CA), set at the excitation wavelength of 544 nm and emission wavelength of 595 nm. Data was analyzed using SOFTmax PRO software. Each data point is the average of six values. Error bars represent the SD.

Statistical analysis. Pairwise, two-tailed, unequal variance Student's t test was done to assess the difference between the effect of Si1 and Si1C. Asterisks indicate a significant difference with P < 0.01 in 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide and P < 0.05 in clonogenic assay. P values are listed in Supplementary Fig. 4.

Xenograft model. HT1080 human fibrosarcoma cells were transfected with Plk1 siRNA Si1 or Si1C. At 24 hours post-transfection, live cells were harvested and mixed with an equal volume of Matrigel (Collaborative Biomedical Products, Bedford, MA). Cells (0.5 million) were inoculated into the flank of SCID-Beige mice (Charles River Laboratories, Wilmington, MA, USA). Tumor volume was measured twice weekly with digital calipers. Tumor volume was estimated using the formula: V = L x W² / 2. Each treatment group contained 12 mice.

Caspase assay. Caspase assays were carried out as previously described (38). Each data point is the average of three values. Error bars represent the SD.

Clonogenic assay. Cells were plated at 1,000 cells per dish at 24 hours post-transfection and incubated for 10 to 14 days at 37°C. Colonies were quantified with Image-Pro Plus (Media Cybernetics, Silver Spring, MD) after fixing with 100% methanol and stained with 5% Giemsa stain (Sigma). Each data point is the average of two values. Error bars represent the range of values.

Flow cytometry analysis. Attached or detached cells were harvested and pelleted by centrifugation at 800 x g for 5 minutes at 4°C. The cells were washed with PBS and resuspended in 0.5 mL ice-cold staining solution (5 µg/mL propidium iodide, 40 units/mL RNase A, 0.25% Triton X-100, in PBS). After a 1-hour incubation at 4°C in the dark, the DNA content was analyzed using a Becton Dickinson ExCalibur Flow Cytometer (San Jose, CA).

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Plk1 depletion induces growth inhibition and apoptosis in human tumor cells but has no significant effect on normal cells during the first two cell cycles. Human large cell lung cancer cell line H1299 was transfected with Plk1 siRNA Si1 or its control Si1C. Plk1 expression was completely blocked by Si1, whereas Si1C had no effect (Fig. 1A). Additionally, Si1 reduced overall cell survival and induced caspase activation when compared with Si1C (Fig. 1B and C). Because Si1C alone caused small levels of nonspecific cytotoxicity (Figs. 1-6), we assessed the effects of Plk1 depletion by comparing the differences between Si1 and Si1C. Cellular phenotypes occurred within the same concentration range of Si1 required to block Plk1 expression. Forty-eight hours after transfection, Si1 transfectants were arrested in G₂-M and displayed monoastral spindle arrays (Fig. 1D and E). Approximately 90% of Si1-treated mitotic cells exhibited such spindle defects. Si1C transfectants or reagent control-treated cells showed normal spindle morphology and cell cycle distribution. A significant increase in multinuclear cells was also observed in Si1 transfectants (Fig. 1F).

View larger version (33K): [in this window] [in a new window] [Download PPT slide]   Figure 1. Plk1 siRNA reduces cell survival in H1299 cells. H1299 cells were transfected with LF2000 alone, Si1, or Si1C. Analyses were carried out at 48 hours post-transfection unless specified. A, Plk1 levels; B, AlamarBlue assay; C, caspase assay; D, fluorescence-activated cell sorting analysis; E, defect in bipolar spindle formation. The pictures represent the morphology of typical cells in each transfection. We have quantified the aberrant mitosis observed to be 90% among the mitotic cells in Si1-treated samples and <5% in the reagent control or Si1C-treated samples. Over 200 mitotic cells were assessed for each siRNA-treated population; F, accumulation of multinuclear cells. Cells with more than two nuclei were counted in each transfected sample at 72 hours post-transfection. At least 700 cells were counted.

View larger version (41K): [in this window] [in a new window] [Download PPT slide]   Figure 2. Plk1 siRNA reduces cell survival in human cancer cells but not in normal cells. Cells were transfected with LF2000 alone, Si1, or Si1C. Cells were analyzed at 48 hours post-transfection. A, Plk1 levels; B, AlamarBlue assay; C, fluorescence-activated cell sorting analysis.

View larger version (24K): [in this window] [in a new window] [Download PPT slide]   Figure 3. Plk1 siRNA reduces long-term survival in normal cells. NHF and IMR90 cells were transfected with LF2000 alone, Si1, or Si1C. A-B, AlamarBlue assay and fluorescence-activated cell sorting analysis at 96 hours post-transfection; C, clonogenic assay with NHF cells.

View larger version (53K): [in this window] [in a new window] [Download PPT slide]   Figure 4. Plk1 depletion preferentially reduces the survival of p53-defective cells. Cells were transfected with LF2000 alone, Si1, or Si1C. Analyses were carried out at 48 hours post-transfection. A, Plk1 levels; B, AlamarBlue assay; C, fluorescence-activated cell sorting analysis; D, p53 functions. Plk1, p53, p21, Bax, and actin levels were measured by Western analysis.

View larger version (33K): [in this window] [in a new window] [Download PPT slide]   Figure 5. Long-term survival of 184B5 pair after Plk1 siRNA transfection. A, cell growth (AlamarBlue assay) during the first 4 days after transfection; B, clonogenic assay.

View larger version (28K): [in this window] [in a new window] [Download PPT slide]   Figure 6. Plk1 depletion inhibits tumor growth in HT1080 xenograft. HT1080 cells were transfected with LF2000 alone, Si1, or Si1C. A-B, Plk1 levels and AlamarBlue assay at 48 hours post-transfection; C, clonogenic assay; D, HT1080 cells treated with LF2000 alone, Si1, or Si1C were inoculated into SCID-beige mice. The sizes of the tumors in each group were plotted against the number of days after inoculation; E, tumors from reagent alone, 30 nmol/L Si1 or 30 nmol/L Si1C-treatment groups were harvested at the end of study. Blots, Plk1 levels in two tumors from each group.

Plk1 depletion preferentially confers cytotoxicity toward p53-defective cells. Virtually all cancer cells are defective in either the p53 or Rb pathways (39, 40). To explore whether p53 contributes to the differential sensitivity observed upon Plk1 depletion, we compared the sensitivity of isogenic cell lines differing in p53 status. Human mammary gland epithelial cells (184B5), colon cancer cells (RKO), and their E6-transformed counterparts were chosen for this study (41). Supplementary Fig. 1A shows the presence of wild-type p53 function in 184B5 cells. p53 and p21 levels were induced by doxorubicin in 184B5 cells, but not in the p53-defective 184B5-E6 cells. We observed a significant difference in cell survival between 184B5 and 184B5-E6 upon the same level of Plk1 depletion (Fig. 4A and B). Similar results were obtained in the RKO and RKO-E6 pair (Supplementary Fig. 2A and B).

Fluorescence-activated cell sorting analysis revealed that Plk1 Si1 caused G₂-M accumulation in 184B5-E6 and RKO-E6 cells, whereas Si1C had minimal effect. Additionally, there were significant amounts of polyploid cells in 184B5-E6 and RKO-E6 cells, suggesting that some of the E6-transformed cells proceeded to the next cell cycle even after the failure of cytokinesis (Fig. 4C and Supplementary Fig. 2C). In contrast, G₂-M accumulation in p53 wild-type cells was minimal upon Plk1 depletion at 48 hours post-transfection (Fig. 4C and Supplementary Fig. 2C) and 72 hours post-transfection (data not shown). Si1 can maintain Plk1 depletion for at least 7 days post-transfection (Fig. 4A). Both 184B5 and 184B5-E6 cells were actively growing for at least 4 days after transfections (Fig. 5A). We also examined the impact of Plk1 depletion on the long-term survival of these cells. More 184B5 cells survived than 184B5-E6 cells in a clonogenic assay, suggesting that p53 wild-type cells survive much better than p53-defective cells upon Plk1 depletion (Fig. 5B). As expected, some increase in G₂-M was the result of mitotic arrest, as indicated by the increase in H3 phosphorylation (Supplementary Fig. 1B). In order to examine the possibility that the differential effects we observed were due to other effects of E6, we showed similar differential phenotypes between 293 and 293 T cells, in which p53 and RB functions are impeded by SV40 large T antigen (Supplementary Fig. 2D and E), supporting the hypothesis that p53 is one of the critical factors in the differential response.

The functions of p53 in cell cycle arrest and apoptosis induction were examined in the 184B5 pair treated with Plk1 siRNA. p53 levels were not changed in the parental 184B5 cells, whereas a very minor but reproducible increase was observed in the 184B5-E6 cells when treated with 10 nmol/L Si1. This is consistent with a previous report on Plk1 siRNA (32). However, neither p21 nor Bax was induced in either cell line (Fig. 4D), and no increase in G₁ phase was detected (Fig. 4C).

Plk1 depletion by small interfering RNA reduces tumor growth in a xenograft model. We chose the HT1080 (human sarcoma cell line) xenograft model to examine the effect of Plk1 depletion on tumor growth. Depletion of Plk1 by Si1 resulted in a dramatic, dose-dependent reduction in HT1080 survival and colony formation (Fig. 6A-C). While assessing the duration of Si1-mediated Plk1 depletion, we observed that most of the cells die 3 to 4 days after transfection, whereas Plk1 is absent. However, after 5 days, cells grew out from sparse cell islands and Plk1 levels returned to normal (data not shown). We suspect that these islands represent untransfected cells.

The effect of Plk1 depletion on tumor growth was then assessed in vivo. Tumor growth from Si1-transfected HT1080 cells was significantly delayed in a dose-dependent manner when compared with Si1C-treated samples. In fact, there was little growth within 14 or 17 days in tumors treated with 10 or 30 nmol/L Si1, respectively. After 19 days, the growth rates of tumors treated with Si1 was indistinguishable from the controls (Fig. 6D). We suspect that Plk1 levels in these tumors return to control levels due to Si1 loss or the outgrowth of untransfected cells. The earliest we could harvest tumors big enough to measure Plk1 levels was 5 days post-inoculation, at which time Plk1 mRNA levels in Si1-tumors were the same as controls (data not shown). At the end of the study, Plk1 protein levels in Si1-tumors were the same as in the controls (Fig. 6E). Because we inoculated the same amount of live cells from each treatment group, cells transfected with Si1 probably died during the first few days, as suggested by the experiments in vitro. The tumors that eventually grew out from the Si1-treated group were likely derived from untransfected cells. These data show the requirement of Plk1 function in maintaining tumor growth.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
We have shown that Plk1 siRNA disrupts bipolar spindle formation, increases the number of multinuclear cells, and effectively reduces cell survival in human cancer cell lines. These results are consistent with previous reports on Plk1 siRNA, antisense oligos, peptide inhibitors, and a Plk1 dominant-negative mutant (32–37). In addition, we have shown that Plk1 siRNA inhibits tumor formation by HT1080 cells in SCID mice, suggesting that Plk1 is required for tumor growth.

A major concern in targeting Plk1 for cancer treatment is the potential toxicity in normal tissues due to its pleiotropic functions in mitosis. To our surprise, Plk1 siRNA did not reduce cell survival in normal human cell lines, whereas it preferentially induced mitotic arrest and decreased cell survival in human tumor cell lines. In fact, normal cells were able to bypass the depletion of Plk1 and maintain active cycling without obvious cell cycle defects for at least two cell cycles (Figs. 2 and 4). These results indicate that episodic Plk1 inhibition can specifically kill cancer cells within a reasonable therapeutic window.

p53 status may contribute to the differential sensitivity of normal and cancer cells to Plk1 depletion. Because these differences might be due to other genetic factors, we examined three sets of isogenic cell lines in which p53 and/or Rb function is blocked by either E6 or T antigen. Upon Plk1 depletion, the p53-defective cells showed increased G₂-M arrest and decreased survival when compared to their p53 wild-type counterparts, both in short-term and long-term experiments (Figs. 2-5). However, transiently blocking p53 expression with siRNA was not sufficient to significantly increase the G₂-M arrest and reduce cell survival upon Plk1 depletion (data not shown). It is possible that a p53 depletion–related event is modulating the response to Plk1 depletion, or that other genetic changes contribute to such modulation. For example, the absence of p53 function may allow other mutations to accumulate over time, which could modulate the response. It is also possible that transformation by E6 or T antigen results in the more profound G₂-M arrest and decreased survival upon Plk1 depletion. Indeed, p53 is apparently not the only factor in this response, since cells such as 293 show significant G₂-M arrest upon Plk1 depletion in the presence of functional p53. However, p53-defective/T antigen transformed 293 T cells still exhibit a more profound G₂-M arrest and less survival when compared to 293 cells (Supplementary Fig. 2E).

Liu and Erikson (32) have reported that Plk1 depletion induces p53-dependent apoptosis in cancer cells. Our results were consistent with theirs since they reported p53 induction and apoptosis 3 days or later post-transfection in p53 wild-type cells. To take these studies further, we examined the kinetics of these responses and showed that p53 function or other factors may help normal cells to cope with the loss of Plk1 (through a yet unknown mechanism) for the first few days without apparent defects. Eventually, Plk1 depletion will induce cytotoxicity in these p53 wild-type cells, although much later than in p53-defective, oncogenic transformed cells. This may provide a reasonable therapeutic window for Plk1 inhibitors in cancer intervention.

As recently implied by van Vugt et al. (42), Plk1 depletion may invoke checkpoint responses due to defects in chromosomal condensation/segregation. Our preliminary results also indicate checkpoint responses upon Plk1 depletion.³ p53 could conceivably affect cell survival via modulating such checkpoint responses.

In addition to p53, other mitotic kinases could compensate for the loss of Plk1 in normal cells. This compensation may not occur in p53-defective tumor cells or may simply not be sufficient. These tumor cells may require higher Plk1 activity, as evidenced by the frequent overexpression of Plk1 in multiple tumor types. Further experiments are required to test this hypothesis.

While this manuscript was under revision, Spänkuch et al. reported similar results, wherein Plk1 depletion reduced tumor growth in nude mice (43).

	Acknowledgments

 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Dr. Paul Jung and Sandra-Xintong Hu for the QPCR study, Loren Lasko for the excellent technical support, and Dr. Yu Shen for providing siRNA.

	Footnotes

 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

³ Unpublished results.

Received 6/16/04. Revised 12/27/04. Accepted 1/24/05.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Glover DM, Hagan IM, Tavares AA. Polo-like kinases: a team that plays throughout mitosis. Genes Dev 1998;12:3777–87.[Free Full Text]
2. Qian YW, Erikson E, Li C, Maller JL. Activated polo-like kinase Plx1 is required at multiple points during mitosis in Xenopus laevis. Mol Cell Biol 1998;18:4262–71.[Abstract/Free Full Text]
3. Abrieu A, Brassac T, Galas S, Fisher D, Labbe JC, Doree M. The Polo-like kinase Plx1 is a component of the MPF amplification loop at the G2/M-phase transition of the cell cycle in Xenopus eggs. J Cell Sci 1998;111:1751–7.[Abstract]
4. Toyoshima Morimoto F, Taniguchi E, Nishida E. Plk1 promotes nuclear translocation of human Cdc25C during prophase. EMBO Rep 2002;3:341–8.[CrossRef][Medline]
5. Toyoshima Morimoto F, Taniguchi E, Shinya N, Iwamatsu A, Nishida E. Polo-like kinase 1 phosphorylates cyclin B1 and targets it to the nucleus during prophase. Nature 2001;410:215–20.[CrossRef][Medline]
6. Yuan J, Eckerdt F, Bereiter Hahn J, Kurunci-Csacsko E, Kaufmann M, Strebhardt K. Cooperative phosphorylation including the activity of polo-like kinase 1 regulates the subcellular localization of cyclin B1. Oncogene 2002;21:8282–92.[CrossRef][Medline]
7. Sumara I, Vorlaufer E, Stukenberg PT, et al. The dissociation of cohesin from chromosomes in prophase is regulated by Polo-like kinase. Mol Cell 2002;9:515–25.[CrossRef][Medline]
8. Lane HA, Nigg EA. Antibody microinjection reveals an essential role for human polo-like kinase 1 (Plk1) in the functional maturation of mitotic centrosomes. J Cell Biol 1996;135:1701–13.[Abstract/Free Full Text]
9. Golsteyn RM, Schultz SJ, Bartek J, Ziemiecki A, Ried T, Nigg EA. Cell cycle analysis and chromosomal localization of human Plk1, a putative homologue of the mitotic kinases Drosophila polo and Saccharomyces cerevisiae Cdc5. J Cell Sci 1994;107:1509–17.[Abstract]
10. Yarm FR. Plk phosphorylation regulates the microtubule-stabilizing protein TCTP. Mol Cell Biol 2002;22:6209–21.[Abstract/Free Full Text]
11. Seong YS, Kamijo K, Lee JS, et al. A spindle checkpoint arrest and a cytokinesis failure by the dominant-negative polo-box domain of Plk1 in U-2 OS cells. J Biol Chem 2002;277:32282–93.[Abstract/Free Full Text]
12. Neef R, Preisinger C, Sutcliffe J, et al. Phosphorylation of mitotic kinesin-like protein 2 by polo-like kinase 1 is required for cytokinesis. J Cell Biol 2003;162:863–75.[Abstract/Free Full Text]
13. Lee KS, Song S, Erikson RL. The polo-box-dependent induction of ectopic septal structures by a mammalian polo kinase, plk, in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 1999;96:14360–5.[Abstract/Free Full Text]
14. Song S, Grenfell TZ, Garfield S, Erikson RL, Lee KS. Essential function of the polo box of Cdc5 in subcellular localization and induction of cytokinetic structures. Mol Cell Biol 2000;20:286–98.[Abstract/Free Full Text]
15. Lee KS, Yuan YL, Kuriyama R, Erikson RL. Plk is an M-phase-specific protein kinase and interacts with a kinesin-like protein, CHO1/MKLP-1. Mol Cell Biol 1995;15:7143–51.[Abstract]
16. Smits VA, Klompmaker R, Arnaud L, Rijksen G, Nigg EA, Medema RH. Polo-like kinase-1 is a target of the DNA damage checkpoint. Nat Cell Biol 2000;2:672–6.[CrossRef][Medline]
17. van Vugt MA, Smits VA, Klompmaker R, Medema RH. Inhibition of Polo-like kinase-1 by DNA damage occurs in an ATM- or ATR-dependent fashion. J Biol Chem 2001;276:41656–60.[Abstract/Free Full Text]
18. Deming PB, Flores KG, Downes CS, Paules RS, Kaufmann WK. ATR enforces the topoisomerase II-dependent G2 checkpoint through inhibition of Plk1 kinase. J Biol Chem 2002;277:36832–8.[Abstract/Free Full Text]
19. Tsvetkov L, Xu X, Li J, Stern David F. Polo-like kinase 1 and Chk2 interact and co-localize to centrosomes and the midbody. J Biol Chem 2003;278:8468–75.[Abstract/Free Full Text]
20. Lin Horng R, Ting Nicholas SY, Qin J, Lee Wen H. M phase-specific phosphorylation of BRCA2 by Polo-like kinase 1 correlates with the dissociation of the BRCA2-P/CAF complex. J Biol Chem 2003;278:35979–87.[Abstract/Free Full Text]
21. Lee MY, Daniels M, Venkitaraman AR. Phosphorylation of BRCA2 by the Polo-like kinase Plk1 is regulated by DNA damage and mitotic progression. Oncogene 2003;1:1–8.
22. Dietzmann K, Kirches E, von B, Jachau K, Mawrin C. Increased human polo-like kinase-1 expression in gliomas. J Neurooncol 2001;53:1–11.[Medline]
23. Holtrich U, Wolf G, Brauninger A, et al. Induction and down-regulation of PLK, a human serine/threonine kinase expressed in proliferating cells and tumors. Proc Natl Acad Sci U S A 1994;91:1736–40.[Abstract/Free Full Text]
24. Takai N, Miyazaki T, Fujisawa K, Nasu K, Hamanaka R, Miyakawa I. Polo-like kinase (PLK) expression in endometrial carcinoma. Cancer Lett 2001;169:41–9.[CrossRef][Medline]
25. Wolf G, Hildenbrand R, Schwar C, et al. Polo-like kinase: a novel marker of proliferation: correlation with estrogen-receptor expression in human breast cancer. Pathol Res Pract 2000;196:753–9.[Medline]
26. Kneisel L, Strebhardt K, Bernd A, Wolter M, Binder A, Kaufmann R. Expression of polo-like kinase (PLK1) in thin melanomas: a novel marker of metastatic disease. J Cutan Pathol 2002;29:354–8.[CrossRef][Medline]
27. Knecht R, Elez R, Oechler M, Solbach C, von Ilberg C, Strebhardt K. Prognostic significance of polo-like kinase (PLK) expression in squamous cell carcinomas of the head and neck. Cancer Res 1999;59:2794–7.[Abstract/Free Full Text]
28. Takai N, Miyazaki T, Fujisawa K, Nasu K, Hamanaka R, Miyakawa I. Expression of polo-like kinase in ovarian cancer is associated with histological grade and clinical stage. Cancer Lett 2001;164:41–9.[CrossRef][Medline]
29. Knecht R, Oberhauser C, Strebhardt K. PLK (polo-like kinase), a new prognostic marker for oropharyngeal carcinomas. Int J Cancer 2000;89:535–6.[CrossRef][Medline]
30. Wolf G, Elez R, Doermer A, et al. Prognostic significance of polo-like kinase (PLK) expression in non-small cell lung cancer. Oncogene 1997;14:543–9.[CrossRef][Medline]
31. Smith MR, Wilson ML, Hamanaka R, et al. Malignant transformation of mammalian cells initiated by constitutive expression of the polo-like kinase. Biochem Biophys Res Commun 1997;234:397–405.[CrossRef][Medline]
32. Liu X, Erikson RL. Polo-like kinase (Plk)1 depletion induces apoptosis in cancer cells. Proc Natl Acad Sci U S A 2003;100:5789–94.[Abstract/Free Full Text]
33. Spankuch-Schmitt B, Bereiter-Hahn J, Kaufmann M, Strebhardt K. Effect of RNA silencing of polo-like kinase-1 (PLK1) on apoptosis and spindle formation in human cancer cells. J Natl Cancer Inst 2002;94:1863–77.[Abstract/Free Full Text]
34. Liu X, Erikson RL. Activation of Cdc2/cyclin B and inhibition of centrosome amplification in cells depleted of Plk1 by siRNA. Proc Natl Acad Sci U S A 2002;99:8672–6.[Abstract/Free Full Text]
35. Spankuch-Schmitt B, Wolf G, Solbach C, et al. Downregulation of human polo-like kinase activity by antisense oligonucleotides induces growth inhibition in cancer cells. Oncogene 2002;21:3162–71.[CrossRef][Medline]
36. Cogswell JP, Brown CE, Bisi JE, Neill SD. Dominant-negative polo-like kinase 1 induces mitotic catastrophe independent of cdc25C function. Cell Growth Differ 2000;11:615–23.[Abstract/Free Full Text]
37. Yuan J, Kramer A, Eckerdt F, Kaufmann M, Strebhardt K. Efficient internalization of the polo-box of polo-like kinase 1 fused to an Antennapedia peptide results in inhibition of cancer cell proliferation. Cancer Res 2002;62:4186–90.[Abstract/Free Full Text]
38. Liu X, Shi Y, Han EK, et al. Downregulation of Akt1 inhibits anchorage-independent cell growth and induces apoptosis in cancer cells. Neoplasia 2001;3:278–86.[CrossRef][Medline]
39. Sherr CJ. Cancer cell cycles. Science 1996;274:1672–7.[Abstract/Free Full Text]
40. Weinberg RA. The retinoblastoma protein and cell cycle control. Cell 1995;81:323–30.[CrossRef][Medline]
41. Luo Y, Rockow Magnone SK, Joseph MK, et al. Abrogation of G2 checkpoint specifically sensitize p53 defective cells to cancer chemotherapeutic agents. Anticancer Res 2001;21:23–8.[Medline]
42. van Vugt MATM, Brat A, Medema RH. Polo-like kinase-1 controls recovery from a G2 DNA damage-induced arrest in mammalian cells. Mol Cell 2004;15:799–811.[CrossRef][Medline]
43. Spänkuch B, Matthess Y, Knecht R, Zimmer B, Kauffman M, Strebhardt K. Cancer inhibition in nude mice after systemic application of U6 promoter-driven short hairpin RNAs against Plk1. J Natl Cancer Inst 2004;96:862–72.[Abstract/Free Full Text]

This article has been cited by other articles:

				M. Adler, K. Muller, E. Rached, W. Dekant, and A. Mally Modulation of key regulators of mitosis linked to chromosomal instability is an early event in ochratoxin A carcinogenicity Carcinogenesis, April 1, 2009; 30(4): 711 - 719. [Abstract] [Full Text] [PDF]

				T. C. Nappi, P. Salerno, H. Zitzelsberger, F. Carlomagno, G. Salvatore, and M. Santoro Identification of Polo-like Kinase 1 as a Potential Therapeutic Target in Anaplastic Thyroid Carcinoma Cancer Res., March 1, 2009; 69(5): 1916 - 1923. [Abstract] [Full Text] [PDF]

				Y. Ren, W. Gong, H. Zhou, Y. Wang, F. Xiao, and T. Li siRecords: a database of mammalian RNAi experiments and efficacies Nucleic Acids Res., January 1, 2009; 37(suppl_1): D146 - D149. [Abstract] [Full Text] [PDF]

				D. Olmos, C. Swanton, and J. de Bono Targeting Polo-Like Kinase: Learning Too Little Too Late? J. Clin. Oncol., December 1, 2008; 26(34): 5497 - 5499. [Full Text] [PDF]

				J. Fink, K. Sanders, A. Rippl, S. Finkernagel, T. L. Beckers, and M. Schmidt Cell type dependent effects of Polo-like kinase 1 inhibition compared with targeted polo box interference in cancer cell lines Mol. Cancer Ther., December 1, 2007; 6(12): 3189 - 3197. [Abstract] [Full Text] [PDF]

				A. Morozov, S. J. Lee, Z.-K. Zhang, V. Cimica, D. Zagzag, and G. V. Kalpana INI1 Induces Interferon Signaling and Spindle Checkpoint in Rhabdoid Tumors Clin. Cancer Res., August 15, 2007; 13(16): 4721 - 4730. [Abstract] [Full Text] [PDF]

				T. J. Lansing, R. T. McConnell, D. R. Duckett, G. M. Spehar, V. B. Knick, D. F. Hassler, N. Noro, M. Furuta, K. A. Emmitte, T. M. Gilmer, et al. In vitro biological activity of a novel small-molecule inhibitor of polo-like kinase 1 Mol. Cancer Ther., February 1, 2007; 6(2): 450 - 459. [Abstract] [Full Text] [PDF]

				S. Kappel, Y. Matthess, B. Zimmer, M. Kaufmann, and K. Strebhardt Tumor inhibition by genomically integrated inducible RNAi-cassettes Nucleic Acids Res., September 11, 2006; 34(16): 4527 - 4536. [Abstract] [Full Text] [PDF]

				M. Schmidt, H.-P. Hofmann, K. Sanders, G. Sczakiel, T. L. Beckers, and V. Gekeler Molecular alterations after Polo-like kinase 1 mRNA suppression versus pharmacologic inhibition in cancer cells. Mol. Cancer Ther., April 1, 2006; 5(4): 809 - 817. [Abstract] [Full Text] [PDF]

				X. Liu, M. Lei, and R. L. Erikson Normal cells, but not cancer cells, survive severe plk1 depletion. Mol. Cell. Biol., March 1, 2006; 26(6): 2093 - 2108. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Supplementary Data Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Guan, R. Articles by Luo, Y. Search for Related Content PubMed PubMed Citation Articles by Guan, R. Articles by Luo, Y.