Cancer Research Meeting Calendar  Genetics and Biology of Brain Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fasching, C. L.
Right arrow Articles by Reddel, R. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fasching, C. L.
Right arrow Articles by Reddel, R. R.
[Cancer Research 65, 2722-2729, April 1, 2005]
© 2005 American Association for Cancer Research


Cell and Tumor Biology

Telomerase-Independent Telomere Length Maintenance in the Absence of Alternative Lengthening of Telomeres–Associated Promyelocytic Leukemia Bodies

Clare L. Fasching, Kylie Bower and Roger R. Reddel

Children's Medical Research Institute, Westmead, Sydney, New South Wales, Australia

Requests for reprints: Roger Reddel, Children's Medical Research Institute, 214 Hawkesbury Road, Westmead, New South Wales 2145, Australia. Phone: 61-2-9687-2800; Fax: 61-2-9687-2120; E-mail: rreddel{at}cmri.usyd.edu.au.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Immortal tumor cells and cell lines employ a telomere maintenance mechanism that allows them to escape the normal limits on proliferative potential. In the absence of telomerase, telomere length may be maintained by an alternative lengthening of telomeres (ALT) mechanism. All human ALT cell lines described thus far have nuclear domains of unknown function, termed ALT-associated promyelocytic leukemia bodies (APB), containing promyelocytic leukemia protein, telomeric DNA and telomere binding proteins. Here we describe telomerase-negative human cells with telomeres that contain a substantial proportion of nontelomeric DNA sequences (like telomerase-null Saccharomyces cerevisiae survivor type I cells) and that are maintained in the absence of APBs. In other respects, they resemble typical ALT cell lines: the telomeres are highly heterogeneous in length (ranging from very short to very long) and undergo rapid changes in length. In addition, these cells are capable of copying a targeted DNA tag from one telomere into other telomeres. These data show that APBs are not always essential for ALT-mediated telomere maintenance.

Key Words: Alternative lengthening of telomeres • ALT-associated PML bodies • Werner syndrome • SV40


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The ends of linear eukaryotic chromosomes are protected by the presence of telomeric DNA (which in vertebrates consists of tandem repeats of the TTAGGG hexanucleotide) and the proteins that specifically bind to this DNA (1, 2). The proliferation of normal cells is accompanied by a progressive decrease in telomere length (3). This telomeric attrition eventually results in a permanent proliferative arrest referred to as replicative senescence (4, 5), which is bypassed in all immortal cell lines and in the majority of tumors by activation of a telomere maintenance mechanism (6). There are at least two such mechanisms. The best known of these uses the ribonucleoprotein enzyme, telomerase (7), which lengthens telomeres by reverse transcribing telomeric repeats from its intrinsic RNA primer moiety. Telomerase-independent telomere length maintenance is called alternative lengthening of telomeres (ALT; refs. 8, 9); in at least some cases, this involves synthesis of telomeric DNA by recombination-mediated DNA replication (10). There are some types of human cancer where a substantial subset of the tumors do not have evidence either of ALT or of telomerase activity (11, 12). Some tumors may not require any telomere maintenance mechanism because of specific features of their biology (13), but it will be very important to determine whether any of the apparently ALT-negative/telomerase-negative tumors use a currently unknown ALT mechanism.

Although there are differences between the telomere biology of yeast and mammalian cells, the observation that there are two classes of Saccharomyces cerevisiae cells that survive mutations resulting in absence of telomerase activity (14–16), also raises the question whether there is more than one ALT mechanism in telomerase-negative human cells. Type I yeast telomerase-null survivors have undergone amplification of Y' elements in their telomeres by a mechanism that is dependent on genes including RAD51. In contrast, the telomeres of type II survivors contain telomeric sequence and use a mechanism that requires the RAD50 gene.

All of the human ALT cell lines analyzed to date have characteristics in common. They lack significant levels of telomerase activity and have telomeres that are highly heterogeneous in length, ranging from very long to very short (8). ALT telomeres can therefore be readily distinguished from telomeres of telomerase-positive cells by fluorescence in situ hybridization (FISH) using telomere-specific probes (17, 18), or by terminal restriction fragment (TRF) Southern analysis (8). This heterogeneity is generated by a combination of gradual telomere attrition and rapid lengthening or shortening events (19). ALT cells also have unique nuclear domains that contain telomeric DNA and the promyelocytic leukemia (PML) protein, together with the TRF1 and TRF2 telomere binding proteins (20). PML bodies with these contents have not been detected in mortal or telomerase-positive cells, and they are therefore referred to as ALT-associated PML bodies (APB; ref. 20). APBs have also been shown to contain proteins involved in recombination and repair, including BLM (21), BRCA1, hRAP1 (22), MRE11, NBS1, RAD50 (23, 24), RAD51, RAD52, replication protein A (RPA; ref. 20), RAD51D (25), WRN (26), ERCC1, XPF (27), hRAD1, hRAD9, hRAD17, and hHUS1 (28) consistent with the evidence that ALT is a recombination-mediated mechanism (10, 19). The function of APBs is unknown, but it has been suggested that they may be actively involved in the ALT mechanism (20, 24, 29).

Here we describe for the first time variant ALT cells that lack APBs and have telomeres that contain nontelomeric as well as telomeric sequence. Their mechanism of telomere maintenance, however, had functional similarities to that of other ALT lines. The telomere lengths were highly heterogeneous and underwent rapid changes. A DNA tag that was targeted into the telomere of a chromosome, which was transferred into these cells by microcell-mediated chromosome transfer (MMCT), was copied into the telomeres of other chromosomes, as had previously been shown for other ALT cells (10). Whereas the data do not provide definitive evidence that these variant ALT cells use a novel ALT mechanism, they do indicate that APBs are not always essential for ALT.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell lines and microcell-mediated chromosome transfer. The SV40-immortalized fibroblast cell lines, AG11395, GM847, and GM639 were purchased from Coriell Cell Repositories (Camden, NJ), and W-v (30) was provided by Dr. Lily Huschtscha (Children's Medical Research Institute, Westmead, Sydney, New South Wales, Australia). AG11395 and W-v were derived from individuals with Werner syndrome. All four cell lines were established either by SV40 infection, or by transfection with plasmid DNA that contained the SV40 origin of replication and SV40 early region genes. The AG11395 cells were received at passage 89 with an unspecified population doubling level. We passaged these cells for an additional 180 population doublings to confirm that they are immortalized, but all other analyses were done within 40 population doublings of the population doubling level at which they were obtained. CMC3c2 is a hybrid cell line generated by transferring a human chromosome with a DNA tag targeted into one of its telomeres into the mouse A9 cell line by MMCT (10). All cell lines were maintained in DMEM containing 10% fetal bovine serum; for CMC3c2 cells, the medium was supplemented with 300 µg/mL G418. MMCT was done as previously described (10, 31). Colonies were isolated and analyzed by neo-specific FISH to confirm that they were microcell hybrid cell lines.

Antibodies and indirect immunofluorescence. The primary antibodies and the dilutions used were rabbit anti-MRE11 Ab-1, 1:300 (Oncogene Research Products, San Diego, CA); mouse anti-RAD50 cl13B3, 1:300 (GeneTex, San Antonio, TX); rabbit anti-NBS1 Ab-1, 1:300 (CalBiochem, San Diego, CA); rabbit anti-RAD51 Ab-1, 1:300 (Oncogene Research Products); rabbit anti-RAD52 AB3221, 1:300 (Chemicon, Temecula, CA); mouse anti-RPA Ab-3, 1:300 (Oncogene Research Products); rabbit anti-PML AB1370, 1:500 (Chemicon); rabbit anti-SP100, 1:300 (Chemicon); mouse anti-SV40 large T antigen, 1:500; and mouse anti-TRF2, 1:200 (Upstate Biotechnology, Waltham, MA). The secondary antibodies and the dilutions used were goat anti-rabbit Alexa 488, 1:500; goat anti-mouse Alexa 594, 1:500 and goat anti-rabbit Alexa 594, 1:500 (Molecular Probes, Eugene, OR). To detect RPA, PML, and SP100, the cells were washed thrice with 1x PBS, then fixed and incubated with the appropriate primary antibody for 60 minutes at 37°C. The cells were then washed thrice in 1x PBS/0.01% Tween 20 and incubated with the appropriate secondary antibody for 30 minutes at 37°C, followed by three washes with 1x PBS/0.01% Tween 20. To detect MRE11, RAD50, NBS1, RAD51, RAD52, or SV40 large T antigen, we used an extraction procedure (23).

Telomerase and telomere length assays. Telomerase activity was assayed by the telomere repeat amplification protocol (TRAP; ref. 32), using 2 µg of CHAPS cellular lysate and a myogenin internal control primer (33). The products were separated on a 10% acrylamide gel, stained with SYBR Green (Molecular Probes) and visualized on a STORM 860 imager (Molecular Dynamics, Sunnyvale, CA). TRF lengths were determined by pulsed field gel electrophoresis of genomic DNA digested with restriction enzymes and hybridization of dried gels to telomere-specific oligo probe (TTAGGG)3 essentially as described (8, 9).

Isolation of low molecular weight DNA and in-gel hybridization. Low molecular weight DNA was isolated as described (34), separated using 1.0% agarose/TAE [0.4 mol/L Tris-acetate and 0.001 mol/L EDTA (pH 8.0)] gel electrophoresis and dried using a vacuum gel drier. The dried gel was denatured and neutralized, and hybridized overnight with oligonucleotide probes for telomere sequence, (TTAGGG)3, or the SV40 origin of replication (gggcggagttaggggcgg). Probes were 5'-end labeled using T4 polynucleotide kinase (New England Biolabs, Beverly, MA). The gel was washed and signal detected using an Amersham phosphor-screen and STORM 860 (Molecular Dynamics).

Fluorescence in situ hybridization. For metaphase FISH slides were prepared as described (10), and for fiber FISH cell suspensions were dropped across the top of slides pretreated with 2% silane. These slides were immersed in lysis buffer [0.5% SDS, 50 mmol/L EDTA, 200 mmol/L Tris (pH 7.4)] for 10 minutes, then overlaid with an equal volume of ethanol. Slides were transferred to 70% ethanol for 30 minutes and air-dried. DNA probes were produced using either plasmid DNA (pBR322-SV40) or PCR amplification of a neoR gene sequence (forward primer gctatgactgggcacaacag and reverse primer ccaccatgatattcggcaag; template: pSXneo plasmid; ref. 10) then labeled with bio-16-dUTP using the Biotin-Nick Translation Mix (Roche, Nutley, NJ). Signals were detected as described (10).

Visualization of telomeric DNA with a peptide nucleic acid probe. After indirect immunofluorescence or FISH with DNA probes, slides were cross-linked in 4% formaldehyde, rinsed in 1x PBS, and dehydrated in 70%, 90%, and 100% ethanol. Denaturation, hybridization, and detection with (CCCTAA)3-Cy3 Tel-PNA probe were as described (18).

Telomere length quantitation. SV40 or telomeric DNA was visualized on metaphase spreads as described above. The signals at each end of a single unpaired distinctive marker chromosome were quantitated essentially as described (18). Image bitmap pixel values ranged from 0 (empty scale = black) to 4,095 (full scale = white) following a linear function of measured intensity with increasing exposure time. Typically, maximum intensity values of the short (p) and the long (q) arm of the marker chromosome were recorded for up to 24 randomly selected metaphase spreads. The maximal values (<4,095) were corrected for average intensity values of background fluorescence.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Lack of detectable telomerase activity in AG11395 cells. Although we confirmed by extensive passaging that the AG11395 cell line is immortal, telomerase activity was not detected in these cells by the TRAP assay (Fig. 1A). It is therefore likely that they use an ALT mechanism for telomere maintenance. To confirm this, we next evaluated whether the telomere lengths were maintained in AG11395 cells.



View larger version (32K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. AG11395 is an ALT cell line containing both SV40 and TTAGGG sequences within its telomeres. A, AG11395 does not have detectable TRAP activity. B, AG11395 has short telomeres when digested with HinfI and RsaI (TRF lanes). The telomeres are heterogeneous ranging from very short to very long when digested with enzymes that do not restrict the SV40 sequences (SV40 lanes). C, Tel-PNA signals reveal the heterogeneous nature of the AG11395 telomeres (left). A similar pattern is seen when the telomeres are visualized with FISH using an SV40 specific probe (middle). Merge of Tel-Cy3 and SV40-FITC reveals an intricate pattern of signals (right). D, visualizing the signal pattern more closely using fiber FISH revealed differing patterns of SV40 FISH and Tel-PNA. Some contained more Tel-PNA signal (i), more SV40 FISH signal (ii), adjacent signals (iii), or alternating signals (iv).

 
Terminal restriction fragment analyses of AG11395 cells. We determined telomere lengths by TRF Southern analysis using the standard restriction enzymes, RsaI and HinfI that do not digest telomeric sequence. The telomeres seemed short and relatively homogeneous in length, resembling those of a telomerase-positive cell line (Fig. 1B). Because investigations described below confirmed the finding of others that the telomeres of these cells contained SV40 sequences1 and the SV40 genome contains 10 HinfI and 12 RsaI restriction sites, we repeated the TRF Southern analysis using enzymes MnlI, MscI, SacI, and XbaI that do not restrict SV40 DNA. This revealed that the telomeres have the characteristic heterogeneous length distribution, ranging from very short to very long, of ALT cells (Fig. 1B). The results suggested that AG11395 is an ALT cell line with telomeres that contain SV40 sequences.

Dispersal of SV40 sequences within the telomeres. We visualized the telomeres in metaphase spreads using a (CCCTAA)3-Cy3 conjugated peptide nucleic acid (Tel-PNA) probe. Consistent with the TRF results, the Tel-PNA signal was highly heterogeneous in intensity, ranging from absent to very strong, as is characteristic of ALT cells (Fig. 1C). FISH analysis using an SV40-specific probe also produced signals at most chromosome ends, with heterogeneity of signal intensity resembling that of the Tel-PNA probe (Fig. 1C).

Although the SV40-FISH and Tel-PNA signals generally coincided, there was some variation at individual chromosome ends. We did FISH on chromatin fibers to resolve the pattern of SV40 and Tel-PNA signals. In all cases, SV40 and Tel-PNA signals were both found on the same chromatin fibers. Some fibers contained a greater amount of Tel-PNA signal interspersed with a few SV40 signals (Fig. 1D, i), and others vice versa (Fig. 1D, ii). Some fibers had adjacent blocks of Tel-PNA and SV40-FISH signals (Fig. 1D, iii), whereas some had alternating SV40 and telomeric signals (Fig. 1D, iv). Thus, the ratio of SV40 and (TTAGGG)n sequences varied from telomere to telomere.

AG11395 shows alternative lengthening of telomeres activity with both telomeric and SV40 DNA. The lengths of individual telomeres within ALT cells change rapidly with time. This was shown in a previous study by examining the ratio of telomere signal on the q and p arms of a single chromosome: ALT cells showed a high level of variability in the p/q arm ratio whereas the level of variability in telomerase-positive cells was very low (18). To examine AG11395 cells for variation in telomere length, a unique marker chromosome was chosen (Fig. 2A) and 23 individual metaphases were evaluated with the Tel-PNA probe (Fig. 2B and D) and 24 with an SV40 specific probe (Fig. 2C and D). The q/p arm telomere length ratios ranged from 0.4 to 8.99 (a 22.5-fold variation) for the Tel-PNA (Fig. 2B and D) and 0.25 to 18.7 for the SV40 probe (a 74.8-fold variation; Fig. 2C and D), in contrast to the <2-fold ratio variation found in telomerase-positive cells (18). Both the telomeric DNA and SV40 DNA showed a range of ratios similar to that of other ALT cell lines, when evaluated independently (18). To confirm that the range of Tel-PNA ratios reflected ALT activity and not heterogeneous subpopulations that had accumulated within the cell line, we generated a subclone of AG11395 and found that the q/p arm ratios of the same marker chromosome ranged from 0.28 to 4.47 (16-fold variation; data not shown). Interestingly, when both SV40 and Tel-PNA ratios were evaluated on the same marker chromosome in 12 metaphase spreads, the ratios for the Tel-PNA did not always correlate with the SV40 values (Fig. 2D). These data are consistent with both the SV40 and (TTAGGG)n sequences participating in recombination-mediated length changes. Thus, the telomere length dynamics of these cells resemble those of ALT cell lines examined previously.



View larger version (32K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Both SV40 and telomeric sequences participate in ALT activity. The q/p arm telomere length ratio was determined by quantitation of telomere-PNA FISH signals on a unique marker chromosome (A) that was found in all metaphase spreads of AG11395 cells. A ratio of 1 (center line), indicates equal signal intensity on both arms; >1, more intense q arm signal; and <1, more intense p arm signal. B, ratio of q/p arm signal showed great variability when assayed with the Tel-PNA probe. C, SV40 FISH showed a similar variability. D, determining the p/q arm length ratios by hybridizing telomere and SV40 probes to the same telomeres showed that the ratios varied independently.

 
Recombination-mediated replication of AG11395 telomeres. Recombination-mediated replication of ALT telomeres was detected previously by targeting a DNA tag containing the neoR gene into ALT telomeres and demonstrating that the tag was copied into other telomeres while also remaining at its original location (10). To determine whether the AG11395 cells also use a recombination-mediated replication mechanism, we transferred a chromosome containing a neoR gene–tagged telomere into AG11395 cells from the CMC3c2 donor cell line by MMCT as described previously (10). The majority (96-100%) of the cells in three clones analyzed contained the donor neoR-tagged chromosome from CMC3c2 (Fig. 3A and C). Many of the cells also contained a variety of additional neo-tagged telomeres at late population doublings (Fig. 3B and C), demonstrating that the tag had been copied from telomere to telomere, as would be expected if these cells lengthen their telomeres by recombination-mediated replication.



View larger version (46K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. AG11395 maintains its telomeres by recombination-mediated DNA replication. A telomere-tagged chromosome was transferred into AG11395 and the neoR gene tag in three individual clones (c1-3) was monitored by FISH over a number of population doublings (PD). A, at early PD the transferred chromosome can be readily identified (cyan arrowhead). B, At later PD the original transferred chromosome can still be identified (cyan arrowhead), but other telomeres now contain tags (yellow arrowheads). C, Percentage of cells containing additional tagged telomeres at early and late population doublings. Total number of additional tagged telomeres refers to chromosome ends that are tagged at least once within the cell population.

 
Lack of alternative lengthening of telomeres–associated promyelocytic leukemia bodies in AG11395 cells. One of the phenotypic markers of ALT cells is the presence of APBs, which are characterized by colocalization of PML to telomeric DNA and/or telomere binding proteins. These have been detected in every ALT cell line examined to date (reviewed in ref. 35). We examined AG11395 cells for the presence of APBs by indirect immunofluorescence with antibodies specific for the PML protein and the telomere binding protein, TRF2. We also analyzed the cells for colocalization of PML and SP100 to telomeric DNA using the Tel-PNA probe. PML (and SP100; data not shown) did not colocalize with either TRF2 or telomeric DNA (Fig. 4A). Thus, AG11395 differ from other ALT cells in that they do not contain APBs.



View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. AG11395 cells do not contain APBs. SV40-specific aggregates colocalized with both TRF2 and telomeric DNA, but not with PML. A, monolayers of AG11395 cells were costained with PML antibody and either the TRF2 antibody or the Tel-PNA probe. Twenty-five to 50 cells were evaluated for each costaining combination and no colocalization was seen. B, cells were costained with the Tel-PNA probe and either TRF2 antibody or an SV40 FISH probe.

 
AG11395 contains distinct nuclear aggregations. Although these cells do not contain APBs, we observed telomere aggregations using Tel-PNA. We analyzed these aggregates with SV40 FISH and either TRF2 immunofluorescence or telomere-specific FISH to confirm the presence of both SV40 and telomeric sequences. We observed ~100% colocalization of the Tel-PNA probe with both TRF2 and the SV40 sequences (Fig. 4B). The SV40/telomeric DNA aggregates were present in 5% to 10% of the cells in an asynchronous population (data not shown).

To further characterize these SV40/telomeric DNA aggregates, we did indirect immunofluorescence using antibodies against SV40 large T antigen and proteins that have previously been shown to be involved in telomere biology such as MRE11, NBS1, RAD50, RAD51, RAD52, and RPA. The SV40/telomeric DNA aggregates colocalized with all of these proteins (Fig. 5).



View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. AG11395 cells contain aggregates of SV40/telomeric DNA and specific proteins. Monolayers of AG11395 were costained with antibodies against MRE11, RAD50, NBS1, RAD51, RAD52, RPA, and SV40 large T antigen (left) and the PNA probe, Tel-FITC (middle). Merged images (right) of colocalization of the proteins with the SV40/telomere aggregates. Fifteen to 20 cells were analyzed with each antibody.

 
AG11395 contains extrachromosomal telomere and SV40 sequences. ALT cell lines contain a greater amount of low molecular weight extrachromosomal telomeric DNA when compared with telomerase-positive cell lines (36, 37).2 To compare the extrachromosomal DNA in AG11395 to other ALT and telomerase-positive cell lines, we analyzed the low molecular weight DNA extracted as Hirt supernatants from AG11395, the ALT cell lines, GM847 and W-v, and the telomerase-positive cell line GM639 using SV40- and telomere-specific probes. There was a significant amount of low molecular weight extrachromosomal telomeric DNA present in AG11395 cells, which had a larger molecular weight than the extrachromosomal telomeric DNA in the ALT cell lines, W-v and GM487 (Fig. 6A). There was no telomeric DNA recovered in the telomerase-positive cell line, GM639 (Fig. 6A). To investigate whether the SV40 origin of replication was present in the low molecular weight DNA, we hybridized it with an SV40 origin of replication–specific oligo. This detected a significant amount of extrachromosomal DNA in AG11395 cells (Fig. 6B), with molecular weights corresponding to those of the extrachromosomal DNA that hybridized to the (TTAGGG)3 probe. We also detected the SV40 origin of replication in the telomeres of AG11395 cells (data not shown). No extrachromosomal SV40 DNA was recovered from the SV40-immortalized cell lines W-v, GM847, or GM639 (Fig. 6B).



View larger version (38K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. AG11395 extrachromosomal DNA includes both SV40 origin of replication and telomeric sequences. Hirt lysates were hybridized with probes specific for telomeric DNA or the SV40 origin of replication. A, telomere-specific probe hybridizes with low molecular weight DNA in all three ALT cell lines, GM847, W-v and AG11395, but not in the telomerase-positive GM639. The bulk of extra-chromosomal DNA found in AG11395 has a higher molecular weight than that in GM847 and W-v. B, SV40 origin of replication–specific probe hybridizes only with the extrachromosomal DNA in AG11395 and the pattern is similar to that of the telomeric probe.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have investigated an immortalized cell line that maintains its telomeres in the absence of telomerase and has features that distinguish it from other ALT cell lines. These cells contain extensive amounts of SV40 sequence in their telomeres, together with (TTAGGG)n DNA. Furthermore, these cells differ from all other telomerase-negative immortalized cell lines described to date in that they lack APBs. In other ways, however, the telomere maintenance mechanism used by these cells resembles that of other ALT cells. TRF analyses showed that these cells have the highly heterogeneous telomere length distribution that is a hallmark of ALT cells. Furthermore, the telomere lengths of a single chromosome varied widely within cells of both an uncloned population and a recently derived subclone, demonstrating that the telomere length heterogeneity is generated rapidly, as has been observed for other ALT cell lines (18). They lengthen their telomeres by recombination-mediated DNA replication like other ALT cells (10), as evidenced by copying of an intratelomeric neoR gene tag from one telomere to others.

FISH analyses showed a complex pattern of interspersion of SV40 and telomeric sequences within the AG11395 telomeres, with SV40 and telomeric sequences alternating in some telomeres. DNA sequence analysis has shown that the telomeres of these cells contain tandem arrays of SV40 and telomeric sequences (38). The presence of SV40 sequences within the telomeres of AG11395 cells resembles the situation in yeast type I telomerase-null survivors that contain amplified Y' subtelomeric elements interspersed with telomeric sequence (14–16, 39), as well as immortalized telomerase-null mouse embryonic stem cells that contain tandem arrays of nontelomeric and telomeric sequences at most chromosome ends (40). The yeast type I and II mechanisms are dependent on different genes, so more information regarding the molecular genetics of ALT and the variant ALT cells described here will be required before it is clear whether the variant ALT cells are the human equivalent of yeast type I survivors.

Regarding the mechanism whereby SV40 DNA became inserted into the telomeres of these cells, it is possible that a telomere was the original site of integration of SV40 DNA. Alternatively, SV40 sequences initially may have integrated elsewhere in the genome and subsequently inserted into a telomere. In either case, once SV40 sequences became inserted into the telomere they could be copied to other telomeres when the ALT mechanism became activated at immortalization.

The differing contributions of SV40 and (TTAGGG)n sequences to some telomeres may be explained by the nature of the telomere maintenance mechanism. We have previously suggested that there may be a variety of templates for recombination-mediated DNA replication of telomeres in ALT cells: in some cases it may be other telomeres, in others a telomere may be able to use itself as a template for DNA synthesis via t-loop formation, or it may be able to use linear or circular extrachromosomal telomeric DNA as a copy template (41, 42). Studies in the yeast Kluyveromyces lactis showed that exogenous plasmid sequences were added to telomeres by rolling circle gene conversion and then "spread" to the other telomeres by recombination (43). SV40 DNA containing the origin of replication has the capacity to become amplified in situ, to form circular extrachromosomal DNA, and to reintegrate into new genomic locations (44–46) which could lead to complex patterns within the telomeres. Thus, there may have been integration of SV40 followed by an excision event, which included telomeric DNA and maintenance of this SV40/telomere unit as an episome. The AG11395 cells were found to contain abundant extrachromosomal DNA ranging in size from ~2.8 to 8.5 kb that hybridized to (TTAGGG)n and SV40 probes. Rolling circle replication of episomal DNA would result in repeating units of SV40 and telomeric DNA. In contrast, recombination with telomeres could result in addition of variable proportions of SV40 and (TTAGGG)n sequences depending on the composition of the template telomere and the point of recombination within the telomere. Also, given the presence of the SV40 origin of replication, it is possible that SV40 sequences may have been amplified in situ within some telomeres.

The presence of substantial amounts of SV40 DNA in the telomeres of these cells raises the question of how telomere capping function is accomplished. It is interesting to note that t-loop formation has been shown in in vitro experiments to be tolerant of nontelomeric sequence at the terminus (47). Moreover, it has been shown that Schizosaccharomyces pombe telomere chromatin structure and function may be stably maintained in the absence of telomeric repeats (48).

Despite the abundant presence of the extrachromosomal telomeric DNA, the AG11395 cells do not contain APBs. These nuclear domains contain PML and other constituents of PML bodies together with telomeric DNA, telomere binding proteins, and other proteins involved in DNA recombination and replication, including WRN, and have been found in 2% to 10% of asynchronously dividing cells within every ALT cell line population that has been examined previously (20, 35). The absence of APBs does not seem to be due to the absence of wild-type WRN protein in AG11395 cells, because APBs are present in another Werner Syndrome cell line, W-v. Although it has been suggested that APBs participate in the ALT mechanism (20) in a cell cycle–dependent manner (24, 29), and APBs disappear from cells after the ALT mechanism is repressed by somatic cell hybridization (49), the relationship of APBs to the ALT mechanism is still unclear. Most or all of the proteins required for ALT may be assembled within APBs, which could therefore function as domains in which the ALT process is facilitated.

Although APBs per se are clearly not required for telomere maintenance in the AG11395 cell line, there are nuclear aggregates present in these cells containing SV40 large T antigen and many of the same components as APBs including MRE11, NBS1, RAD50, RAD51, RAD52, RPA, and TRF2 (but not PML or SP100). Large T antigen may accumulate within these aggregates by binding to the SV40 origin of replication within the telomeric DNA in AG11395 cells. SV40 large T antigen interacts with many proteins and has been shown to interact with the nuclear matrix (50). It is possible, therefore, that large T antigen may be responsible for the unusual localization of the DNA/protein complexes in AG11395 cells that would otherwise aggregate in PML bodies and thus form APBs, by both binding to the SV40 origin of replication sequences in the extrachromosomal mixed SV40/telomeric DNA and determining its localization within the nucleus by its other binding activities. Regardless of the mechanism of this localization, the observation that there are nuclear domains containing concentrations of telomeric DNA and proteins involved in DNA processing in these cells, leaves open the possibility that in ALT cells such aggregates are an important aspect of the telomere maintenance mechanism.


    Acknowledgments
 
Grant support: Judith Hyam Memorial Trust Fund for Cancer Research, Carcinogenesis Fellowship of the Cancer Council New South Wales, and National Health and Medical Research Council of Australia postgraduate scholarship and project grant.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Sheila Stewart for helpful discussions and Brad Johnson, Len Guarente, and Robert Marciniak for providing unpublished data.


    Footnotes
 
1 B. Johnson et al., personal communication. Back

2 T.R. Yeager and R.R. Reddel, unpublished data. Back

Received 8/ 9/04. Revised 11/ 8/04. Accepted 1/14/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Moyzis RK, Buckingham JM, Cram LS, et al. A highly conserved repetitive DNA sequence, (TTAGGG)n, present at the telomeres of human chromosomes. Proc Natl Acad Sci U S A 1988;85:6622–6.[Abstract/Free Full Text]
  2. Blackburn EH. Structure and function of telomeres. Nature 1991;350:569–73.[CrossRef][Medline]
  3. Hastie ND, Dempster M, Dunlop MG, Thompson AM, Green DK, Allshire RC. Telomere reduction in human colorectal carcinoma and with ageing. Nature 1990;346:866–8.[CrossRef][Medline]
  4. Olovnikov AM. A theory of marginotomy. The incomplete copying of template margin in enzymic synthesis of polynucleotides and biological significance of the phenomenon. J Theor Biol 1973;41:181–90.[CrossRef][Medline]
  5. Levy MZ, Allsopp RC, Futcher AB, Greider CW, Harley CB. Telomere end-replication problem and cell aging. J Mol Biol 1992;225:951–60.[CrossRef][Medline]
  6. Cech TR. Beginning to understand the end of the chromosome. Cell 2004;116:273–9.[CrossRef][Medline]
  7. Greider CW, Blackburn EH. Identification of a specific telomere terminal transferase activity in Tetrahymena extracts. Cell 1985;43:405–13.[CrossRef][Medline]
  8. Bryan TM, Englezou A, Gupta J, Bacchetti S, Reddel RR. Telomere elongation in immortal human cells without detectable telomerase activity. EMBO J 1995;14:4240–8.[Medline]
  9. Bryan TM, Reddel RR. Telomere dynamics and telomerase activity in in vitro immortalised human cells. Eur J Cancer 1997;33:767–73.
  10. Dunham MA, Neumann AA, Fasching CL, Reddel RR. Telomere maintenance by recombination in human cells. Nat Genet 2000;26:447–50.[CrossRef][Medline]
  11. Gupta J, Han L-P, Wang P, Gallie BL, Bacchetti S. Development of retinoblastoma in the absence of telomerase activity. J Natl Cancer Inst 1996;88:1152–7.[Abstract/Free Full Text]
  12. Hakin-Smith V, Jellinek DA, Levy D, et al. Alternative lengthening of telomeres and survival in patients with glioblastoma multiforme. Lancet 2003;361:836–8.[CrossRef][Medline]
  13. Reddel RR. The role of senescence and immortalization in carcinogenesis. Carcinogenesis 2000;21:477–84.[Abstract/Free Full Text]
  14. Lundblad V, Blackburn EH. An alternative pathway for yeast telomere maintenance rescues est1 senescence. Cell 1993;73:347–60.[CrossRef][Medline]
  15. Teng S-C, Zakian VA. Telomere-telomere recombination is an efficient bypass pathway for telomere maintenance in Saccharomyces cerevisiae. Mol Cell Biol 1999;19:8083–93.[Abstract/Free Full Text]
  16. Le S, Moore JK, Haber JE, Greider CW. RAD50 and RAD51 define two pathways that collaborate to maintain telomeres in the absence of telomerase. Genetics 1999;152:143–52.[Abstract/Free Full Text]
  17. Lansdorp PM, Poon S, Chavez E, et al. Telomeres in the hematopoietic system. Ciba Found Symp 1997;211:209–18.[Medline]
  18. Perrem K, Colgin LM, Neumann AA, Yeager TR, Reddel RR. Coexistence of alternative lengthening of telomeres and telomerase in hTERT-transfected GM847 cells. Mol Cell Biol 2001;21:3862–75.[Abstract/Free Full Text]
  19. Murnane JP, Sabatier L, Marder BA, Morgan WF. Telomere dynamics in an immortal human cell line. EMBO J 1994;13:4953–62.[Medline]
  20. Yeager TR, Neumann AA, Englezou A, Huschtscha LI, Noble JR, Reddel RR. Telomerase-negative immortalized human cells contain a novel type of promyelocytic leukemia (PML) body. Cancer Res 1999;59:4175–9.[Abstract/Free Full Text]
  21. Yankiwski V, Marciniak RA, Guarente L, Neff NF. Nuclear structure in normal and Bloom syndrome cells. Proc Natl Acad Sci U S A 2000;97:5214–9.[Abstract/Free Full Text]
  22. Wu G, Jiang X, Lee WH, Chen PL. Assembly of functional ALT-associated promyelocytic leukemia bodies requires Nijmegen breakage syndrome 1. Cancer Res 2003;63:2589–95.[Abstract/Free Full Text]
  23. Zhu X-D, Kuster B, Mann M, Petrini JHJ, de Lange T. Cell-cycle-regulated association of RAD50/MRE11/NBS1 with TRF2 and human telomeres. Nat Genet 2000;25:347–52.[CrossRef][Medline]
  24. Wu G, Lee W-H, Chen PL. NBS1 and TRF1 colocalize at promyelocytic leukemia bodies bodies during late S/G2 phases in immortalized telomerase-negative cells: implication of NBS1 in alternative lengthening of telomeres. J Biol Chem 2000;275:30618–22.[Abstract/Free Full Text]
  25. Tarsounas M, Munoz P, Claas A, et al. Telomere maintenance requires the RAD51D recombination/repair protein. Cell 2004;117:337–47.[CrossRef][Medline]
  26. Johnson FB, Marciniak RA, McVey M, Stewart SA, Hahn WC, Guarente L. The Saccharomyces cerevisiae WRN homolog Sgs1p participates in telomere maintenance in cells lacking telomerase. EMBO J 2001;20:905–13.[CrossRef][Medline]
  27. Zhu XD, Niedernhofer L, Kuster B, Mann M, Hoeijmakers JH, de Lange T. ERCC1/XPF removes the 3' overhang from uncapped telomeres and represses formation of telomeric DNA-containing double minute chromosomes. Mol Cell 2003;12:1489–98.[CrossRef][Medline]
  28. Nabetani A, Yokoyama O, Ishikawa F. Localization of hRad9, hHus1, hRad1 and hRad17, and caffeine-sensitive DNA replication at ALT (alternative lengthening of telomeres)-associated promyelocytic leukemia body. J Biol Chem 2004;279:25849–57.[Abstract/Free Full Text]
  29. Grobelny JV, Godwin AK, Broccoli D. ALT-associated PML bodies are present in viable cells and are enriched in cells in the G2/M phase of the cell cycle. J Cell Sci 2000;113:4577–85.[Abstract]
  30. Huschtscha LI, Thompson KVA, Holliday R. The susceptibility of Werner's syndrome and other human skin fibroblasts to SV40-induced transformation and immortalization. Proc R Soc Lond B Biol Sci 1986;229:1–12.[Medline]
  31. Saxon PJ, Srivatsan ES, Leipzig GV, Sameshima JH, Stanbridge EJ. Selective transfer of individual human chromosomes to recipient cells. Mol Cell Biol 1985;5:140–6.[Abstract/Free Full Text]
  32. Kim NW, Piatyszek MA, Prowse KR, et al. Specific association of human telomerase activity with immortal cells and cancer. Science 1994;266:2011–5.[Abstract/Free Full Text]
  33. Wright WE, Shay JW, Piatyszek MA. Modifications of a telomeric repeat amplification protocol (TRAP) result in increased reliability, linearity and sensitivity. Nucleic Acids Res 1995;23:3794–5.[Free Full Text]
  34. Cole SL, Tevethia MJ. Simian Virus 40 Large T antigen and two independent T-antigen segments sensitize cells to apoptosis following genotoxic damage. J Virol 2002;76:8420–32.[Abstract/Free Full Text]
  35. Henson JD, Neumann AA, Yeager TR, Reddel RR. Alternative lengthening of telomeres in mammalian cells. Oncogene 2002;21:598–610.[CrossRef][Medline]
  36. Ogino H, Nakabayashi K, Suzuki M, et al. Release of telomeric DNA from chromosomes in immortal human cells lacking telomerase activity. Biochem Biophys Res Commun 1998;248:223–7.[CrossRef][Medline]
  37. Tokutake Y, Matsumoto T, Watanabe T, et al. Extra-chromosome telomere repeat DNA in telomerase-negative immortalized cell lines. Biochem Biophys Res Commun 1998;247:765–72.[CrossRef][Medline]
  38. Marciniak RA, Cavazos D, Montellano R, Johnson FB. A novel form of ALT telomere maintenance in human cells. Cancer Res. Under revision 2004.
  39. Chen Q, Ijpma A, Greider CW. Two survivor pathways that allow growth in the absence of telomerase are generated by distinct telomere recombination events. Mol Cell Biol 2001;21:1819–27.[Abstract/Free Full Text]
  40. Niida H, Shinkai Y, Hande MP, et al. Telomere maintenance in telomerase-deficient mouse embryonic stem cells: characterization of an amplified telomeric DNA. Mol Cell Biol 2000;20:4115–27.[Abstract/Free Full Text]
  41. Neumann AA, Reddel RR. Opinion: Telomere maintenance and cancer-look, no telomerase. Nat Rev Cancer 2002;2:879–84.[CrossRef][Medline]
  42. Fasching CL, Reddel RR. Telomere maintenance in human cell lines and tumors without telomerase. In: Krupp G, Parwaresch R, editors. Telomerases, telomeres and cancer. Georgetown (TX): Landes Bioscience/Eurekah.com and New York (NY): Kluwer Academic/Plenum Publishers; 2002. p. 359–73.
  43. Natarajan S, Groff-Vindman C, McEachern MJ. Factors influencing the recombinational expansion and spread of telomeric tandem arrays in Kluyveromyces lactis. Eukaryot Cell 2003;2:1115–27.[Abstract/Free Full Text]
  44. Molecular biology of tumor viruses, part 2. DNA tumor viruses. 2nd ed. Cold Spring Harbor: Cold Spring Harbor Laboratory Press; 1981.
  45. Zouzias D, Jha KK, Mulder C, Basilico C, Ozer HL. Human fibroblasts transformed by the early region of SV40 DNA: analysis of "free" viral DNA sequences. Virology 1980;104:439–53.[CrossRef][Medline]
  46. Stary A, Sarasin A. Molecular analysis of DNA junctions produced by illegitimate recombination in human cells. Nucleic Acids Res 1992;20:4269–74.[Abstract/Free Full Text]
  47. Stansel RM, de Lange T, Griffith JD. T-loop assembly in vitro involves binding of TRF2 near the 3' telomeric overhang. EMBO J 2001;20:5532–40.[CrossRef][Medline]
  48. Sadaie M, Naito T, Ishikawa F. Stable inheritance of telomere chromatin structure and function in the absence of telomeric repeats. Genes Dev 2003;17:2271–82.[Abstract/Free Full Text]
  49. Perrem K, Bryan TM, Englezou A, Hackl T, Moy EL, Reddel RR. Repression of an alternative mechanism for lengthening of telomeres in somatic cell hybrids. Oncogene 1999;18:3383–90.[CrossRef][Medline]
  50. Deppert W, Von der Weth A. Functional interaction of nuclear transport-defective simian virus 40 large T antigen with chromatin and nuclear matrix. J Virol 1990;64:838–46.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
JCBHome page
W.-Q. Jiang, Z.-H. Zhong, A. Nguyen, J. D. Henson, C. D. Toouli, A. W. Braithwaite, and R. R. Reddel
Induction of alternative lengthening of telomeres-associated PML bodies by p53/p21 requires HP1 proteins
J. Cell Biol., June 1, 2009; 185(5): 797 - 810.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z.-H. Zhong, W.-Q. Jiang, A. J. Cesare, A. A. Neumann, R. Wadhwa, and R. R. Reddel
Disruption of Telomere Maintenance by Depletion of the MRE11/RAD50/NBS1 Complex in Cells That Use Alternative Lengthening of Telomeres
J. Biol. Chem., October 5, 2007; 282(40): 29314 - 29322.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
B. L. Pike and J. Heierhorst
Mdt1 Facilitates Efficient Repair of Blocked DNA Double-Strand Breaks and Recombinational Maintenance of Telomeres
Mol. Cell. Biol., September 15, 2007; 27(18): 6532 - 6545.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. T. Calado, S. A. Graf, K. L. Wilkerson, S. Kajigaya, P. J. Ancliff, Y. Dror, S. J. Chanock, P. M. Lansdorp, and N. S. Young
Mutations in the SBDS gene in acquired aplastic anemia
Blood, August 15, 2007; 110(4): 1141 - 1146.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. L. Fasching, A. A. Neumann, A. Muntoni, T. R. Yeager, and R. R. Reddel
DNA Damage Induces Alternative Lengthening of Telomeres (ALT) Associated Promyelocytic Leukemia Bodies that Preferentially Associate with Linear Telomeric DNA
Cancer Res., August 1, 2007; 67(15): 7072 - 7077.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
A. S. Multani and S. Chang
WRN at telomeres: implications for aging and cancer
J. Cell Sci., March 1, 2007; 120(5): 713 - 721.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. A. Compton, J.-H. Choi, A. J. Cesare, S. Ozgur, and J. D. Griffith
Xrcc3 and Nbs1 Are Required for the Production of Extrachromosomal Telomeric Circles in Human Alternative Lengthening of Telomere Cells
Cancer Res., February 15, 2007; 67(4): 1513 - 1519.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Brachner, S. Sasgary, C. Pirker, C. Rodgarkia, M. Mikula, W. Mikulits, H. Bergmeister, U. Setinek, M. Wieser, S.-F. Chin, et al.
Telomerase- and Alternative Telomere Lengthening-Independent Telomere Stabilization in a Metastasis-Derived Human Non-Small Cell Lung Cancer Cell Line: Effect of Ectopic hTERT.
Cancer Res., April 1, 2006; 66(7): 3584 - 3592.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
A. Muntoni and R. R. Reddel
The first molecular details of ALT in human tumor cells
Hum. Mol. Genet., October 15, 2005; 14(suppl_2): R191 - R196.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. E. Johnson, R. J. Varkonyi, J. Schwalm, R. Cragle, A. Klein-Szanto, A. Patchefsky, E. Cukierman, M. von Mehren, and D. Broccoli
Multiple Mechanisms of Telomere Maintenance Exist in Liposarcomas
Clin. Cancer Res., August 1, 2005; 11(15): 5347 - 5355.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fasching, C. L.
Right arrow Articles by Reddel, R. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fasching, C. L.
Right arrow Articles by Reddel, R. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online