Cancer Research 09 AM Call for Abstracts
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Curnis, F.
Right arrow Articles by Corti, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Curnis, F.
Right arrow Articles by Corti, A.
[Cancer Research 65, 2906-2913, April 1, 2005]
© 2005 American Association for Cancer Research

Experimental Therapeutics, Molecular Targets, and Chemical Biology

Targeted Delivery of IFN{gamma} to Tumor Vessels Uncouples Antitumor from Counterregulatory Mechanisms

Flavio Curnis, Anna Gasparri, Angelina Sacchi, Angela Cattaneo, Fulvio Magni and Angelo Corti

Department of Oncology, Cancer Immunotherapy and Gene Therapy Program, San Raffaele H Scientific Institute, Milan, Italy

Requests for reprints: Angelo Corti, Department of Biological and Technological Research, San Raffaele H Scientific Institute, via Olgettina 58, 20132 Milan, Italy. Phone: 39-2264-34802; Fax: +39-2264-34786; E-mail: corti.angelo{at}hsr.it.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Because of its immunomodulatory and anticancer activities, IFN{gamma} has been used as an anticancer drug in several clinical studies, unfortunately with modest results. Attempts to increase the response by increasing the dose or by repeated continuous injection often resulted in lower efficacy, likely due to counterregulatory effects. We show here that targeted delivery of low doses of IFN{gamma} to CD13, a marker of angiogenic vessels, can overcome major counterregulatory mechanisms and delay tumor growth in two murine models that respond poorly to IFN{gamma}. Tumor vascular targeting was achieved by coupling IFN{gamma} to GCNGRC, a CD13 ligand, by genetic engineering technology. The dose-response curve was bell-shaped. Maximal effects were induced with a dose of 0.005 µg/kg, about 500-fold lower than the dose used in patients. Nontargeted IFN{gamma} induced little or no effects over a range of 0.003 to 250 µg/kg. Studies on the mechanism of action showed that low doses of targeted IFN{gamma} could activate tumor necrosis factor (TNF)-dependent antitumor mechanisms, whereas high doses of either targeted or nontargeted IFN{gamma} induced soluble TNF-receptor shedding in circulation, a known counterregulatory mechanism of TNF activity. These findings suggest that antitumor activity and counterregulatory mechanisms could be uncoupled by tumor vascular targeting with extremely low doses of IFN{gamma}.

Key Words: IFN{gamma} • tumor targeting • aminopeptidase N • CD13 • vascular targeting • NGR motif • soluble TNF receptors


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
A large body of evidence suggests that IFN{gamma}, a pleiotropic cytokine mainly produced by T lymphocytes and natural killer cells (1, 2) , could promote antitumor responses (3–10). For instance, IFN{gamma} could induce antiproliferative and proapoptotic effects on many tumor cell types (11), inhibit tumor angiogenesis (8, 12–14) HREF="#B12">, and activate natural killer cells and macrophages to kill a variety of tumor cell targets (11). IFN{gamma} is also an important regulator of CD4+ T helper cells (15, 16), is the major physiologic macrophage-activating factor (17–19), and can augment the expression of MHC-I and -II on cancer and endothelial cells (2, 20, 21). Within tumor stroma, IFN{gamma} can induce cytokine and chemokine secretion, including IP-10, an angiostatic protein and a chemoattractant factor for lymphocytes and monocytes (11, 12). Evidence has been obtained to suggest that IFN{gamma} produced by tumor-infiltrating macrophages plays a role in tumor blood vessel destruction (22). Combined treatment of endothelial cells with IFN{gamma} and tumor necrosis factor (TNF)-{alpha} results in synergistic cytotoxic effects, likely important for tumor vasculature destruction (23). IFN{gamma} can also increase the production of TNF by activated macrophages, as well as the expression of TNF-receptors in various cell types (24–26). As a consequence of these effects on tumor vasculature and on cells of the immune system, IFN{gamma} can activate inflammatory/immune responses against established tumors and inhibit tumor growth (27).

The antiproliferative, angiostatic, and immunomodulatory activity of IFN{gamma} make this cytokine an attractive anticancer agent. For this reason, several clinical studies have been done with this cytokine. Unfortunately, the response rates observed in early studies, based on doses that approached the maximal tolerated dose, were very low (28–30). Studies in animal models showed that the antitumor activity of IFN{gamma} exhibits a bell shaped dose-response curve (6). Subsequent studies, carried out in patients, showed that induction of immune-activation markers also exhibit a bell-shaped dose-response curve (31–33). This suggests that optimal biological effects could be induced by doses below the maximum tolerated dose. Interestingly, the results of a phase III study on ovarian cancer patients showed that inclusion of relatively low doses of this cytokine (100 µg) in first-line chemotherapy could prolong progression-free survival (34). Higher response rates were also observed in melanoma patients treated with the low-dose weekly regime compared with higher doses and more frequent schedules (35). However, no difference in outcome was observed in a recent phase III study in patients with renal-cell carcinoma treated with low doses of IFN{gamma} (60 µg/m2 once every week), as compared with placebo (36).

The results of preclinical and clinical studies suggest that attempts to increase the antitumor efficacy by increasing the dose and the exposure to IFN{gamma} could actually result in higher toxicity and lower efficacy, likely because of induction of counterregulatory mechanisms. Therefore, the development of new strategies that overcome the untoward effects of IFN{gamma} and bypass counterregulatory mechanisms could be of great experimental and clinical value.

The biological effects induced by IFN{gamma} on tumor stroma and blood vessels provide the rationale for a tumor vasculature targeting approach. To this aim, we have fused, by recombinant DNA technology, the COOH terminus of murine IFN{gamma} with the NH2 terminus of Gly-Cys-Asn-Gly-Arg-Cys (GCNGRC), a ligand of a CD13 (aminopeptidase N) isoform expressed by angiogenic vessels (37, 38). The CNGRC peptide, previously identified by in vivo panning of peptide-phage display libraries (39), has proven useful for targeting chemotherapeutic drugs, proapoptotic peptides and TNF to tumor blood vessels (38–45). We show here that targeted delivery of minute amounts (picogram doses) of IFN{gamma}-GCNGRC conjugate (called IFN{gamma}-NGR) to tumor vasculature could be a valuable strategy for overcoming major counterregulatory mechanisms and inducing antitumor effects.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cell lines and reagents. EA.hy926 cells (human endothelial cells fused with human lung carcinoma A549 cells (46) were obtained from Dr. Elisabetta Ferrero (San Raffaele H Scientific Institute, Milan, Italy). EA.hy926 cells and murine WEHI-164 fibrosarcoma cells (Sigma-Aldrich, Milan, Italy) were cultured in DMEM (Euroclone, Milan, Italy) supplemented with 2 mmol/L glutamine, 100 units/mL penicillin, 100 µg/mL streptomycin, and 10% fetal bovine serum. Murine RMA lymphoma (47) and B16/F1 melanoma cells were cultured as described previously (48). Monoclonal antibody (mAb) R3-63 (rat anti-mouse CD13; ref. 49) was from Acris Antibodies GmbH (Hiddenhausen, Germany), goat anti-mouse-FITC secondary antibody was from Sigma-Aldrich, mAb Y-3 (mouse anti-H-2Kb) and mAb 19E12 (rat anti-mouse Thy1.1) were provided by Dr. Paolo Dellabona (San Raffaele Scientific Institute, Milan, Italy), and mAb V1q (rat anti-murine TNF) was kindly supplied by Dr. Daniela N. Mannel (University of Regensburg, Germany). Recombinant murine IFN{gamma} was from PeproTech, London, United Kingdom. Human TNF and the CNGRCG-TNF conjugate (NGR-TNF) were prepared as described previously (41).

Preparation of IFN{gamma}-NGR and IFN{gamma}-C136S. The cDNA coding for murine IFN{gamma}-NGR (IFN{gamma}-NGR; IFN{gamma}4-135 fused with the NH2 terminus of SGCNGRC) was obtained by reverse transcriptase-PCR on total RNA purified from the splenocytes of C57BL/6 mice (Harlan, Italy). Before RNA extraction, the splenocytes were stimulated for 20 hours with 10 µg/mL lipopolysaccharide in RPMI (Euroclone) supplemented with 2 mmol/L glutamine, 100 units/mL penicillin, 100 µg/mL streptomycin, 0.25 µg/mL amphotericin-B, and 10% fetal bovine serum. Reverse transcription-PCR was done using the following primers: ATATCTACATATGCACGGCACAGTCATTGAAAGCC (forward primer); TCGGATCCTCAGCAACGGCCGTTGCAGCCGGAGCGACTCCTTTTCCGCTTCCTGAGGC (reverse primer). Primer sequences were designed to include the NdeI and BamHI restriction sites for cloning in pET11 plasmid (Novagen, Madison, WI). The cDNA coding for murine IFN{gamma}-C136S (an IFN{gamma}4-136-mutant with Cys136 replaced with Ser) was prepared by PCR on the IFN{gamma}-NGR plasmid, using ATATCTACATATGCACGGCACAGTCATTGAAAGCC (forward primer) and TCGGATCCTCAGGAGCGACTCCTTTTCCGC (reverse primer), and cloned in pET11.

Both cDNA were expressed in BL21(DE3) E. coli cells (Novagen). The products were purified from cell extracts by ammonium sulfate precipitation and hydrophobic interaction chromatography on Phenyl-Sepharose 6 Fast Flow (Amersham Biosciences Europe GmbH, Freiburg, Germany), followed by ion exchange chromatography on DEAE-Sepharose Fast Flow (Amersham). The products were gel-filtered through an HR-Sephacryl S-300 column (1,025 mL; Amersham) preequilibrated with 150 mmol/L sodium chloride, 50 mmol/L sodium phosphate (pH 7.3), containing 5% sucrose. Fractions corresponding to dimeric products were pooled, filtered through a 0.22 µmol/L filter, and stored at –20°C. All solutions used in the purification steps were prepared with sterile and endotoxin-free water (S.A.L.F. Laboratorio Farmacologico SpA, Bergamo, Italy). Protein concentration was measured using the bicinchoninic acid protein assay reagent (Pierce, Rockford, IL). About 3 to 4 mg of purified proteins were recovered from 1 L of E. coli culture. Protein purity and identity were checked by SDS-PAGE.

Fluorescence-activated cell sorting analysis. Murine B16/F1 melanoma cells were plated in 24-well plates (2 x 105 cells per well in 1 mL of culture medium). After 1 hour, the cells were treated with various amounts of IFN{gamma} or IFN{gamma}-NGR for 20 hours at 37°C, 5% CO2. Expression of MHC class I on cells was then assessed by fluorescence-activated cell sorting analysis as follows: the cells were detached by treatment with trypsin-EDTA, washed and resuspended in 138 mmol/L sodium chloride, 2.7 mmol/L potassium chloride, 10 mmol/L sodium phosphate (pH 7.3; PBS) containing 2% fetal bovine serum and 2 µg/mL mAb Y-3 (anti-H-2Kb) and incubated for 1 hour on ice. After washing with PBS, the cells were incubated with goat anti-mouse-FITC secondary antibody (1:100 in PBS containing 2% FCS, 30 minutes on ice), washed, fixed with 4% formaldehyde in PBS, and analyzed by fluorescence-activated cell sorting.

EA.hy926 cell adhesion assay. Polyvinyl chloride microtiter plates (Falcon code #3912, Becton Dickinson, Franklin Lakes, NJ) were coated with 30 µg/mL IFN{gamma}-NGR or IFN{gamma}-C136S [50 µL/well in 150 mmol/L sodium chloride, 50 mmol/L sodium phosphate (pH 7.3), at 4°C overnight]. After washing with 0.9% sodium chloride, each well was filled with DMEM containing 2% bovine serum albumin (45 minutes at 37°C), to block the uncoated surface, and washed again. EA.hy926 cells in DMEM culture media (100 µL) were then added to the plates (3 x 104 cells per well). After incubation (1-1.5 hours) at 37°C, 5% CO2, unbound cells were removed by washing with DMEM. Adherent cells were fixed with 3% paraformaldehyde, 2% sucrose in PBS (pH 7.3), and stained with 0.5% crystal violet (Fluka Chemie, Buchs, Switzerland). Adherent cells were quantified by measuring the absorbance of each well at 540 nm, using a microplate reader.

Soluble tumor necrosis factor receptor assays. Soluble p55-TNF receptor (sTNF-R1) and soluble p75-TNF receptor (sTNF-R2) in animal sera were measured by ELISA as previously described (50).

In vivo studies. Studies on animal models were approved by the Ethical Committee of the San Raffaele H Scientific Institute and done according to the prescribed guidelines. C57BL/6 mice or BALB/c (Harlan), 8 weeks old, were challenged with s.c. injection in the left flank of 7 x 104 RMA or 106 WEHI-164 living cells, respectively; 6 to 10 days later, mice were treated i.p. with IFN{gamma}, IFN{gamma}-NGR, or IFN{gamma}-C136S solutions (100 µL). All proteins were diluted with 0.9% sodium chloride containing 100 µg/mL endotoxin-free human serum albumin (Farma-Biagini SpA, Lucca, Italy). Tumor growth was monitored daily by measuring tumor volumes with calipers as previously described (51). Animals were sacrificed before tumors reached 1.0 to 1.5 cm in diameter. Tumor sizes are shown as mean ± SE (five animals per group).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Production and characterization of IFN{gamma}-NGR and IFN{gamma}-C136S. Murine IFN{gamma} is a homodimeric protein of 136 residues characterized by the presence of two cysteines in the NH2-terminal region (Cys-Tyr-Cys) and one cysteine at the COOH terminus (52, 53). We have fused the COOH terminus of IFN{gamma}4-135 (lacking the NH2- and COOH-terminal cysteines) to the NH2 terminus of (S)GCNGRC by recombinant DNA technology. NH2-terminal cysteines were omitted and Cys136 was replaced with a serine to reduce the risk of disulfide bridge formation with the GCNGRC targeting domain. The final product was called IFN{gamma}-NGR. In parallel, the IFN{gamma}4-135-C136S mutant (called IFN{gamma}-C136S) was also prepared (see Fig. 1A for a schematic representation of these products). Both proteins were purified by hydrophobic interaction chromatography, ion exchange, and gel-filtration chromatography. Only fractions corresponding to dimeric species were collected during gel-filtration chromatography. The purity and identity of both products were characterized by SDS-PAGE, gel-filtration HPLC, and mass spectrometry. Reducing and nonreducing SDS-PAGE of IFN{gamma}-NGR and IFN{gamma}-C136S showed a single band of about 16 kDa, as expected for monomeric subunits (Fig. 1B). The molecular mass of subunits, as measured by electrospray mass spectrometry, was 16,225.2 ± 2.3 and 15,635.0 ± 1.3 Da, respectively, corresponding to products with unprocessed NH2-terminal methionine (expected 16,225.5 and 15,636.8 Da, respectively). Analytic gel-filtration chromatography showed that IFN{gamma}-NGR and IFN{gamma}-C136S were homogeneous and characterized by a hydrodynamic volume of about 30 to 35 kDa, corresponding to dimers (Fig. 1C).



View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 1. Schematic representation (A), SDS-PAGE (B), and analytic gel-filtration chromatography (C) of IFN{gamma}-NGR, IFN{gamma}-C136S, and IFN{gamma}. SDS-PAGE was done under reducing (+ßMe) and nonreducing (–ßMe) conditions. Analytic gel-filtration chromatography was done using a Superdex 75-HR column (Amersham) pre-equilibrated with 0.15 sodium chloride, 0.05 sodium phosphate buffer (pH 7.3); bars on chromatograms represent the elution volume of molecular weight markers.

 
Biological activity of IFN{gamma}-NGR in vitro. The functional properties of effector and targeting domains of IFN{gamma}-NGR, i.e., the IFN{gamma} and GCNGRC domains, were first investigated using in vitro biological assays. To assess whether the IFN{gamma} domain was functional, we compared the effect of various doses of IFN{gamma}-NGR and IFN{gamma} on MHC class I and II expression on murine B16/F1 cells. Fluorescence-activated cell sorting analysis of treated cells showed that both proteins could induce MHC-I expression with similar potency (Fig. 2A and B). IFN{gamma}-C136S induced MHC-I in a similar manner and similar results were obtained for MHC-II (data not shown). These results indicate that replacement of Cys136 with Ser and fusion of IFN{gamma}-C136S with GCNGRC do not prevent folding, dimerization, or binding to IFN{gamma} receptors.



View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 2. Induction of MHC-I expression on B16/F1 cells by IFN{gamma}-NGR and IFN{gamma}. Cells were preincubated for 20 hours (37°C) with various amounts of IFN{gamma}-NGR or IFN{gamma} and analyzed by fluorescence-activated cell sorting using mAb Y3 (anti-H-2Kb) and fluorescein-goat anti-mouse IgGs. Representative results of B16/F1 cells incubated with 10 ng/mL of IFN{gamma} or IFN{gamma}-NGR (A). Dose-response curve of MHC-I induction after incubation with various amounts of cytokines (B).

 
The accessibility and functional properties of the NGR domain were also investigated. We have previously shown, by immunohistochemical analysis of renal cell carcinoma tissue sections, that peptides and drug conjugates containing the CNGRC motif can inhibit the binding of the anti-human CD13 mAb WM-15 to tumor-associated vessels (38). Competitive binding experiments with IFN{gamma}-NGR and IFN{gamma} showed that IFN{gamma}-NGR, but not IFN{gamma}, could compete the binding of mAb WM-15 to tumor vessels (data not shown), suggesting that IFN{gamma}-NGR could interact with CD13 expressed in tumor vessels. Considering that peptides containing the NGR motif can also interact with {alpha}vß3- and {alpha}5ß1-integrines with low affinity (54, 55) and inhibit {alpha}vß3- and {alpha}vß5-integrin-mediated cell adhesion (56) we have also analyzed the effects of IFN{gamma}-NGR and IFN{gamma}-C136S in a cell adhesion assay. To this aim, the adhesion of endothelial-epithelial EA.hy926 hybrid cells to microtiter wells coated with IFN{gamma}-NGR or IFN{gamma}-C136S was studied (Fig. 3). In parallel, we also analyzed cell adhesion to CNGRCG-TNF (called NGR-TNF), a conjugate with a functional NGR domain (41, 42). As expected, we observed adhesion of EA.hy926 cells to microtiter plates coated with NGR-TNF or IFN{gamma}-NGR, but not with TNF or with IFN{gamma}-C136S (Fig. 3). Cell adhesion was not inhibited by mAb WM15 (data not shown), suggesting that this effect was likely mediated by integrins and not by CD13. These results, collectively, suggest that both IFN{gamma} and CNGRC domains are properly folded and accessible for the interaction with membrane receptors.



View larger version (31K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 3. Adhesion of EA.hy926 cells to solid phases coated with IFN{gamma}-NGR, IFN{gamma}-C136S, NGR-TNF or TNF. Cell adhesion assay was done as described in Materials and Methods (A). Microphotograph of wells coated with 30 µg/mL of IFN{gamma}-NGR, IFN{gamma}-C136S, NGR-TNF, or TNF; x200 (B).

 
Antitumor activity and toxicity of IFN{gamma}-NGR in vivo. The antitumor activity of IFN{gamma}-NGR, IFN{gamma}-C136S, or IFN{gamma} against s.c. RMA lymphoma and WEHI-164 fibrosarcoma was investigated in immunocompetent mice. Various doses of each cytokine, ranging from 0.03 to 5000 ng were given (i.p.) to tumor-bearing C57BL6 (RMA) or BALB/c (WEHI-164) mice. Administration of 0.1 or 0.3 ng of IFN{gamma}-NGR to RMA tumor-bearing mice, 10 days after tumor implantation, was sufficient to induce significant antitumor effects (Fig. 4A and B). The antitumor effect decreased when the dose was increased to 3 or 300 ng (Fig. 4B) or when the dose was decreased to 0.03 ng (data not shown), indicating that the dose-response curve of IFN{gamma}-NGR is bell-shaped. Thus, maximal effects were achieved with 0.1 ng (0.005 µg/kg). No loss of body weight was induced by any tested dose (Fig. 4A and B, bottom). This suggests that IFN{gamma}-NGR could induce antitumor effects without causing major toxic effects. No significant antitumor effects were observed when IFN{gamma} was given at doses ranging from 0.3 to 300 ng (Fig. 4B, middle) or when IFN{gamma}-C136S was used (data not shown).



View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 4. Effect of IFN{gamma}-NGR or IFN{gamma} on tumor growth and animal weight in the RMA model. Animals (five mice per group) bearing RMA-tumors were treated at days 10 and 17 (arrows) with the indicated doses of IFN{gamma}-NGR or IFN{gamma} (i.p.). Tumor volume and animal weight after treatment are reported. A and B represent separate experiments. A (top), {triangleup} versus {blacksquare} (P < 0.005; two-tailed t test at day 18); B (middle), {triangleup} versus {diamondsuit} (P < 0.05; two-tailed t test at day 14).

 
A bell-shaped dose-response curve was also observed in the WEHI-164 model. Again maximal effect was achieved with 0.1 ng of IFN{gamma}-NGR (Fig. 5A), whereas lower effects were induced by 0.3 or 0.9 ng doses (Fig. 5A). Also in this model, the antitumor effect induced by the 0.1 ng dose was not associated with loss of body weight (Fig. 5A, bottom).



View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 5. Effect of IFN{gamma}-NGR or IFN{gamma} on tumor growth and animal weight in the WEHI-164 model. Animals (five mice per group) bearing WEHI-tumors were treated at the indicated times after tumor implantation (arrows) with various doses of IFN{gamma}-NGR or IFN{gamma} (i.p.). Tumor volume and animal weight after treatment are reported. A-C represent separate experiments. A (top), {triangleup} versus {blacktriangleup} (P < 0.05; two-tailed t test at day 15).

 
The effect of repeated administrations was then investigated. Repeated administration of IFN{gamma}-NGR produced different effects depending on dose and time schedule. For instance, we found that the antitumor effects of daily treatment with 0.03 or 0.1 ng were lower than those of biweekly treatments (Fig. 5B). Of note, whereas the first and the second treatment with 0.1 or 0.03 ng induced an antitumor response, the subsequent daily treatments were not effective and inhibited the antitumor response induced by the first treatment (Fig. 5B, bottom). Apparently, repeated treatment also inhibited the spontaneous transient regression observed in control animals from day 14 to day 16 in this experiment (Fig. 5B, bottom). This phenomenon was also observed in another experiment (data not shown).

When the dose of IFN{gamma}-NGR was increased to 5000 ng (given weekly) no significant effects were observed (Fig. 5C, top). IFN{gamma} was virtually inactive at any tested dose (Fig. 5A and C). Overall, these results of in vivo experiments indicate that IFN{gamma}-NGR is endowed with more potent antitumor activity than IFN{gamma} and that the antitumor activity depends on dose and time schedule.

Role of the aminopeptidase N (CD13) in the antitumor activity of IFN{gamma}-NGR. We have shown previously that a CD13 isoform expressed in tumor vessels could function as the main vascular receptor for NGR-TNF, as most of the antitumor activity of this drug is inhibited by an excess of an anti-murine CD13 mAb (mAb R3-63; refs. 38, 41). To investigate the role of CD13 in the antitumor activity of IFN{gamma}-NGR, we have coadministered this conjugate with an excess of the anti-CD13 mAb R3-63 to RMA and WEHI-164 tumor-bearing mice. This antibody inhibited most of the antitumor effects of different doses of IFN{gamma}-NGR (3 and 0.06 ng) in these models (Fig. 6A and C). In contrast, a control antibody (mAb 19E12, anti-Thy 1.1) did not affect the antitumor activity of IFN{gamma}-NGR (Fig. 6A). Although we cannot exclude that integrins could also play a role in vascular targeting, the almost complete inhibition observed after CD13 neutralization suggest that CD13 plays a major role.



View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 6. Effect of neutralizing anti-CD13 (R3-63) and anti-TNF (V1q) mAbs on the antitumor activity of IFN{gamma}-NGR. RMA (A and B) or WEHI-tumor-bearing mice (C and D) were treated at day 10 (RMA) or day 6 (WEHI) with IFN{gamma}-NGR alone or in combination with mAb R3-63 (anti-murine CD13 mAb), or mAb V1q (anti-murine TNF), or mAb 19E12 (anti-murine Thy 1.1, control antibody) at the doses indicated in each (five mice per group). Each mAb was given 2.5 hours before IFN{gamma}-NGR; B, {triangleup} versus {circ} (P < 0.05; two-tailed t test at day 14); C, {triangleup} versus {circ} (P < 0.05; two-tailed t test at day 13).

 
Role of endogenous and soluble tumor necrosis factor receptors. IFN{gamma} and TNF can exert synergistic cytotoxic effects against tumor and endothelial cells (23, 57, 58). Keeping this in mind, we have studied the role of endogenous TNF in the IFN{gamma}-NGR antitumor activity. To this aim, RMA and WEHI-164 tumor-bearing mice were treated with IFN{gamma}-NGR alone or in combination with a neutralizing anti-murine TNF mAb (V1q). This antibody completely inhibited the antitumor effects of IFN{gamma}-NGR in both models, whereas it was inactive when given alone (Fig. 6B and D). Also in this experiment, the control mAb 19E12 did not inhibit the antitumor activity of IFN{gamma}-NGR. These results suggest that endogenous TNF is critical for the antitumor activity of IFN{gamma}-NGR.

Given that soluble p55 and p75 TNF receptors (sTNF-R1 and sTNF-R2, respectively) could inhibit endogenous TNF and consequently inhibit the antitumor activity of IFN{gamma}-NGR, we have addressed the hypothesis that induction of soluble TNF receptors by high doses of IFN{gamma}-NGR contributes to inhibiting its activity. Three hundred nanograms of IFN{gamma}-NGR, but not 3 ng, significantly induced sTNF-R1 and sTNF-R2 shedding in the blood of RMA tumor-bearing mice (Fig. 7B). Thus, the release of sTNF-Rs could be one of the counterregulatory mechanisms that contribute to generate the bell-shaped dose-response curve of IFN{gamma}-NGR. This phenomenon is not a peculiarity of high doses of targeted IFN{gamma}, as nontargeted IFN{gamma} (IFN{gamma}-C136S) could also induce sTNF-R2 shedding (Fig. 7B).



View larger version (18K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 7. Circulating levels of sTNF-R1 and sTNF-R2 in RMA-tumor bearing mice after treatment with IFN{gamma}-NGR or IFN{gamma}-C136S. Animals were treated 10 days after tumor implantation with 0, 3, or 300 ng of IFN{gamma}-NGR (n = 4; A) or 5 µg of IFN{gamma}-C136S alone or in combination with anti-TNF mAb V1q (7 µg, given 2 hours before IFN{gamma}-C136S; n = 5; B). Animal sera were collected 1.5 hours after treatment and serum levels of sTNF-R1 and sTNF-R2 were measured by ELISA.

 
Soluble TNF-R2 shedding in mice can be induced by TNF itself (42). To assess whether shedding of sTNF-Rs was indirectly mediated by endogenous TNF or was a direct consequence of IFN{gamma}, IFN{gamma}-induced shedding of sTNF-R2 was studied in mice pretreated with anti-TNF mAb V1q. As shown in Fig. 7B, IFN{gamma}-C136S-induced shedding of sTNF-R2 was not inhibited by V1q, pointing to a direct mechanism.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
We have found that targeted delivery of low doses of IFN{gamma} to CD13, a marker of angiogenic vessels, can delay tumor growth in murine models that respond poorly to IFN{gamma}. Targeted delivery of IFN{gamma} to CD13 was achieved by coupling the COOH terminus of IFN{gamma} to the NH2 terminus of GCNGRC peptide, a CD13 ligand (37). To avoid potential disulfide bridge formation between cysteine residues present in the GCNGRC targeting domain and in the NH2- and COOH-terminal regions of IFN{gamma} (Cys1, Cys3 and Cys136) we deleted the first three residues of murine IFN{gamma} and replaced Cys136 with Ser. The results of biochemical and in vitro biological studies of the IFN{gamma}4-135-C136S-GCNGRC conjugate (called IFN{gamma}-NGR) showed that the final product was homogeneous and characterized by a dimeric structure with accessible and functional targeting and effector domains (i.e., GCNGRC and IFN{gamma}).

The results of studies on the mechanism of action of IFN{gamma}-NGR suggest that the improved antitumor activity of this conjugate depends on the GCNGRC targeting domain, as originally postulated, and not on the C136S substitution. This view is supported by the following observations: (a) the antitumor activities of IFN{gamma} and IFN{gamma}-C136S (lacking the targeting domain) were similar and very low; (b) the in vivo antitumor activity of IFN{gamma}-NGR was almost completely inhibited by an antibody (mAb R3-63) against CD13, a CNGRC-receptor. These findings, together, support the hypothesis that IFN{gamma}-NGR works via a GCNGRC/CD13-dependent targeting mechanism.

We have previously shown that tumor-associated vessels of human breast carcinoma tissue section and other primary and metastatic tumors could be stained by immunohistochemistry with the anti-CD13 mAb WM15 (38). The finding that IFN{gamma}-NGR can compete mAb WM15 binding to tumor vessels in tissue sections and the notion that RMA tumor cells of our murine model do not express CD13 (41) further support the CD13-mediated vascular targeting hypothesis.

Another important observation of this work is that the dose-response curve of IFN{gamma}-NGR is bell-shaped. Maximal effects were achieved by the administration of 0.1 ng (0.005 µg/kg) of IFN{gamma}-NGR (i.p.) in both RMA-lymphoma and WEHI-164 models, whereas administration of nontargeted IFN{gamma} induced little or no effects over a range of 0.06 to 5000 ng (0.003-250 µg/kg). Attempts to increase the effect of IFN{gamma}-NGR by increasing the dose (up to 250 µg/kg) or by frequent (daily) administration resulted in a decrease of activity.

The bell-shaped dose-response curve is not a peculiarity of targeted IFN{gamma} as a similar behavior has also been reported for nontargeted IFN{gamma} in other animal models and in patients (6, 31–33). However, it is noteworthy that doses of about 2 µg/kg of IFN{gamma} were necessary to induce maximal biological effects in patients and even higher doses (250 µg/kg) were required in mice (6). One explanation for the bell-shaped dose-response curve of IFN{gamma}-NGR is that low doses of this modified cytokine could activate local antitumor effects, by virtue of a targeting mechanism, without activating counterregulatory mechanisms, whereas high doses could induce counterregulatory effects that prevent its potential antitumor activity. The same phenomenon could explain the low response rates observed in animals and in patients treated with IFN{gamma}.

Induction of soluble TNF receptors (sTNF-R) could be one of these counterregulatory mechanisms for the following reasons. Previous clinical studies have shown that treatment of patients suffering from metastasizing renal cell carcinoma with IFN{gamma} induces the release of endogenous TNF into the serum (59). The known synergism between IFN{gamma} and TNF in inducing tumor and endothelial cell cytotoxicity and other antitumor effects suggest that TNF could contribute to the antitumor activity of IFN{gamma} (23, 57, 58, 60–62) . Interestingly, administration of a neutralizing anti-murine TNF mAb (mAb V1q) to our tumor-bearing mice inhibited the antitumor activity of low doses of IFN{gamma}-NGR. Endogenous TNF is, therefore, indeed critical for the antitumor activity of IFN{gamma}-NGR. However, we have also found that high doses of IFN{gamma}-NGR (e.g., 300 ng), but not low doses (3 ng), could induce a significant increase of sTNF-R1 and sTNF-R2 in the circulation. Similarly, high doses of nontargeted IFN{gamma} induced sTNF-Rs. Given that the release of sTNF-Rs is an important counterregulatory mechanism for TNF (63), one possibility is that sTNF-Rs shedding contributes to the bell-shaped dose-response curve of IFN{gamma}-NGR and to the lack of effect by IFN{gamma} in our models. Of course, many other cytokines and counterregulatory mechanisms could be activated by high doses of targeted and nontargeted IFN{gamma}. Nevertheless, the observation that low doses of IFN{gamma}-NGR (0.06 and 3 ng) are sufficient to activate a TNF-dependent antitumor mechanism, whereas high doses (300 ng) are necessary to induce sTNF-Rs shedding implies that antitumor and counterregulatory mechanisms could be uncoupled by the low-dose targeting strategy. This finding offers a new rationale for targeted delivery of very low doses of cytokines to tumors.

The results have also pointed out some important limitations of IFN{gamma}-NGR that deserve to be discussed. As reported for IFN{gamma} by many investigators, we observed that daily treatments with IFN{gamma}-NGR was less effective than biweekly or weekly treatments and that, remarkably, repeated treatment inhibited the response induced by the first treatment. Previous studies have shown that the release of endogenous TNF induced by IFN{gamma} in the serum of patients with renal cell carcinoma is down-regulated by repeated application of the same dose (59). Other studies have shown that prolonged treatment with IFN{gamma} can induce hyporesponsiveness of natural killer activity (7, 64). It is therefore possible that excessive exposure to IFN{gamma}-NGR can induce counterregulatory mechanisms (locally and/or systemically) and/or inhibit ongoing antitumor responses. Remarkably, concern was expressed about rapid disease progression in patients with Kaposi's sarcoma or other tumors repeatedly treated with high doses of IFN{gamma} in early clinical studies (65). In our models, the spontaneous regression occasionally observed in control groups was apparently inhibited in groups repeatedly treated with targeted IFN{gamma}, through an unknown mechanism. Therefore, dosage and schedule of administration could also be very critical for the biological effects of targeted IFN{gamma}, as previously observed for IFN{gamma}. Further work with different schedules of treatment, routes of administration, and combination with other drugs are therefore necessary to further assess the therapeutic potential and limitations of IFN{gamma}-NGR.


   Acknowledgments
 
Grant support: This work was supported by Associazione Italiana Ricerca sul Cancro.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 11/30/04. Accepted 1/28/05.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Farrar MA, Schreiber, RD. The molecular cell biology of interferon-{gamma} and its receptor. Annu Rev Immunol 1993;11:571–611.[CrossRef][Medline]
  2. Boehm U, Klamp T, Groot M, Howard JC. Cellular responses to interferon-{gamma}. Annu Rev Immunol 1997;15:749–95.[CrossRef][Medline]
  3. Gansbacher B, Bannerji R, Daniels B, et al. Retroviral vector-mediated {gamma}-interferon gene transfer into tumor cells generates potent and long lasting antitumor immunity. Cancer Res 1990;50:7820–5.[Abstract/Free Full Text]
  4. Dighe AS, Richards E, Old LJ, Schreiber RD. Enhanced in vivo growth and resistance to rejection of tumor cells expressing dominant negative IFN {gamma} receptors. Immunity 1994;1:447–56.[CrossRef][Medline]
  5. Mumberg D, Monach PA, Wanderling S, et al. CD4(+) T cells eliminate MHC class II-negative cancer cells in vivo by indirect effects of IFN-{gamma}. Proc Natl Acad Sci U S A 1999;96:8633–8.[Abstract/Free Full Text]
  6. Talmadge JE, Black PL, Tribble H, et al. Preclinical approaches to the treatment of metastatic disease: therapeutic properties of rH TNF, rM IFN-{gamma}, and rH IL-2. Drugs Exp Clin Res 1987;13:327–37.[Medline]
  7. Talmadge JE, Tribble HR, Pennington RW, Phillips H, Wiltrout RH. Immunomodulatory and immunotherapeutic properties of recombinant {gamma}-interferon and recombinant tumor necrosis factor in mice. Cancer Res 1987;47:2563–70.[Abstract/Free Full Text]
  8. Qin Z, Blankenstein T. CD4+ T cell-mediated tumor rejection involves inhibition of angiogenesis that is dependent on IFN {gamma} receptor expression by nonhematopoietic cells. Immunity 2000;12:677–86.[CrossRef][Medline]
  9. Dobrzanski MJ, Reome JB, Dutton RW. Immunopotentiating role of IFN-{gamma} in early and late stages of type 1 CD8 effector cell-mediated tumor rejection. Clin Immunol 2001;98:70–84.[CrossRef][Medline]
  10. Wigginton JM, Gruys E, Geiselhart L, et al. IFN-{gamma} and Fas/FasL are required for the antitumor and antiangiogenic effects of IL-12/pulse IL-2 therapy. J Clin Invest 2001;108:51–62.[CrossRef][Medline]
  11. Ikeda H, Old LJ, Schreiber RD. The roles of IFN{gamma} in protection against tumor development and cancer immunoediting. Cytokine Growth Factor Rev 2002;13:95–109.[CrossRef][Medline]
  12. Angiolillo AL, Sgadari C, Taub DD, et al. Human interferon-inducible protein 10 is a potent inhibitor of angiogenesis in vivo. J Exp Med 1995;182:155–62.[Abstract/Free Full Text]
  13. Qin Z, Schwartzkopff J, Pradera F, et al. A critical requirement of interferon {gamma}-mediated angiostasis for tumor rejection by CD8+ T cells. Cancer Res 2003;63:4095–100.[Abstract/Free Full Text]
  14. Hayakawa Y, Takeda K, Yagita H, et al. IFN-{gamma}-mediated inhibition of tumor angiogenesis by natural killer T-cell ligand, {alpha}-galactosylceramide. Blood 2002;100:1728–33.[Abstract/Free Full Text]
  15. Mosmann TR, Coffman RL. TH1 and TH2 cells: different patterns of lymphokine secretion lead to different functional properties. Annu Rev Immunol 1989;7:145–73.[CrossRef][Medline]
  16. Gajewski TF, Schell SR, Nau G, Fitch FW. Regulation of T-cell activation: differences among T-cell subsets. Immunol Rev 1989;111:79–110.[CrossRef][Medline]
  17. Bancroft GJ, Schreiber RD, Bosma GC, Bosma MJ, Unanue ER. A T cell-independent mechanism of macrophage activation by interferon-{gamma}. J Immunol 1987;139:1104–7.[Abstract]
  18. Schreiber RD, Hicks LJ, Celada A, Buchmeier NA, Gray PW. Monoclonal antibodies to murine {gamma}-interferon which differentially modulate macrophage activation and antiviral activity. J Immunol 1985;134:1609–18.[Abstract]
  19. Liew FY, Li Y, Millott S. Tumor necrosis factor-{alpha} synergizes with IFN-{gamma} in mediating killing of Leishmania major through the induction of nitric oxide. J Immunol 1990;145:4306–10.[Abstract]
  20. Basham TY, Merigan TC. Recombinant interferon-{gamma} increases HLA-DR synthesis and expression. J Immunol 1983;130:1492–4.[Abstract]
  21. Basham TY, Nickoloff BJ, Merigan TC, Morhenn VB. Recombinant {gamma} interferon differentially regulates class II antigen expression and biosynthesis on cultured normal human keratinocytes. J Interferon Res 1985;5:23–32.[Medline]
  22. Ibe S, Qin Z, Schuler T, Preiss S, Blankenstein T. Tumor rejection by disturbing tumor stroma cell interactions. J Exp Med 2001;194:1549–59.[Abstract/Free Full Text]
  23. Ruegg C, Yilmaz A, Bieler G, et al. Evidence for the involvement of endothelial cell integrin {alpha}vß3 in the disruption of the tumor vasculature induced by TNF and IFN-{gamma}. Nat Med 1998;4:408–14.[CrossRef][Medline]
  24. Aggarwal BB, Eessalu TE, Hass PE. Characterization of receptors for human tumour necrosis factor and their regulation by {gamma}-interferon. Nature 1985;318:665–7.[CrossRef][Medline]
  25. Ruggiero V, Tavernier J, Fiers W, Baglioni C. Induction of the synthesis of tumor necrosis factor receptors by interferon-{gamma}. J Immunol 1986;136:2445–50.[Abstract]
  26. Tsujimoto M, Yip YK, Vilcek J. Interferon-{gamma} enhances expression of cellular receptors for tumor necrosis factor. J Immunol 1986;136:2441–4.[Abstract]
  27. Blankenstein T, Qin Z. The role of IFN-{gamma} in tumor transplantation immunity and inhibition of chemical carcinogenesis. Curr Opin Immunol 2003;15:148–54.[CrossRef][Medline]
  28. Foon KA, Sherwin SA, Abrams PG, et al. A phase I trial of recombinant {gamma} interferon in patients with cancer. Cancer Immunol Immunother 1985;20:193–7.[Medline]
  29. Quesada JR, Kurzrock R, Sherwin SA, Gutterman JU. Phase II studies of recombinant human interferon {gamma} in metastatic renal cell carcinoma. J Biol Response Mod 1987;6:20–7.[Medline]
  30. Kurzrock R, Rosenblum MG, Sherwin SA, et al. Pharmacokinetics, single-dose tolerance, and biological activity of recombinant {gamma}-interferon in cancer patients. Cancer Res 1985;45:2866–72.[Abstract/Free Full Text]
  31. Kleinerman ES, Kurzrock R, Wyatt D, Quesada JR, Gutterman JU, Fidler IJ. Activation or suppression of the tumoricidal properties of monocytes from cancer patients following treatment with human recombinant {gamma}-interferon. Cancer Res 1986;46:5401–5.[Abstract/Free Full Text]
  32. Weiner LM, Steplewski Z, Koprowski H, Sears HF, Litwin S, Comis RL. Biologic effects of {gamma} interferon pre-treatment followed by monoclonal antibody 17–1A administration in patients with gastrointestinal carcinoma. Hybridoma 1986;5:S65–77.
  33. Aulitzky W, Gastl G, Aulitzky WE, et al. Interferon-{gamma} for the treatment of metastatic renal cancer: dose-dependent stimulation and downregulation of ß-2 microglobulin and neopterin responses. Immunobiology 1987;176:85–95.[Medline]
  34. Windbichler GH, Hausmaninger H, Stummvoll W, et al. Interferon-{gamma} in the first-line therapy of ovarian cancer: a randomized phase III trial. Br J Cancer 2000;82:1138–44.[CrossRef][Medline]
  35. Propper DJ, Chao D, Braybrooke JP, et al. Low-dose IFN-{gamma} induces tumor MHC expression in metastatic malignant melanoma. Clin Cancer Res 2003;9:84–92.[Abstract/Free Full Text]
  36. Gleave ME, Elhilali M, Fradet Y, et al. Interferon {gamma}-1b compared with placebo in metastatic renal-cell carcinoma. Canadian Urologic Oncology Group. New Engl J Med 1998;338:1265–71.[Abstract/Free Full Text]
  37. Pasqualini R, Koivunen E, Kain R, et al. Aminopeptidase N is a receptor for tumor-homing peptides and a target for inhibiting angiogenesis. Cancer Res 2000;60:722–7.[Abstract/Free Full Text]
  38. Curnis F, Arrigoni G, Sacchi A, et al. Differential binding of drugs containing the NGR motif to CD13 isoforms in tumor vessels, epithelia and myeloid cells. Cancer Res 2002;62:867–74.[Abstract/Free Full Text]
  39. Arap W, Pasqualini R, Ruoslahti E. Cancer treatment by targeted drug delivery to tumor vasculature in a mouse model. Science 1998;279:377–80.[Abstract/Free Full Text]
  40. Ellerby HM, Arap W, Ellerby LM, et al. Anti-cancer activity of targeted pro-apoptotic peptides. Nat Med 1999;5:1032–8.[CrossRef][Medline]
  41. Curnis F, Sacchi A, Borgna L, Magni F, Gasparri A, Corti A. Enhancement of tumor necrosis factor {alpha} antitumor immunotherapeutic properties by targeted delivery to aminopeptidase N (CD13). Nat Biotechnol 2000;18:1185–90.[CrossRef][Medline]
  42. Curnis F, Sacchi A, Corti A. Improving chemotherapeutic drug penetration in tumors by vascular targeting and barrier alteration. J Clin Invest 2002;110:475–82.[CrossRef][Medline]
  43. Pastorino F, Brignole C, Marimpietri D, et al. Vascular damage and anti-angiogenic effects of tumor vessel-targeted liposomal chemotherapy. Cancer Res 2003;63:7400–9.[Abstract/Free Full Text]
  44. Zarovni N, Monaco L, Corti A. Inhibition of tumor growth by intramuscular injection of cDNA encoding tumor necrosis factor {alpha} coupled to NGR and RGD tumor-homing peptides. Hum Gene Ther 2004;15:373–82.[Medline]
  45. Colombo G, Curnis F, De Mori GM, et al. Structure-activity relationships of linear and cyclic peptides containing the NGR tumor-homing motif. J Biol Chem 2002;277:47891–7.[Abstract/Free Full Text]
  46. Edgell CJ, McDonald CC, Graham JB. Permanent cell line expressing human factor VIII-related antigen established by hybridization. Proc Natl Acad Sci U S A 1983;80:3734–7.[Abstract/Free Full Text]
  47. Ljunggren HG, Karre K. Host resistance directed selectively against H-2-deficient lymphoma variants. Analysis of the mechanism. J Exp Med 1985;162:1745–59.[Abstract/Free Full Text]
  48. Moro M, Pelagi M, Fulci G, et al. Tumor cell targeting with antibody-avidin complexes and biotinylated tumor necrosis factor {alpha}. Cancer Res 1997;57:1922–8.[Abstract/Free Full Text]
  49. Stryhn Hansen A, Noren O, Sjostrom H, Werdelin O. A mouse aminopeptidase N is a marker for antigen-presenting cells and appears to be co-expressed with major histocompatibility complex class II molecules. Eur J Immunol 1993;23:2358–64.[Medline]
  50. Corti A, Fattorini L, Thoresen OF, et al. Upregulation of p75 tumor necrosis factor {alpha} receptor in Mycobacterium avium-infected mice: evidence for a functional role. Infect Immun 1999;67:5762–7.[Abstract/Free Full Text]
  51. Gasparri A, Moro M, Curnis F, et al. Tumor pretargeting with avidin improves the therapeutic index of biotinylated tumor necrosis factor {alpha} in mouse models. Cancer Res 1999;59:2917–23.[Abstract/Free Full Text]
  52. Gray PW, Goeddel DV. Cloning and expression of murine immune interferon cDNA. Proc Natl Acad Sci U S A 1983;80:5842–6.[Abstract/Free Full Text]
  53. Nagata K, Izumi T, Kitagawa T, Yoshida N. Oligomeric structure of recombinant human and murine immune interferons by means of sedimentation equilibrium. J Interferon Res 1987;7:313–20.[Medline]
  54. Healy JM, Murayama O, Maeda T, Yoshino K, Sekiguchi K, Kikuchi M. Peptide ligands for integrin {alpha}vß3 selected from random phage display libraries. Biochemistry 1995;34:3948–55.[CrossRef][Medline]
  55. Koivunen E, Wang B, Ruoslahti E. Isolation of a highly specific ligand for the {alpha}5ß1 integrin from a phage display library. J Cell Biol 1994;124:373–80.[Abstract/Free Full Text]
  56. Koivunen E, Gay DA, Ruoslahti E. Selection of peptides binding to the {alpha}5ß1 integrin from phage display library. J Biol Chem 1993;268:20205–10.[Abstract/Free Full Text]
  57. Williamson BD, Carswell EA, Rubin BY, Prendergast JS, Old LJ. Human tumor necrosis factor produced by human B-cell lines: synergistic cytotoxic interaction with human interferon. Proc Natl Acad Sci U S A 1983;80:5397–401.[Abstract/Free Full Text]
  58. Fransen L, Van der Heyden J, Ruysschaert R, Fiers W. Recombinant tumor necrosis factor: its effect and its synergism with interferon-{gamma} on a variety of normal and transformed human cell lines. Eur J Cancer Clin Oncol 1986;22:419–26.[CrossRef][Medline]
  59. Aulitzky WE, Aulitzky WK, Frick J, et al. Treatment of cancer patients with recombinant interferon-{gamma} induces release of endogenous tumor necrosis factor-{alpha}. Immunobiology 1990;180:385–94.[Medline]
  60. Hori K, Ehrke MJ, Mace K, Mihich E. Effect of recombinant tumor necrosis factor on tumoricidal activation of murine macrophages: synergism between tumor necrosis factor and {gamma}-interferon. Cancer Res 1987;47:5868–74.[Abstract/Free Full Text]
  61. Sacchi A, Gasparri A, Curnis F, Bellone M, Corti A. Crucial role for interferon-{gamma} in the synergism between tumor vasculature-targeted tumor necrosis factor {alpha} (NGR-TNF) and doxorubicin. Cancer Res 2004;64:7150–5.[Abstract/Free Full Text]
  62. Brouckaert PG, Leroux-Roels GG, Guisez Y, Tavernier J, Fiers W. In vivo anti-tumour activity of recombinant human and murine TNF, alone and in combination with murine IFN-{gamma}, on a syngeneic murine melanoma. Int J Cancer 1986;38:763–9.[Medline]
  63. Aderka D. The potential biological and clinical significance of the soluble tumor necrosis factor receptors. Cytokine Growth Factor Rev 1996;7:231–40.[CrossRef][Medline]
  64. Talmadge JE, Herberman RB, Chirigos MA, et al. Hyporesponsiveness to augmentation of murine natural killer cell activity in different anatomical compartments by multiple injections of various immunomodulators including recombinant interferons and interleukin 2. J Immunol 1985;135:2483–91.[Abstract]
  65. Quesada JR. Biologic therapy with interferon-{gamma}. In: De Vita V, Hellman S, Rosenberg S, editors. Biologic therapy of cancer: principles and practice, Philadelphia: J.B. Lippincott Company; 1995. pp. 435–42.



This article has been cited by other articles:


Home page
 BloodHome page
A. Corti, F. Curnis, W. Arap, and R. Pasqualini
The neovasculature homing motif NGR: more than meets the eye
Blood, October 1, 2008; 112(7): 2628 - 2635.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
F. Curnis, A. Sacchi, A. Gasparri, R. Longhi, A. Bachi, C. Doglioni, C. Bordignon, C. Traversari, G.-P. Rizzardi, and A. Corti
Isoaspartate-Glycine-Arginine: A New Tumor Vasculature-Targeting Motif
Cancer Res., September 1, 2008; 68(17): 7073 - 7082.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. Spitaleri, S. Mari, F. Curnis, C. Traversari, R. Longhi, C. Bordignon, A. Corti, G.-P. Rizzardi, and G. Musco
Structural Basis for the Interaction of isoDGR with the RGD-binding Site of {alpha}v{beta}3 Integrin
J. Biol. Chem., July 11, 2008; 283(28): 19757 - 19768.
[Abstract] [Full Text] [PDF]

Home page
 Drug Metab. Dispos.Home page
H. Rachmawati, C. Reker-Smit, M. N. Lub-de Hooge, A. van Loenen-Weemaes, K. Poelstra, and L. Beljaars
Chemical Modification of Interleukin-10 with Mannose 6-Phosphate Groups Yields a Liver-Selective Cytokine
Drug Metab. Dispos., May 1, 2007; 35(5): 814 - 821.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
F. Curnis, R. Longhi, L. Crippa, A. Cattaneo, E. Dondossola, A. Bachi, and A. Corti
Spontaneous Formation of L-Isoaspartate and Gain of Function in Fibronectin
J. Biol. Chem., November 24, 2006; 281(47): 36466 - 36476.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
T. E. Battle, R. A. Lynch, and D. A. Frank
Signal transducer and activator of transcription 1 activation in endothelial cells is a negative regulator of angiogenesis.
Cancer Res., April 1, 2006; 66(7): 3649 - 3657.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
A. Sacchi, A. Gasparri, C. Gallo-Stampino, S. Toma, F. Curnis, and A. Corti
Synergistic Antitumor Activity of Cisplatin, Paclitaxel, and Gemcitabine with Tumor Vasculature-Targeted Tumor Necrosis Factor-{alpha}
Clin. Cancer Res., January 1, 2006; 12(1): 175 - 182.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)